diff --git "a/deduped/dedup_0121.jsonl" "b/deduped/dedup_0121.jsonl"
new file mode 100644--- /dev/null
+++ "b/deduped/dedup_0121.jsonl"
@@ -0,0 +1,125 @@
+{"text": "We conclude that environmental lead exposure in children who have maximal blood lead levels < 7.5 \u03bcg/dL is associated with intellectual deficits.Lead is a confirmed neurotoxin, but questions remain about lead-associated intellectual deficits at blood lead levels < 10 \u03bcg/dL and whether lower exposures are, for a given change in exposure, associated with greater deficits. The objective of this study was to examine the association of intelligence test scores and blood lead concentration, especially for children who had maximal measured blood lead levels < 10 \u03bcg/dL. We examined data collected from 1,333 children who participated in seven international population-based longitudinal cohort studies, followed from birth or infancy until 5\u201310 years of age. The full-scale IQ score was the primary outcome measure. The geometric mean blood lead concentration of the children peaked at 17.8 \u03bcg/dL and declined to 9.4 \u03bcg/dL by 5\u20137 years of age; 244 (18%) children had a maximal blood lead concentration < 10 \u03bcg/dL, and 103 (8%) had a maximal blood lead concentration < 7.5 \u03bcg/dL. After adjustment for covariates, we found an inverse relationship between blood lead concentration and IQ score. Using a log-linear model, we found a 6.9 IQ point decrement  associated with an increase in concurrent blood lead levels from 2.4 to 30 \u03bcg/dL. The estimated IQ point decrements associated with an increase in blood lead from 2.4 to 10 \u03bcg/dL, 10 to 20 \u03bcg/dL, and 20 to 30 \u03bcg/dL were 3.9 , 1.9 , and 1.1 , respectively. For a given increase in blood lead, the lead-associated intellectual decrement for children with a maximal blood lead level < 7.5 \u03bcg/dL was significantly greater than that observed for those with a maximal blood lead level \u22657.5 \u03bcg/dL ( The preponderance of experimental and human data indicates that there are persistent and deleterious effects of blood lead levels > 10 \u03bcg/dL on brain function, including lowered intelligence, behavioral problems, and diminished school performance . Lead toThere is emerging evidence that lead-associated intellectual deficits occur at blood lead levels < 10 \u03bcg/dL. In the Rochester Longitudinal Study, there was an estimated reduction of 7.4 IQ points associated with an increase in lifetime mean blood lead from 1 to 10 \u03bcg/dL . In a reThe primary objective of this pooled analysis was to estimate the quantitative relationship between children\u2019s performance on IQ tests and selected measures of blood lead concentration among children followed prospectively, from infancy through 5\u201310 years of age in seven prospective cohort studies. We also sought to test whether the lead-associated IQ deficit was greater for a given change in exposure among children who had maximal blood lead levels < 10 \u03bcg/dL compared with children who had higher blood lead concentrations.We contacted investigators for all eight prospective lead cohorts that were initiated before 1995, and we were able to retrieve data sets and collaboration from seven. The participating sites were Boston ; CincinnThe primary outcome measure was the full-scale IQ, which is a composite score of verbal and performance tests. The children were administered a version of the Wechsler Intelligence Scales for Children .To investigate further whether the lead-associated decrement was greater at lower blood lead concentrations, we divided the data at two cut-points 5 \u03bcg/dL) . We thenTo assess the model stability, we employed a random-effects model with sites assumed to be randomly selected from a larger set of populations. Results were similar to the preferred fixed-effects model, with the random-effects model producing a blood lead coefficient that was 3.7% lower (\u22122.6 vs. \u22122.7). As an additional measure of model stability, we fit seven identical log-linear models with each model omitting data from one of the sites. The range of coefficients leaving one site out at a time was \u22122.36 (Rochester) to \u22122.94 (Yugoslavia), or a percent change ranging from \u22122.6 to +8.9%. These analyses provide evidence of the stability of our final preferred fixed-effects model and indicate that the results of the pooled analysis did not depend on the data from any single study.p = 0.196).We also examined the relation of blood lead concentration to verbal and performance IQ scores, adjusting for the same covariates used in the full-scale IQ model. The coefficient for the log of blood lead related to performance IQ was similar to the coefficient for log of blood lead in the full-scale IQ model (\u03b2= \u22122.73 vs. \u22122.70), whereas the coefficient for log of blood lead related to verbal IQ was somewhat lower than the coefficient for the log of blood lead in the full-scale IQ model (\u03b2= \u22122.07 vs. \u22122.70). The difference between the coefficient for verbal and performance IQ was not statistically significant (p = 0.005). After adjusting for the log of concurrent blood concentration, the log of cord blood lead was no longer associated with children\u2019s IQ scores (p = 0.21). In contrast, the log of concurrent blood lead was significantly associated with children\u2019s IQ scores even with log cord blood lead concentration in the model . Finally, we identified and removed 65 potentially influential observations from the data and refit the model. The change in the coefficient for log of blood lead was 1.4%, from \u22122.70 to \u22122.74.We did not identify any significant interactions between the covariates and the log of concurrent blood lead. In the U.S. sites, race was not significantly associated with IQ after inclusion of the four covariates in the preferred model, nor did it alter the estimated relationship of blood lead concentration and IQ. In unadjusted analyses involving the 696 children who had cord blood lead levels, the log of cord blood lead concentration was significantly associated with child\u2019s IQ  or early childhood blood lead concentration. Although this finding conflicts with the widely held belief that 2-year (or peak) blood lead levels are the most salient measure of lead toxicity, there is increasing evidence that lifetime mean blood lead and concurrent blood lead levels are stronger predictors of IQ in older children . The strThe specific mechanisms for lead-induced intellectual deficits have not been fully elucidated. There are several plausible mechanisms for the greater lead-associated intellectual deficits observed at blood lead levels < 10 \u03bcg/dL , but it The observational design of this study limits our ability to draw causal inferences. Instead, we must rely on the consistency of findings from numerous epidemiologic and experimental studies in rodents and nonhuman primates, including evidence that environmental lead exposure is associated with intellectual deficits at blood lead levels < 10 \u03bcg/dL. There are potential limitations of the tools we used to measure important covariates. The HOME Inventory was not conducted at the same age for children in all of the sites, and the HOME Inventory and IQ tests have not been validated in all cultural or ethnic communities. Nonetheless, because these covariates were standardized and adjusted for study site, these problems do not pose any limitations to the interpretation of the pooled analysis results. There are other predictors of neurodevelopmental outcomes that we did not examine in this pooled analysis, such as maternal depression. The omission of unmeasured variables may produce residual confounding . Still, The impact of low-level environmental lead exposure on the health of the public is substantial. This pooled analysis focused on intellectual deficits, but environmental lead exposure has been linked with an increased risk for numerous conditions and diseases that are prevalent in industrialized society, such as reading problems, school failure, delinquent behavior, hearing loss, tooth decay, spontaneous abortions, renal disease, and cardiovascular disease . AlthougIn conclusion, the results of this pooled analysis underscore the increasing importance of primary prevention as the consequences of lower blood lead concentrations are recognized. Although blood lead concentrations < 10 \u03bcg/dL in children are often considered \u201cnormal,\u201d contemporary blood lead levels in children are considerably higher than those found in pre-industrial humans . Moreove"}
+{"text": "We also observed significant interactions of blood lead and tibia lead with diabetes in relation to baseline SCr levels (tibia lead only) and follow-up SCr levels. A significant interaction of tibia lead with hypertensive status in predicting annual change in SCr was also observed. We conclude that longitudinal decline of renal function among middle-age and elderly individuals appears to depend on both long-term lead stores and circulating lead, with an effect that is most pronounced among diabetics and hypertensives, subjects who likely represent particularly susceptible groups.In this prospective study, we examined changes in renal function during 6 years of follow-up in relation to baseline lead levels, diabetes, and hypertension among 448 middle-age and elderly men, a subsample of the Normative Aging Study. Lead levels were generally low at baseline, with mean blood lead, patella lead, and tibia lead values of 6.5 \u03bcg/dL, 32.4 \u03bcg/g, and 21.5 \u03bcg/g, respectively. Six percent and 26% of subjects had diabetes and hypertension at baseline, respectively. In multivariate-adjusted regression analyses, longitudinal increases in serum creatinine (SCr) were associated with higher baseline lead levels but these associations were not statistically significant. However, we observed significant interactions of blood lead and tibia lead with diabetes in predicting annual change in SCr. For example, increasing the tibia lead level from the midpoints of the lowest to the highest quartiles (9\u201334 \u03bcg/g) was associated with an increase in the rate of rise in SCr that was 17.6-fold greater in diabetics than in nondiabetics (1.08 mg/dL/10 years vs. 0.062 mg/dL/10 years;  An association between lead poisoning and renal disease in humans has been recognized for more than a century . NumerouBlood lead, which mostly reflects relatively recent exposure, is an inadequate measure of total body burden of lead, which may explain why most of the previous observational studies failed to find a significant association between low-level lead exposure and renal function impairment. Compared with concurrent blood lead, bone lead, which comprises > 95% of adult body lead burden and has a biologic half-life ranging from years to decades, is a better biologic marker for studying chronic toxicity of accumulated exposure and lead burden . In addiGiven that an increase in bone resorption is a characteristic of aging in both men and women, aging-associated release of bone lead into the circulation is a potentially important source of soft-tissue lead exposure and toxicity. Another factor associated with aging that may increase the nephrotoxicity of lead is diabetes. The more prevalent form, type 2 diabetes, affects approximately 10% or more of the general population   and is wIn the present study, we used data from a cohort of middle-age and elderly men who had no previous known heavy lead exposure to examine the effects of low-level bone and blood lead levels on renal function. We also examined the potential modifying effect of diabetes and hypertension on these relationships.a) used oral hypoglycemic drugs, b) used insulin, or c) reported a physician\u2019s diagnosis of diabetes whether or not they used diabetic drugs for treatment.Study participants were from the Normative Aging Study (NAS), a longitudinal study of aging established by the Veterans Administration in 1961 . The stuA blood sample for lead analysis has been collected at each NAS visit since July 1988. Beginning in August 1991, NAS participants were recruited for a substudy of K X-ray fluorescence (KXRF) bone lead measurement. Subjects included in the present investigation were those who participated in the KXRF bone lead substudy with concurrent blood lead, SCr, body mass index (BMI), alcohol intake, and blood pressure data and a follow-up measurement of SCr at least 4 years later.All research performed in the present study was approved by the Human Research Committees of Brigham and Women\u2019s Hospital and the Department of Veterans Affairs Outpatient Clinic.Bone lead was measured in each subject\u2019s midtibia shaft and patella with a KXRF instrument . The tibia and patella have been targeted for bone lead research because they consist mainly of cortical and trabecular bone, respectively. A technical description and the validity specifications of this instrument have been published elsewhere . The KXRWhole-blood samples were obtained and analyzed for lead by graphite furnace atomic absorption with Zeeman background correction . Values below the minimum detection limit of 1 \u03bcg/dL were coded as 0. The instrument was calibrated with National Institute of Standards and Technology Standard Reference Material  after every 20 samples. Ten percent of samples were run in duplicate; at least 10% of the samples were controls, and 10% were blanks. In tests on reference samples from the Centers for Disease Control and Prevention , precision [coefficient of variation (CV)] ranged from 8% for concentrations 10\u201330 \u03bcg/dL to 1% for higher concentrations. Compared with an NIST target of 5.7 \u03bcg/dL, 24 measurements by this method gave a mean \u00b1 SD of 5.3 \u00b1 1.23 \u03bcg/dL.SCr concentration was determined by a computerized automatic analyzer  at each examination. The analyzer measures creatinine based on the Jaffe procedure  and demot-test to compare participants included in the analysis with eligible nonparticipants. Because many of the variables had skewed distributions, we used the nonparametric Wilcoxon signed-rank test for continuous variables to compare their distributions between baseline and follow-up visit. The main outcome of interest, annual change in SCr (milligrams per deciliter per year) was defined as (follow-up SCr \u2013 baseline SCr)/years of follow-up.We used chi-square analysis and Student\u2019s We used multiple linear regression analyses to determine the associations between baseline lead biomarkers  and annual change in SCr. Because lead levels in blood and bone were skewed toward the upper end, we used lead biomarkers in the natural log scale to improve stability over the whole range of lead levels. The following variables at baseline were considered for possible inclusion in the models: age, BMI, baseline SCr, diabetic status, hypertensive status, smoking history [smoking status (ever/never) and cumulative smoking in pack years], alcohol consumption, and use of analgesic medication and diuretic medication. Alcohol consumption was analyzed both as a continuous variable (grams per day) and as a categorical variable: nondrinkers, light to moderate drinkers (< 20 g/day), and heavy drinkers (\u2265 20 g/day).1(ID1) + \u03b22(ID0 \u00d7 mean-centered lead) + \u03b23 (ID1 \u00d7 mean-centered lead) + (other covariates), where ID0 = 1 if nondiabetes (reference group), 0 otherwise; ID1 = 1 if diabetes, 0 otherwise. We used this model to get the slopes for the two groups and their statistical significance. We constructed a second multiple regression model containing all main effects and a two-way interaction between diabetic status and natural-log\u2013transformed baseline lead bio-markers. The model is expressed as annual change in SCr = intercept + \u03b21(ID1) + \u03b22(mean-centered lead) + \u03b23 (ID1 \u00d7 mean-centered lead) + (other covariates), where ID1 = 1 if diabetes, 0 otherwise. The second model was to do the statistical test of the interaction. If \u03b23 differs significantly from zero, then diabetes is a significant effect modifier. The inclusion of specific covariates in the final multiple linear regression models was based on statistical and biologic considerations. To minimize the possibility of reverse causation, we repeated the analyses of annual change in SCr after excluding subjects with a high SCr at baseline, as defined by a value > 1.5 mg/dL. In addition, we examined the cross-sectional associations of baseline lead biomarkers with SCr measured at baseline and follow-up visits. The same set of confounders was considered for possible inclusion in the cross-sectional analyses of SCr.To examine the modifying effect of diabetes on the nephrotoxicity of lead, we constructed models of the hypothesized interaction of lead with diabetes as follows: Annual change in SCr = intercept + \u03b2We used the same approach to examine the modifying effect of hypertension on the nephrotoxicity of lead. Analyses were conducted using the Statistical Analysis System .p = 0.03 from Wilcoxon rank-sum test).An initial group of 707 NAS subjects who participated in the KXRF substudy between 1991 and 1995 and who had complete data on lead biomarkers, SCr, BMI, alcohol intake, medication use history, and diagnoses and blood pressure measurements were identified as eligible study subjects at baseline. Among them, 448 subjects had a follow-up measurement of SCr at, on average, 6 years later . Selected characteristics of the 448 subjects at baseline and at follow-up are shown in p < 0.05).The nonparametric Wilcoxon signed-rank test showed that the mean follow-up SCr (1.06 mg/dL) was significantly lower than the mean baseline SCr (1.25 mg/dL), and blood lead levels decreased significantly over time in this population . Excluding this group from the analysis did not change the observed associationsThere was no interaction of alcohol consumption or smoking with lead biomarkers in determining annual change in SCr. Assessment for a potential interaction between race and lead exposure in determining annual change in SCr was limited by small numbers  with prospective follow-up measures and annual change in SCr were observed among subjects with diabetes. We also observed significant positive associations of blood lead with prospective annual change in SCr among diabetics and cross-sectional increases in SCr (at the follow-up exam) among nondiabetics. Associations of higher blood lead with poorer renal function have been described elsewhere among non-occupationally exposed populations. A positive correlation between SCr concentration and blood lead levels was found in a survey of men in the British civil service . In geneThe analysis of lead, hypertension, and SCr indicates that both the association between follow-up blood lead with follow-up measures of SCr and the association between tibia lead and prospective annual change in SCr were significantly modified by hypertensive status, with hypertensive subjects having stronger and more significant associations. A recent analysis from the Third National Health and Nutrition Examination Survey (NHANES III) also showed a significant association of higher blood lead levels with chronic kidney disease and elevated SCr among hypertensives. Relationships among lead exposure, impaired renal function, and hypertension are complex: Lead exposure has been associated with an increased risk of hypertension, and essential hypertension, in turn, is a well-established risk factor for kidney disease. Whether lead affects blood pressure indirectly through alterations in kidney function or via more direct effects on the vasculature or neurologic blood pressure control is unknown. The interaction of hypertension, lead, and kidney function merits further investigation in a prospective cohort.Studies of lead body burden estimated by EDTA mobilization tests have revealed a correlation of high body lead burden with declines in renal function . There hHowever, there are several limitations to our findings. In the absence of diabetes or hypertension, we did not see statistically significant associations of bone lead levels with either cross-sectional or longitudinal measures of renal function. Our study population was not occupationally exposed and therefore had relatively low lead levels, whereas the clearest associations of lead with decrements in renal function have been demonstrated among heavily exposed populations. Although SCr is a widely used measure of renal function in clinical medicine, it provides only a rough estimate of glomerular function. Increases in SCr are relatively insensitive to declining glomerular filtration and are evident  only when kidney function has been reduced by about 50%. Therefore, low exposures and the relative insensitivity of our outcome measure may have limited our ability to detect more modest lead effects. Furthermore, we observed an unexpected overall decline in SCr over time in this population. SCr is a function of muscle mass and diet, as well as the glomerular filtration rate. A possible explanation for the lower follow-up SCr we observed includes decreased creatinine generation attributable to reduced muscle mass as a result of aging or reduced meat intake. However, SCr level was not associated with total energy-adjusted protein intake either at baseline or at the follow-up in the present study. Therefore, protein intake did not appear to confound the relation of SCr with lead exposure. Baseline and follow-up SCr were measured using the same technique and established standards and calibration methods, making measurement drift an unlikely explanation for lower follow-up values.In addition, our diagnostic criteria for diabetes may misclassify individuals. However, this type of misclassification is likely to be non-differential with respect to the null hypothesis of no association, because nondiabetic individuals who had high or low lead exposure (and high or low SCr) would be equally likely to be misclassified as diabetic. The same is true regarding diabetic individuals being misclassified as nondiabetics. Such a nondifferential misclassification will tend to drive the overall effect toward a null finding (attenuated parameter estimates) but will not drive a true null finding toward an effect.Our findings do not necessarily exclude the alternative hypothesis that elevated bone (or blood) lead levels were a result of impaired renal function. However, studies have shown that body lead burden was not elevated among patients with renal insufficiency or chronic renal failure if they did not have a history of childhood plumbism or high lead exposure . For theAlthough tibia lead was clearly associated with longitudinal decrements in renal function among the study\u2019s diabetics, patella lead was not. Differential sensitivity of tibia versus patella lead in predicting health outcomes has been observed previously  and may Several factors related to blood and bone lead levels, including age, cigarette smoking, and alcohol consumption are potential confounders of the lead\u2013SCr relationship. However, SCr level was not associated with age, cigarette smoking, or alcohol use in the present study. Therefore, these factors did not appear to confound the relation of SCr with lead exposure.In summary, our findings suggest that both blood lead and cumulative lead burden, reflected by tibia  bone lead levels, are predictors of prospective increases in SCr among middle-age and elderly men with diabetes or hypertension. To our knowledge, no previous studies have reported an analysis of the potential for diabetes to modify the relationship between lead exposure and renal function. Such an interaction may be related to the joint effect of the glomerular pathology associated with diabetes and the tubular atrophy and interstitial nephritis/fibrosis associated with lead. Given how common a history of environmental or occupational lead exposure is among adults and the high prevalence (and growing incidence) of type 2 diabetes in the general population, an interaction as suggested in this study would be of significant public health importance if confirmed. Additional research in this area\u2014both epidemiologic and experimental involving, for example, the diabetic rat\u2014would be helpful."}
+{"text": "Blood lead concentrations among children aged 6 years and younger become a concern at 10 \u00b5g/dL (0.48 \u00b5mol/L) or higher. The authors' objective was to determine whether initial blood lead concentrations of 10\u201319 \u00b5g/dL (0.48\u20130.96 \u00b5mol/L) declined among children aged 3 years and younger and whether the magnitude of decline was associated with the case management protocol of the state or local childhood lead poisoning prevention program.The authors analyzed childhood blood lead surveillance data from 1994 through 1995 and case management protocols from six states that reported the results of all blood lead tests. The study included 2109 children aged 2 years or younger who had a venous blood lead concentration of 10\u201319 \u00b5g/dL (0.48\u20130.96 \u00b5mol/L) and a follow-up venous blood lead test within 3 to 12 months.Overall, blood lead concentrations increased by 0.25 \u00b5g/dL (0.01 \u00b5mol/L) between the time of the initial elevated blood lead test and the follow-up test, but concentrations declined by 1.96 \u00b5g/dL (0.09 \u00b5mol/L) among children covered by a case management protocol that included a home visit and by 0.92 \u00b5g/dL (0.04 \u00b5mol/L) among those covered by a protocol that included a lead source investigation. The decline remained significant after we adjusted for the child's age.These findings suggest that childhood lead prevention programs should consider focusing their efforts on home visits and lead source investigations. Children are exposed to lead from multiple sources, including lead-based paint and lead-contaminated dust. This exposure can have chronic consequences. Preschool children with blood lead concentrations greater than 9 \u00b5g/dL 0.43 \u00b5mol/L) have lower intelligence and more performance problems on average than do children who are unexposed to lead ,2. Resea \u00b5mol/L hIn 1991, the Centers for Disease Control and Prevention (CDC) designated blood lead concentrations of 10 \u00b5g/dL 0.48 \u00b5mol/L) or higher as the level of concern for children aged 6 years and younger. Children were not considered to need environmental or medical intervention unless their blood lead concentration was 20 \u00b5g/dL 0.97 \u00b5mol/L) or higher , but the effect of these case management protocols on children's blood lead concentrations is unknown. We analyzed childhood blood lead surveillance data from six states to examine changes in blood lead concentrations among children aged 2 years and younger to determine whether there was any relationship with case management protocol. We examined the following questions:Does blood lead concentration decline after an initial venous blood lead test result of 10\u201319 \u00b5g/dL (0.48\u20130.96 \u00b5mol/L)?If so, is the size of the decline associated with state or local case management protocol?Does the effect of the case management protocol differ if the initial blood lead concentration is between 10\u201314 \u00b5g/dL (0.48\u20130.71 \u00b5mol/L) or between\u00a015\u201319 \u00b5g/dL (0.72\u20130.96 \u00b5mol/L)?Does the effect of case management protocol remain after controlling for a child's demographic characteristics?We defined a case of borderline elevated blood lead concentration as a venous blood lead concentration of 10\u201319 \u00b5g/dL (0.48\u20130.96 \u00b5mol/L), regardless of the case definition used by state and local lead poisoning prevention programs. The case management protocol for a state or county was defined as the method of contact required under the protocol  and the type of service to be delivered under the protocol  for children with a given blood lead concentration. Each child with blood lead concentrations of 10\u201319 \u00b5g/dL (0.48\u20130.96 \u00b5mol/L) was assigned a method of contact and a type of service according to information on case management protocol provided by the coordinator of each state lead poisoning prevention program. One state, Wisconsin, provided county-level information. Children were assumed to have received the services called for under the case management protocol of their state or county of residence.Children's demographic information and blood lead test data came from CDC's childhood blood lead database, which is compiled from state childhood blood lead surveillance data . Test reIn 1996, guidelines for blood lead screening changed. Under the new guidelines, targeted screening of children in high risk areas and populations was recommended instead of universal screening \u2014 a change that altered the population of children who were tested. We limited our analysis to children who had an initial venous blood lead test concentration of 10\u201319 \u00b5g/dL (0.48\u20130.96 \u00b5mol/L) before they were aged 2 years and who had at least one follow-up venous blood test 3 to 12 months after their initial test. These parameters were selected to ensure sufficient time for interventions to affect blood lead concentrations, to examine the long-term effects of the interventions, and to allow for varied case management protocols. Although a follow-up test within this period was recommended for all children with a venous blood lead concentration of 10\u201319 \u00b5g/dL (0.48\u20130.96 \u00b5mol/L), the timing of the follow-up test varied by case management protocol. The test could be either a venous or a capillary test . We limit tests to test for significant changes. We stratified our analysis by blood lead concentration because we expected the magnitude of any decline in blood lead concentration to be related to the initial concentration.We computed the change in blood lead concentration for a child as the difference between the blood lead concentration at the first elevated venous test and the concentration at the first venous follow-up test completed 3 to 12 months after the initial elevated test.\u00a0We calculated mean changes as the average of individual changes for the group and used paired We used Kruskal-Wallis tests to compare mean changes in blood lead concentrations, analysis of variance (ANOVA) to compare the mean number of months needed for blood lead concentrations to decline to less than 10 \u00b5g/dL (0.48 \u00b5mol/L), and the Mantel-Haenszel chi-square test to determine differences in the proportion of children whose blood lead concentration was less than 10 \u00b5g/dL (0.48 \u00b5mol/L) at the end of follow-up. We examined the relationship between case management protocol and changes in blood lead concentration over the entire follow-up period and controlled for the age of the child with generalized linear modeling. Quadratic splines with knots at 20, 50, and 80 percentiles for each variable allowed the relationship between a child's age at the initial test, or during the time between tests, and blood lead concentration to differ for different ages or time spans. All the venous blood test results available for a child were used in generalized equalizing equation modeling with autoregressive correlation to examine the longitudinal relationship between case management protocol and blood lead concentration. We controlled for age at the initial and follow-up tests. We used SAS Version 8  for all analyses .The children in this study were served by childhood lead poisoning prevention programs that provided parental education by mail (78%), telephone (21%), or home visits (<1%) when a child's blood lead concentration was 10\u201314 \u00b5g/dL (0.48\u20130.71 \u00b5mol/L). Forty-eight percent of children in the study were served by childhood lead poisoning prevention programs that also provided parental education by mail when a child's blood lead concentration was 15\u201319 \u00b5g/dL (0.72\u20130.96 \u00b5mol/L). The other 52% were covered by childhood lead poisoning prevention programs that provided home visits. Eighty-four percent of the children were covered by programs that provided education alone and 16% by programs that provided investigations of the source of lead exposure .Forty percent of children in the study were aged 13 months and younger when they had their first elevated blood lead test result . A publiOn average, blood lead concentrations increased by 0.25 \u00b5g/dL (0.01 \u00b5mol/L) between the first elevated venous blood lead test and the first follow-up test done 3 to 12 months after the initial elevated test. The direction and magnitude of change in blood lead concentration varied by the child's age at the initial elevated test, whether a public or private entity paid for the test, the child's race or ethnicity, and state of residence. Blood lead levels declined, on average, among older children, those whose test was paid for by private funds, those who were not white or Hispanic, and residents of states other than Ohio and Wisconsin. The sex of the child was not associated with changes in blood lead concentrations .Overall, blood lead concentrations declined most among children whose case management protocol called for a home visit . Blood lThe contrast between protocols was even more striking for children whose initial blood lead concentration was 10\u201314 \u00b5g/dL (0.48\u20130.71 \u00b5mol/L). The association with type of contact was less marked for children whose initial blood lead concentration was 15\u201319 \u00b5g/dL (0.72\u20130.96 \u00b5mol/L), and there was no overall difference between blood lead concentrations among children receiving mailed educational materials and those receiving a lead source investigation . Blood lAmong children with initial blood lead concentrations of 15\u201319 \u00b5g/dL (0.72\u20130.96 \u00b5mol/L) who received a home visit, blood lead concentrations of those who received mailed educational materials declined by 2.49 \u00b5g/dL (0.12 \u00b5mol/L), a larger decline than that of those who received lead source investigations 0.72 \u00b5g/dL (0.03 \u00b5mol/L) (data not shown). The difference remained after we adjusted for a child's age but was not significant at later tests.We did not control for race, ethnicity, and payment source in these models because of missing data; only 23% of records included information on these variables. When we fit models including race and payment source, we found that home visits and lead source investigations among children with initial blood lead concentrations of 10\u201314 \u00b5g/dL (0.48\u20130.71 \u00b5mol/L) were still associated with a significant decline in blood lead concentrations between the time of initial test and first follow-up test, but telephone contact was not significant (data not shown). Including these variables did not change any longitudinal effects significantly.Blood lead concentrations declined to less than 10 \u00b5g/dL (0.48 \u00b5mol/L) by the last reported test among 43% of children whose initial blood lead concentration was 10\u201314 \u00b5g/dL (0.48\u20130.71 \u00b5mol/L) and among 23% of children whose initial blood lead concentration was 15\u201319 \u00b5g/dL (0.72\u20130.96 \u00b5mol/L) . On averWe found that home visit protocols were associated with a larger decline in blood lead concentrations than mail or telephone contact protocols, regardless of a child's initial blood lead concentration. Mailed educational materials alone were not associated with lower blood lead concentrations.There are several possible limitations to our study. One is that we may have underestimated the effects of case management protocol. Another is that tested children may not have actually received the services called for by the lead poisoning prevention program in their area. We also had no information on the details of interventions and how these may differ among programs. State laws require the reporting of blood lead tests, but some results, especially those below 10 \u00b5g/dL (0.48 \u00b5mol/L) or conducted by out-of-state laboratories, may not have been reported or linked to an appropriate child.\u00a0We used the first venous test performed at least 3 months after the index test of 10\u201319 \u00b5g/dL, but we included children who had at least one follow-up test up to 12 months. Blood lead concentrations among children who had more time between the initial test and the follow-up test would have more time to decline, and this effect could bias our results.\u00a0The analyses that controlled for the timing of tests, however, should not be affected by this limitation.The effect of other limitations is less clear. We had no information on many variables, such as iron or calcium intake, that affect blood lead concentrations. Demographic characteristics were missing for many children. We cannot determine how results may have differed if we had been able to control for race and payment source, but results of analyses that included these variables were similar to ones that did not. For these factors to affect our results, however, they would have to be associated with both the case management protocol of the state or county childhood lead poisoning prevention program and with changes in a child's blood lead concentration. Although many factors are associated with an initial elevated blood lead concentration, few have been found to affect changes in blood lead concentration -20. Our Surveillance data result from tests performed at the request of a child's parents or physician, and circumstances for these children may differ from circumstances of children who are not tested. This limitation may affect the applicability of our findings to other children. Parents of children who had an elevated blood lead test result but who did not take their children for follow-up tests may be less likely to implement measures to control lead exposure than parents of children who did receive follow-up tests. If this is true, we would expect all case management protocols to be less effective in children overall than we found among children in our study.The total amount of lead stored in tissues in a child's body can affect blood lead concentrations and obscure the efficacy of interventions. Lead is released during bone turnover until all the stored lead has been released from tissues. Rust et al estimated that among children aged 2 years and younger, bone lead stores could elevate blood lead concentrations for up to 1 year after all sources of lead exposure were removed . Bone leOur study has several strengths in relation to other studies of interventions to reduce blood lead concentrations. We had a large sample, which allowed us to detect small effects on blood lead concentrations, and a diverse study population in terms of race and ethnicity, population density, and geographic region. Our blood lead tests were linked by child and allowed us to compare changes in an individual's blood lead concentration instead of an average for a group.We identified five randomized trial studies that examined the effectiveness of interventions to reduce blood lead concentrations among children who had concentrations of less than 20 \u00b5g/dL (0.97 \u00b5mol/L) ,18,22,23All of these other studies measured the change in group mean blood lead concentrations. We measured the change in blood lead concentrations for individual children. The decline in blood lead concentrations among children in our study who received home visits [\u22121.96 \u00b5g/dL (0.09 \u00b5mol/L)], however, was within the range of changes in blood lead concentrations among these control groups.Schultz et al, in a study of children followed by a local lead poisoning prevention program, examined the average changes in blood lead concentrations before and after the program implemented home education visits among children who had initial blood lead concentrations of 20\u201324 \u00b5g/dL (0.97\u20131.16 \u00b5mol/L) . These aThe decline in blood lead concentrations among children covered by a case management protocol that included a home visit was larger and faster than predicted by Neimuth and Schultz for children not receiving interventions . For chiRoberts et al estimated the time that would be required for blood lead concentrations to decline to less than 10 \u00b5g/dL (0.48 \u00b5mol/L) among children who received no intervention. In our study, the time required for initial blood lead concentrations of 10\u201314 \u00b5g/dL (0.48\u20130.71 \u00b5mol/L) to decline to less than 10 \u00b5g/dL (0.48 \u00b5mol/L) among children covered by home visit protocols was similar to that estimated by Roberts et al for children with blood lead concentrations in this range who received no intervention . Among cSome clinicians have questioned the value of following children with blood lead concentrations of less than 15 \u00b5g/dL (0.72 \u00b5mol/L) . Althoug"}
+{"text": "A 45-year-old woman was referred to the Department of Occupational and Environmental Health in January 2002 because of increased blood lead concentrations of unknown origin. She suffered from malaise, fatigue, and diffuse gastrointestinal symptoms. She had a blood lead level of 550 \u03bcg/L . The patient had not been occupationally exposed to lead, and no potential lead sources, such as food products or lead-glazed pottery, could be identified. Her food habits were normal, but she did consume game occasionally. Clinical examination, including standard neurologic examination, was normal. No anemia was present. Laboratory tests showed an increased excretion of lead in the urine, but there were no signs of microproteinuria. An abdominal X ray in October 2002 revealed a 6-mm rounded metal object in the colon ascendens. Before the object could be further localized, the patient contracted winter vomiting disease (gastroenteritis) and the metal object was spontaneously released from the colon during a diarrhea attack. The object was a lead shot pellet, possibly but not normally used in Sweden for hunting wild boar or roe deer. Blood lead levels slowly decreased. Nine months later the patient\u2019s blood lead levels were almost normal (~ 70 \u03bcg/L) and her symptoms had almost completely disappeared. In this case, a rare source of lead exposure was found. In investigations of blood lead elevations of unknown origin, we recommend abdominal X ray in parallel with repeated blood lead determinations. A 45-year-old woman who had suffered from gastrointestinal (GI) symptoms similar to irritable bowel disease since adolescence sought a private practitioner in 1991 when she suspected medical problems from amalgam dental fillings. In addition to the bowel symptoms, she suffered from fatigue. An analysis of the metal content in the patient\u2019s feces showed considerably increased concentrations of mercury, cadmium, and lead. In 1992 she was referred to the Department of Occupational and Environmental Medicine of Huddinge Hospital, Stockholm, Sweden, for further investigation. No source of occupational or environmental metal exposure was identified, and the patient showed blood concentrations of mercury and cadmium within normal ranges. The patient\u2019s blood lead concentration was 100 \u03bcg/L. The reference level used by the analytical laboratory at that time was < 145 \u03bcg/L. The analysis of metals in feces is considered much more unreliable than levels in blood, and the physician concluded that there was no evidence of environmental exposure to lead, mercury, or cadmium. Chelation therapy with dimercaptosuccinic acid (DMSA), which had been initiated by the practitioner in 1991, was continued for 2 years. The patient received oral treatment two to three times per week, but we do not know the exact dose. Symptoms were mainly unchanged during the treatment period.In August 2001 when the patient saw another physician, a moderately increased blood lead level of 210 \u03bcg/L was found . At that time, the DMSA medication was started again, and she was referred to the Department of Occupational and Environmental Health in Stockholm. A repeated blood lead sample in December 2001 showed an even higher blood lead concentration of 550 \u03bcg/L.This patient was born in Germany in 1956 and moved to Sweden in the mid-1970s. During 1980\u20131994 she gave birth to eight children, the last of them twins. In the early 1980s she worked at day care centers, and in 1997 she began working part-time cleaning buildings. The family lived in a house built in the 1930s. She was a smoker during the 1980s (except during pregnancy), but she quit smoking in the early 1990s. Her alcohol consumption was low, about one bottle of wine per month, and she did not abuse drugs. She had no psychiatric problems.During the investigation at the Department of Occupational and Environmental Health she reported increasing GI problems with daily diarrhea for about a year. She also suffered from coldlike symptoms in combination with malaise and fatigue several times a week. A clinical examination, including a standard neurologic examination  was normal.In January 2002, we began our investigation by asking the patient about potential lead sources in her diet or in the environment. She had no contact with lead crystal glassware or lead-glazed pottery, and her food habits were normal. The blood lead concentrations in the other family members were normal. Her hematologic parameters and kidney function were normal, and she showed no signs of microproteinuria. In October 2002, lead in urine was increased , and an X ray of the abdomen showed a dense rounded metal object with a diameter of approximately 6 mm at the colon ascendens. While waiting for a computed tomography (CT) scan, which we planned in order to localize the object more precisely, the patient contracted the winter vomiting disease (gastroenteritis) in January 2003. During severe diarrhea, the object was released from the GI tract. The object was identified as lead shot pellet used for game hunting, and marks on it showed that it had been fired through a rifle. The lead shot pellet had a diameter of 6 mm and a mass of 1.7 g . A new aThe woman confirmed that she had consumed game at several occasions: she had eaten wild boar at a restaurant in Sweden in 1993, and hare or rabbit on some occasions during the 1990s, both in Sweden and in Germany. However, she could not recall having eaten meat that contained a hard object at any time. Her blood lead levels in April 2003, 2 months after the elimination of the lead shot pellet from her colon, were still high (345 \u03bcg/L). After another 7 months, the patient\u2019s blood lead concentration was 72 \u03bcg/L, almost down to reference levels. At that time, the attacks of malaise and fatigue had disappeared, and the abdominal symptoms were mild. Since 2003 she has been working full-time.Lead intoxication may be caused by intake of food and water containing increased lead concentrations or by industrial exposure from inhalation of lead-contaminated air. The absorption of ingested lead varies from 10 to 60% , with anAlthough our patient\u2019s blood lead level of 100 \u03bcg/L in 1992 was within the reference range of the analytical laboratory, it was somewhat higher than would be expected among unexposed individuals (at that time < 60 \u03bcg/L). We do not know the reason for this, but because the patient\u2019s blood lead level was only slightly above the normal range in 1992, it is probable that the intake of the lead shot pellet took place between 1993 and 2001. The rapid increase in blood lead level from August to December of 2001 indicates that the lead shot pellet may have been ingested in the autumn of that year. The lead shot pellet was released from the GI tract in January 2003. Thereafter, a slow decline in blood lead level took place, and the blood lead level was still clearly elevated in April 2003 (345 \u03bcg/L). A blood lead sample 7 months later (November 2003) showed an almost normal blood lead level 74 \u03bcg/L; . It seemThe lead shot pellet was larger (diameter 6 mm) than those normally used for hunting in Sweden and was a type not allowed in the country. It may have been used for hunting wild boar or roe deer in Germany and may also have been used rarely in Sweden .The blood lead levels that we observed, if they resulted from long-term exposure, could be associated with GI disturbances (which the patient had) and neurophysiologic findings of impaired nerve transmission. However, anemia or other symptoms of lead intoxication would not be expected. The patient promptly recovered from the malaise, and her bowel problems gradually decreased after the elimination of the lead shot pellet. It is likely that the bowel symptoms were caused by the lead exposure, but because the patient suffered from bowel problems earlier in life, we cannot be certain that the two are linked.Similar blood lead patterns have been observed for other individuals with retained lead objects in the GI tract. An 8-year-old boy swallowed 20\u201325 fishing sinkers and a nail . He quicBecause children have a considerably higher lead absorption in the GI tract (30\u201340%) than adults (15\u201320%), it is especially important to promptly examine and diagnose children with suspected lead objects retained in the GI tract. Also, necessary treatment should not be delayed. Otherwise, children may reach toxic blood lead levels in a few days. Even fatal lead encephalopathy could be caused by heavy exposure .207Pb, 206Pb, and 204Pb in environmental and biological samples has been suggested and applied for children . Some centuries ago it was discovered that crystal glass with high concentrations of lead shows a high durability and brilliance. The lead concentration in crystal glassware is often 25\u201330%; it has been shown that wine kept in lead crystal glass containers for a long time may contain a considerable amount of lead. Our investigation revealed an unusual source of lead exposure in this patient. In the first phase, we directed the investigation toward finding an environmental source, most probably a lead-containing food product. Accidental intake of a lead shot pellet was not suspected, and we have found very few earlier reports of this type of exposure among adults.Lead objects retained in the GI tract must be diagnosed and treated promptly. This is especially important in children who have a considerably higher GI absorption than adults and who can reach toxic levels of blood lead within a couple of days. We suggest an X ray of the abdomen in cases where external sources of lead exposure have been eliminated. The patient should also be followed by regular blood lead determinations. If possible, lead objects could be removed from the GI tract by gastroscopy or colonoscopy. Indications for and choice of chelation therapy depend not only on blood lead levels but also on factors such as severity of symptoms, age of the patient, and exposure circumstances ."}
+{"text": "This systematic review evaluates the evidence on the association between lead exposure and cardiovascular end points in human populations.We reviewed all observational studies from database searches and citations regarding lead and cardiovascular end points.A positive association of lead exposure with blood pressure has been identified in numerous studies in different settings, including prospective studies and in relatively homogeneous socioeconomic status groups. Several studies have identified a dose\u2013response relationship. Although the magnitude of this association is modest, it may be underestimated by measurement error. The hypertensive effects of lead have been confirmed in experimental models. Beyond hypertension, studies in general populations have identified a positive association of lead exposure with clinical cardiovascular outcomes , but the number of studies is small. In some studies these associations were observed at blood lead levels < 5 \u03bcg/dL.We conclude that the evidence is sufficient to infer a causal relationship of lead exposure with hypertension. We conclude that the evidence is suggestive but not sufficient to infer a causal relationship of lead exposure with clinical cardiovascular outcomes. There is also suggestive but insufficient evidence to infer a causal relationship of lead exposure with heart rate variability.These findings have immediate public health implications. Current occupational safety standards for blood lead must be lowered and a criterion for screening elevated lead exposure needs to be established in adults. Risk assessment and economic analyses of lead exposure impact must include the cardiovascular effects of lead. Finally, regulatory and public health interventions must be developed and implemented to further prevent and reduce lead exposure. Cardiovascular disease is the leading cause of mortality and a primary contributor to the burden of disease worldwide . EnvironPopulation research on the cardiovascular effects of lead has focused largely on the association with blood pressure and hypertension. Several reviews and metaanalyses combining data from more than 30 original studies and around 60,000 participants have examined the evidence relating blood lead to blood pressure or hypertension . All theThe cardiovascular effects of lead, however, are not limited to increased blood pressure and hypertension. Lead exposure has also been associated with an increased incidence of clinical cardiovascular end points such as coronary heart disease, stroke, and peripheral arterial disease , and witThe Health Consequences of Smoking [In the present article, our objective was to perform a systematic review of the epidemiologic evidence on the association of lead exposure with cardiovascular disease end points. Because previous reviews have examined the connection between lead and blood pressure in depth , our sys Smoking  to the ahttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed), EMBASE (http://www.embase.com/), and TOXLINE (http://toxnet.nlm.nih.gov/) through August 2006 with no language restrictions. In addition we manually reviewed the reference lists from relevant original research and review articles and documents.We aimed to identify all observational studies assessing the association between lead exposure and cardiovascular end points. Using free text and key words , we searFor lead exposure, we included studies that used biomarkers , environmental measures (airborne lead levels), or indirect measures . For cardiovascular end points, we included studies that reported clinical cardiovascular end points  and intermediate cardiovascular end points  other than blood pressure levels or hypertension.We excluded publications containing no original research, studies not carried out in humans, case reports, case series, ecologic studies, studies lacking a cardiovascular outcome, and studies lacking data on lead exposure . For stuWe adapted the criteria used by Measures of association  and their standard errors were abstracted or derived from published data . For stuBecause of substantial heterogeneity and methodologic limitations of the original studies, we considered that quantitative pooling was inappropriate. We thus present a qualitative systematic review of the available evidence.Twelve studies met our inclusion criteria . Lead waLead exposure was positively associated with clinical cardiovascular end points in all studies . Among pEighteen studies from the United States , Europe Relative risk estimates across occupational studies varied widely, with positive, inverse, and null associations . SeveralFive studies evaluated ventricular wall dimensional and functional parameters  Table 4Table 4. Ten studies measured heart rate variability among lead-exposed workers , and oneFifteen studies reported the association of lead with other electrocardiographic parameters  and one Finally, heart rate was evaluated using different methods in five studies, four in lead-exposed workers  and one Chronic lead poisoning was connected to hypertension in the 19th century . With raThe association between lead exposure and blood pressure has been found in populations with different geographic, ethnic, and socioeconomic background. While residual confounding by socioeconomic status is a concern, studies in homogenous samples and studies that have adjusted for a variety of socioeconomic indicators have still identified an association between lead exposure and blood pressure .The association between blood lead and elevated blood pressure has been identified not only in cross-sectional but also in prospective studies that showed that new cases of hypertension and within-person elevations in blood pressure levels over follow-up were related to baseline lead exposure .While the strength of the association between lead and blood pressure is modest, it may have been substantially underestimated because of measurement error in both lead and blood pressure determinations. Most studies used single blood lead measurements to assess lead exposure. When bone lead was used as a bio-marker of long-term exposure , lead inSome studies have demonstrated a progressive dose\u2013response relationship between lead exposure and blood pressure . HoweverNumerous experimental studies in animals have shown irrefutable evidence that chronic exposure to low lead levels results in arterial hypertension that persists long after the cessation of lead exposure . The preWe conclude that the evidence is sufficient to infer a causal relationship between lead exposure and high blood pressure. Further research is still needed to determine the precise dose\u2013response relationship, the relative importance of short-term versus chronic lead effects, the relevant mechanisms at environmental levels of exposure, and whether the magnitude of the association is different in children or in other vulnerable population subgroups.Few cohort studies have evaluated the prospective association of lead with clinical cardiovascular outcomes in general population settings. The findings of the NHANES II and NHANES III Mortality Follow-up studies are remarkable. NHANES are periodic, standardized surveys designed to provide representative health data from the U.S. noninstitutionalized population. Despite a marked decline in lead levels in U.S. adults, both surveys showed statistically significant increases in cardiovascular mortality with increasing blood lead . In addiThe associations of blood lead with clinical cardiovascular end points in the NHANES studies were moderately strong, with a clear dose\u2013response gradient. An unresolved issue is the impact of uncontrolled confounding and measurement error on the relative risk estimates in studies of lead and clinical cardiovascular end points. NHANES studies adjusted for race, education, income, and urban versus rural location, which reduces potential confounding by socioeconomic status. Studies with more detailed information on the determinants of lead exposure may contribute to a better understanding of this issue. Similarly, evaluating lead effects using a single blood lead measure may result in measurement error with substantial underestimation of the magnitude of the association. This is particularly problematic when there are marked temporal trends in lead levels, as this source of error adds to within-person variability in blood lead levels to increase regression-dilution bias.in vitro models . Second, a criterion for elevated blood lead levels in adults needs to be established and screened for in preventive services. In fact, the cardiovascular end points described above plus the substantial evidence that chronic lead exposure affects cognitive function  and rena"}
+{"text": "Analyses of mortality data for participants examined in 1976\u20131980 in the second National Health and Nutrition Examination Survey (NHANES II) suggested an increased risk of mortality at blood lead levels > 20 \u03bcg/dL. Blood lead levels have decreased markedly since the late 1970s. In NHANES III, conducted during 1988\u20131994, few adults had levels > 20 \u03bcg/dL.Our objective in this study was to determine the risk of mortality in relation to lower blood lead levels observed for adult participants of NHANES III.We analyzed mortality information for 9,757 participants who had a blood lead measurement and who were \u2265 40 years of age at the baseline examination. Using blood lead levels categorized as < 5, 5 to < 10, and \u2265 10 \u03bcg/dL, we determined the relative risk of mortality from all causes, cancer, and cardiovascular disease through Cox proportional hazard regression analysis.p for trend < 0.001). The magnitude of risk was similar for deaths due to cardiovascular disease and cancer, and tests for trend were statistically significant (p < 0.01) for both causes of death.Using blood lead levels < 5 \u03bcg/dL as the referent, we determined that the relative risk of mortality from all causes was 1.24  for those with blood levels of 5\u20139 \u03bcg/dL and 1.59  for those with blood levels \u2265 10 \u03bcg/dL (In a nationally representative sample of the U.S. population, blood lead levels as low as 5\u20139 \u03bcg/dL were associated with an increased risk of death from all causes, cardiovascular disease, and cancer. Toxic effects of exposure to high levels of lead among adults in occupational settings and from poisonings include neurologic and renal impairment as well as effects on other organ systems . EnvironLead exposure declined dramatically beginning in the late 1970s largely because of mandated removal of lead from gasoline, from paint, and to a lesser extent, from solder used in cans . Blood lAnalyses of mortality follow-up data for participants of NHANES II suggested an increased risk of mortality at blood lead levels > 20 \u03bcg/dL . MortaliNHANES III was fielded in two phases, the first from 1988 through October 1991 and the second from November 1991 through 1994. The survey consisted of a household interview and a standardized physical examination in a mobile examination center. The NHANES III sample was selected through a complex, multistage probability design. The survey has been described in detail elsewhere .During the physical examination, blood was obtained by venipuncture for all survey participants \u2265 1 year of age. Blood lead concentrations were measured by graphite furnace atomic absorption spectrophotometry and expressed in micrograms per deciliter. Details regarding laboratory methods and quality control procedures have been described previously .NHANES III participants \u2265 17 years of age were eligible for passive mortality follow-up, which has been completed for deaths occurring through December 2000. Mortality information is based on the results of a probabilistic match between NHANES III and the National Death Index records .International Classification of Diseases, Tenth Revision  had a blood lead measurement at baseline. Five persons were excluded because of insufficient information to allow for follow-up, resulting in a sample of 9,757 persons. The median length of follow-up was 8.55 years, during which there were 2,515 deaths (25.8% of participants). The  ICD-10;  was usedBlood lead levels were categorized as < 5, 5 to < 10, and \u2265 10 \u03bcg/dL. The sample size for persons with blood lead levels \u2265 20 \u03bcg/dL was too small to provide reliable estimates of mortality risk for this group. Because of the skewed distribution of blood lead concentrations, log-transformed values were used for additional analyses using lead levels as a continuous variable.A participant\u2019s age was defined as his or her age in years at the baseline examination. Race/ethnicity was categorized as non-Hispanic white, non-Hispanic black, Mexican American, and other. Education level was categorized as < 12 years or \u2265 12 years of education. Total family income was defined as < $20,000/year or \u2265 $20,000/year. Region, as defined by the We used Cox proportional hazard regression analysis, using age as the time scale to examine the relative hazard (or relative risk) of mortality from all causes, cancer, and cardiovascular disease using categories of blood lead concentrations as described above . As recoInitial models assessed univariate associations of covariates and mortality. Next, we constructed multivariate proportional hazard models to examine the association of lead exposure and mortality after adjusting for potential confounders. All two-way interactions with blood lead category were assessed. We assessed the proportional hazard assumption by examining the consistency of the relative hazards of mortality across three age groups. We defined three age categories, 40\u201374, 75\u201384, and \u2265 85 years, so that there were an approximately equal number of deaths from all causes in each category. Study subjects can be included in more than one age group as their ages change during the follow-up period. Because the cancer mortality and blood lead relationship was different for men and women in a previous study of the NHANES II cohort, we also stratified multivariate models separately for males and females.We analyzed the dose\u2013response relationship of blood lead and mortality in two ways. First, the multivariate-adjusted relative risks across the three blood lead categories were tested for trend. A linear term consisting of the median values for each lead group was placed in the proportional hazards model instead of the dummy variables for each group, and this linear term was analyzed using a Wald test. Second, the dose\u2013response relationship between lead and mortality from all causes was evaluated using log-transformed blood lead concentration as a continuous variable with a five-knot cubic regression spline in the multivariate proportional hazards model . We usedp < 0.05 as the level of statistical significance.Statistical analyses were conducted using the SAS System for Windows  and SUDAAN . All analyses included sample weights that accounted for the unequal probabilities of selection and nonresponse. All variance calculations incorporated the sample weights and accounted for the complex sample design using Taylor series linearization. All significance tests were two-sided using p-value of 0.02 for the interaction terms lead \u00d7 education in the cardiovascular disease model and lead \u00d7 race/ethnicity in the cancer mortality model; however, the interactive effects were not large and did not alter the direction of the lead\u2013mortality relationships. Therefore, we did not include these terms in our final models.The number of deaths and multivariate-adjusted relative risks of mortality due to all causes, cardiovascular disease, and cancer by blood lead category are presented in p < 0.001). For mortality due to cardiovascular disease, there was also a pattern of increasing risk with increasing blood lead. For all ages combined, the estimated relative risk of mortality from cardiovascular disease was 1.20  for those with blood lead levels of 5\u20139 \u03bcg/dL and 1.55  for those with blood lead levels of \u2265 10 \u03bcg/dL . For all ages combined, the estimated relative risk of mortality from cancer was 1.44  for those with blood lead levels of 5\u20139 \u03bcg/dL and 1.69  for those with blood lead levels of \u2265 10 \u03bcg/dL .In general, we found an increased risk of mortality from all causes with increasing blood lead levels , where tWe further explored the dose\u2013response relationship between blood lead concentrations and mortality from all causes by modeling the proportional hazards using log-transformed blood lead levels on a continuous scale with a five-knot cubic regression spline. The spline analysis results displayed as relative hazards using a referent blood lead level of 1.5 \u03bcg/dL (12.5th percentile) and 95% CIs are shown graphically in In this analysis of mortality among a large cohort of adults representative of the U.S. population, we found an increased risk of death from all causes, cardiovascular disease, and cancer associated with elevated blood lead levels. Overall, the increase in risk was small; however, the increase was observed for blood lead levels as low as 5\u20139 \u03bcg/dL. Our finding of dose\u2013response relationships between mortality risk and increasing blood lead levels for all three classes of death strengthens the conclusion that blood lead levels are associated with an increased risk of mortality.Previous research has examined mortality risk and blood lead levels in the general population of the United States using mortality follow-up data for participants 30\u201374 years of age from NHANES II, a study with baseline data collected during 1976\u20131980 and follow-up through 1992 . LustberThe results of our study showing increased mortality at levels as low as 5\u20139 \u03bcg/dL are consistent with other research that suggests health effects associated with low levels of lead exposure. Recent cross-sectional analyses of the current, ongoing NHANES, with data from 1999\u20132002, suggest an increased risk of peripheral arterial disease, hypertension, and renal dysfunction in a population with blood lead levels of approximately 2 \u03bcg/dL on average . Other aExposure misclassification is a potentially important limitation of our analysis. We classified exposure based on blood lead levels measured at only one point in time. Most (75\u201395%) lead in the body is found in bone , where tThat our results show an increased risk of mortality at lower blood lead levels than the mortality studies of the NHANES II cohort may be related to exposure classification being based on a single blood lead measurement. Blood lead levels of NHANES III participants were close to 80% lower than in the NHANES II cohort, and few adults had blood lead levels > 20 \u03bcg/dL . This reIt is not possible to differentiate an acute effect of lead in blood from a chronic effect in studies that only use blood lead levels to indicate exposure . With adFrom the present study we conclude that mortality is associated with lead exposure as indicated by a single blood lead measurement typical for the U.S. adult population during 1988\u20131994. Extrapolating from this to mortality risk related to cumulative lead exposure or blood lead measurements from different calendar periods can only be speculative. The blood lead and mortality relationship that we observed may be due to lead being a surrogate for some other factor that is associated with an increase in mortality. For example, socioeconomic status may not be sufficiently controlled for by measures of education level or family income. However, we adjusted for well-know confounders without observing a substantial reduction in the blood lead relationship. Also, the observed relationships for each category of mortality were fairly consistent across age and groups.The major strengths of our study, that the NHANES cohort is representative of the U.S. population and that the sample size is large enough to evaluate small differences in risk, are notable. Our analysis adds to the body of evidence demonstrating adverse health consequences related to blood lead levels that fall below current levels of concern. Further research is needed to assess cumulative exposure and adverse health consequences, including mortality, for persons who were not exposed to high levels of lead in the environment that were typical before lead was removed from gasoline in the late 1970s."}
+{"text": "Contrary to our hypothesis, subjects with high lead exposure had a significantly higher BMD than did subjects with low lead exposure. This may reflect a true phenomenon because lead exposure has been reported to accelerate bony maturation by inhibiting the effects of parathyroid hormone\u2013related peptide. Accelerated maturation of bone may ultimately result in a lower peak BMD being achieved in young adulthood, thus predisposing to osteoporosis in later life. Future studies need to investigate this proposed model.Osteoporosis is a decrease in bone mineral density (BMD) that predisposes individuals to fractures. Although an elderly affliction, a predisposition may develop during adolescence if a sufficient peak BMD is not achieved. Rat studies have found that lead exposure is associated with decreased BMD. However, human studies are limited. We hypothesized that the BMD of children with high lead exposure would be lower than the BMD of children with low lead exposure. We collected data on 35 subjects; 16 had low cumulative lead exposure , and 19 had high exposure . All were African American; there was no difference between the groups by sex, age, body mass index, socioeconomic status, physical activity, or calcium intake. Significant differences in BMD between low and high cumulative lead exposure were noted in the head (1.589 vs. 1.721 g/cm Research on the adverse effects of lead exposure on humans has focused on neurocognitive outcomes among children . HoweverHowever, human studies on this association are limited. In a study of children, Our objective was to determine whether an association between lead exposure and bone density exists in children. We hypothesized that the bone density of children with high lead exposure would be lower than the bone density of children with low lead exposure.To identify potential subjects who had an adequate number of blood lead levels to define past lead exposure, we obtained a comprehensive database of blood lead levels from the local county health department . To minimize the effect of age on BMD, we limited the database to children 8\u201310 years of age. In the database, we excluded capillary blood lead levels \u2265 10 \u03bcg/dL, because of the possibility that these represent contaminated specimens , and chiThe Human Subjects Committee of the Monroe County Health Department, the Human Subjects Review Board of the University of Rochester Medical Center, and the Clinical Investigation Committee of Rochester General Hospital approved this study.The measure of lead exposure used in this study is termed the cumulative lead exposure. To compute it, we identified all blood lead levels collected during four age strata  from the local health department database. Subsequently, we calculated the arithmetic mean of all blood lead levels for each of the four age strata. Finally, the cumulative lead exposure was calculated by computing the arithmetic mean of the four age strata means. Subjects were dichotomized as having high versus low cumulative lead exposure at a cutoff of 15 \u03bcg/dL.There is a strong correlation  between any single blood lead level in children between 2 and 4 years of age and cumulative lead exposure measure based on 24 serial blood lead levels in children between 3 months and 10 years of age ; therefore, we conclude that our measure of cumulative lead exposure is a valid measure of the overall lifetime lead exposure for a school-age child.We used a fan-beam dual-energy X-ray absorptiometry (DEXA) scanner  to measure BMD . BMD wasVariables associated with changes in bone density include age , race N, weight To minimize the effect of age, we enrolled only subjects within a narrow age range: 8\u201310 years. To eliminate the effect of race, we enrolled only subjects who were African American (and whose parents were both African American). We measured subject weight and height at the time of the BMD measurement. A parental questionnaire collected data on physical activity , calcium intake , and socioeconomic status [head of household Hollingshead occupational level and socioeconomic score ].a priori, to introduce both into adjusted analyses. Other comparisons with p-values \u22640.20 were also to be introduced into adjusted analyses. The primary analysis was, for each bony site, a comparison of the mean BMD by cumulative lead exposure status. Using SPSS software , we conducted adjusted analyses by use of analysis of covariance between the cumulative lead exposure groups.We initially compared the covariates between subjects by cumulative lead exposure status . Because age and weight are strongly associated with BMD, we decided, A sample size calculation demonstrated that 44 subjects would be required to achieve a power of 80% in discerning a 1.0-SD difference in BMD between the groups. We conducted analyses during subject recruitment, thus allowing us to discontinue enrollment after significant findings were discerned at a sample size of 35 subjects.We collected data on 36 subjects. All were African American. One subject was excluded because of obesity [body mass index (BMI) = 33]. Among the remaining subjects, 63% were male. The mean age was 109.5 months. The mean weight was 33.6 kg, and the mean height 138.6 cm; these measures are approximately at the 75th and 60th percentiles, respectively.p > 0.20) between the groups on sex distribution, age, BMI, socioeconomic status, physical activity, or calcium intake  and 23.6 \u03bcg/dL  . The grom intake .p \u22640.05).in vitro study using an older Lunar DPX-L pencil-beam instrument, that bone density increased by 8\u201311% with increasing and clinically relevant bone lead levels   . However measure .2 versus 0.720 g/cm2 among subjects with high and low cumulative lead exposure, respectively (p = 0.03). Thus, in this study, children with high cumulative lead exposure had nearly 7% higher BMD at the lumbar vertebrae than did children with low cumulative lead exposure. This amounts to about 2 years of bone growth.The alternative interpretation of our findings is that high lead exposure is associated with truly higher bone density in childhood. Our results indicate that the magnitude of this association is clinically relevant. For example, the mean BMD of the lumbar vertebrae (L1\u2013L4) was 0.770 g/cmin vitro study found that lead inhibits parathyroid hormone\u2013related peptide (PTHrP) and transforming growth factor-\u03b21, proteins that decrease the rate of maturation of chondrocytes in endochondral bone formation (We now wish to speculate on the mechanism of this finding. An ormation . Furtherormation . Similarormation , also haormation . The inhormation , which mOur findings differ from past research findings that lead exposure is associated with lower, not higher, bone density in mature animals . NeverthAn alternative model for the development of osteoporosis is that a lead-exposed individual may achieve a lower peak bone mass as a young adult. Studies of children have found a negative association between blood lead level and height . Similar"}
+{"text": "In the last decade children\u2019s blood lead levels have fallen significantly in a number of countries, and current mean levels in developed countries are in the region of 3 \u03bcg/dL. Despite this reduction, childhood lead poisoning continues to be a major public health problem for certain at-risk groups of children, and concerns remain over the effects of lead on intellectual development in infants and children. The evidence for lowered cognitive ability in children exposed to lead has come largely from prospective epidemiologic studies. The current World Health Organization/Centers for Disease Control and Prevention blood level of concern reflects this and stands at 10 \u03bcg/dL. However, a recent study on a cohort of children whose lifetime peak blood levels were consistently < 10 \u03bcg/dL has extended the association of blood lead and intellectual impairment to lower levels of lead exposure and suggests there is no safety margin at existing exposures. Because of the importance of this finding, we reviewed this study in detail along with other recent developments in the field of low-level lead exposure and children\u2019s cognitive development. We conclude that these findings are important scientifically, and efforts should continue to reduce childhood exposure. However, from a public health perspective, exposure to lead should be seen within the many other risk factors impacting on normal childhood development, in particular the influence of the learning environment itself. Current lead exposure accounts for a very small amount of variance in cognitive ability (1\u20134%), whereas social and parenting factors account for 40% or more. The effects of lead poisoning have been known since ancient times. In 200 BC the Greek physician Dioscorides observed that \u201clead makes the mind give way.\u201d Until the beginning of the 20th century, lead poisoning was viewed largely as an occupational disease of adults. In the 1890s lead paint poisoning in children was first recognized, and childhood lead poisoning is now well documented and persists as a major public health problem throughout the world. Clinical features of acute lead poisoning include abdominal pain and neurologic symptoms of lead encephalopathy including headache and confusion. In severe cases renal failure and convulsions can occur , and extArchives of Clinical Neuropsychology in 2001 was devoted to the topic of intelligence quotient (IQ) and low-level lead exposure in children. Five groups of scientists were invited to reply to an article by Although there appears to be no dispute about the effects of high levels of lead, there has been uncertainty about the effects of low levels of lead exposure on children\u2019s health. The debate has been particularly heated in the United States , where dIn contrast, debate in European countries has been muted with an overriding feeling that since the banning of leaded gasoline and lead-containing paints, lead exposure no longer poses a significant environmental threat to health. Publication of a study by Canfield and colleagues in 2003  challengThe main sources of lead in children\u2019s environments are diet, lead-based paint in older housing, lead in soil and dust from contaminated leaded paint and gasoline, or past and present mining and industrial activity . ExposurBlood lead levels peak in children at around 2 years of age, and hand-to-mouth behavior and pica  are significantly associated with elevated blood lead levels . ChildreChildren\u2019s blood lead concentrations have fallen substantially in a number of countries in the last few decades, including the United States, Australia, Mexico, Germany, Poland, Sweden, and the United Kingdom . By 1999Lowering of exposure guideline levels reflects concern over the growing body of evidence that low levels of lead exposure have subtle effects on the nervous system of children. Since 1971 there have been four reductions in the CDC guideline level above which children are considered to have an elevated lead level. This level currently stands at 10 \u03bcg/dL (0.483 \u03bcmol/L). In 1997 the CDC estimated that 4.4% of children in the United States 1\u20135 years of age have blood lead levels \u2265 10 \u03bcg/dL . In a reCross-sectional studies form part of a worldwide effort to quantify the effects of lead exposure in children. The main limitation of such cross-sectional studies is that they measure blood lead at one specific time point only. Because the half-life of lead in blood approximates that of the erythrocyte (approximately 35 days), it is primarily an indicator of recent exposure. This is of particular importance with lead exposure, as blood lead levels peak in children at around 2 years of age.We identified eight recent cross-sectional studies looking at the relationship between blood lead concentrations and children\u2019s cognitive abilities: the large U.S. National Health and Nutrition Examination Survey (NHANES) III  and seveThe evidence for lowered intellectual and cognitive ability in children exposed to lead comes largely from prospective epidemiologic studies of cohorts in Boston, Massachusetts, USA; Cincinnati and Cleveland, Ohio, USA; Port Pirie and Sydney, Australia; and Yugoslavia . A numbea) the time sequence of events can be assessed, b) they can provide information on a wide range of outcomes, and c) there is reduced recall and selection bias compared with case\u2013control studies. Children\u2019s intellectual capacities change with time, and therefore age-specific tests must be used . Unfortunately, in the five ongoing lead/IQ studies identified, a variety of cognitive test instruments were used, even for children of the same age, and no two studies adjusted for the same covariables. It is therefore not possible to directly compare results between these studies.Longitudinal studies have many advantages over cross-sectional studies: n = 1,502) living in two towns in Yugoslavia were identified as having differing lead exposures. One town is on the site of a lead smelter, whereas the other (control) town lies 25 miles to the south. Maternal blood lead was measured at midpregnancy and at delivery, and child blood leads were determined at subsequent 6-month intervals. The report by n = 390) having at least one assessment of intellectual functioning at 3, 4, 5, or 7 years of age with complete data on all covariates. Three normed and age-specific tests of cognitive function were used. This review is a reanalysis of data given in the authors\u2019 full 1999 report, when the study was in its fourteenth year  and postnatal (p < 0.05) exposure were independently and significantly negatively correlated with IQ, and no critical period of vulnerability was found. A 50% rise in prenatal blood lead levels was associated with a 1.07-point loss in IQ score , whereas a 50% increase in postnatal blood lead relative to prenatal levels was associated with a 2.82-point IQ loss . Because the analyses first controlled for prenatal blood lead, the postnatal change measure indicated a substantial change in exposure and was not a reflection of whether the mean postnatal blood lead was high or low. Covariates included in the regression analysis were quality of the home (HOME score); maternal age, intelligence, education and ethnicity; birth weight; and sex. Together these accounted for approximately 50% of the variance in IQ at 7 years of age; lifetime lead exposure accounted for 4.2% of the variance  between blood lead levels and IQ, with a 0.46-point decrease in IQ for each microgram per deciliter increase in lifetime average blood lead concentration . For the subsample of children whose maximal blood lead level remained below 10 \u03bcg/dL over the 5 years, the IQ loss associated with a given change in blood lead level was greater. In these 101 children, the study indicates a loss of 0.74 IQ points for each microgram per deciliter increase in lifetime blood concentration. The authors suggest a nonlinear relationship between children\u2019s IQ scores and their blood lead concentration, with larger associations at lower lead concentrations. The importance of this study is that it extends the association of blood lead concentrations and intellectual impairment to concentrations below the current level of concern, which stands at 10 \u03bcg/dL (0.483 \u03bcmol/L), and implies that there is no safety margin at existing exposures.The study reports a significant negative association (n = 140) and a control group (n = 135). Families in the intervention group received cleaning equipment and up to eight visits by a dust-control advisor, although the length of time between visits was not specified. All families continued to be visited by the study team at 6-month intervals for blood sampling and environmental lead measurements by a technician (blinded to intervention status). In addition, at each of these home visits an interviewer  conducted a face-to-face interview to identify, among other things, the type and frequency of cleaning and the last time cleaning was performed.To fully evaluate the results of the Canfield study, the experiences of their (nested) study cohort within the original dust-control trial must be considered. The Canfield cohort comprised 240 children from a larger group of 276 children and their families taking part in the dust-control trial. Families were eligible for the dust-control trial if they lived in the city of Rochester and had a child 5\u20137 months of age at the time of the baseline visit. Participants were identified using sequential lists of live births from three urban hospitals, and families were recruited by telephone. Families who agreed to participate were visited by a study team who carried out a baseline interview and collected a venous blood sample from the child. In addition, an experienced technician collected and analyzed dust samples at various indoor locations and measured lead content of painted surfaces inside and outside the home. This original cohort was randomly divided into an intervention group . House dust lead levels declined sharply in both the intervention and control groups. Six months after the first baseline visit, dust lead levels in interior window sills and on floors had decreased by approximately 50% and continued to decline at a slower rate over the following year. The authors recognized several limitations of the study, including sampling the same location in each house, that is, the act of sampling itself may have introduced an artificial decline in dust lead levels. Another possibility was that the act of sampling altered the cleaning behavior of the control group families (the Hawthorne effect). To examine whether the regular visits and dust sampling introduced such an effect, birth certificate data were used to construct a matched negative-control group of 236 children. Children were matched by race, month of birth, and poverty level (measured by census block group characteristics). At 24 months of age the geometric mean blood lead levels were 7.3 \u03bcg/dL  in the intervention group, 7.8 \u03bcg/dL  in the control group, and 7.3 \u03bcg/dL \u00b1 2.2 \u03bcg/dL (CI not given) in the matched negative controls. No Hawthorne effect was apparent.If it is assumed that the matched negative-control group lived in homes with dust lead levels equivalent to those found in the study cohort before any interventions , house dust lead levels do not appear to correlate with blood lead levels in the study children. This is not discussed in the 1999 article by p = 0.005), which is not significantly different from the coefficient of \u20130.46 for all 172 children. For the group of children with a peak blood lead concentration < 10 \u03bcg/dL, 15 observations were eliminated by using the IQ < 110 cutoff. In this case the linear regression coefficient was \u20131.07 (p = 0.038), which again is not significantly different from the coefficient of \u20131.37 for all children with a peak blood lead < 10 \u03bcg/dL. However, after eliminating these observations, the p-value decreased from 0.05 to 0.08 in the quadratic model.Nonlinear mixed models were analyzed using the full range of blood lead values. a) if removal of data from the 140 children in the original dust-control intervention cohort alters the semiparametric analysis relationship given in b) to which group the cluster of 10 children with high IQs (> 115) and low blood lead levels (< 5 \u03bcg/dL) were assigned in the original study. In addition, data from the nine children with the highest blood lead levels may have had a disproportionate influence on the final slope of the curve compared with subjects clustered around the average blood lead level, and further information on these nine children would also be of interest.It would be of interest to know Cognitive function was assessed using an abbreviated Stanford-Binet Intelligence Scale (version IV) at 3 and 5 years of age, with a different examiner administering the test at each age. Results are expressed as the composite score. However, this test may not have been the most accurate measure of IQ for this cohort. The Stanford-Binet is heavily weighted on verbal skills and has been superseded by the Wechsler scales for this reason. Anyone who lacks English proficiency will do less well in this test, and children were correctly excluded from analysis if their parents lacked English proficiency. Overall, the study children had below-average Stanford-Binet scores (89.8 \u00b1 11.4). However, the standard method for calculating the composite score excludes subtests with a raw score of zero, and thus overestimates IQ in those children achieving a zero in any subtest. The Stanford-Binet IV score at 3 years of age does not correlate well with Wechsler Preschool and Primary Scale of Intelligence (WPPSI) scores at 4\u20135 years of age, but correlation is significantly improved by considering the number of subtests the child did not perform at 3 years of age . The powIn correspondence after publication of the Canfield study, In summary, of the three most recent longitudinal studies that measured prenatal lead exposure (average blood lead ranging from 1 to 11.5 \u03bcg/dL), two found a negative association with subsequent IQ, and one found no effect. In contrast, all five recent longitudinal studies that measured postnatal exposure (average blood lead levels ranging from 6 to 44 \u03bcg/dL) found significant associations with cognitive development, and this association was maintained after adjusting for a range of covariates including child\u2019s sex and birth weight and parental/maternal IQ and years of education. The Port Pirie and Rochester studies considered the widest range of confounding factors and were the most robust methodologically. With the report of Canfield and colleagues and the recalculation of the Boston cohort results, these findings in nearly 1,300 children support an association between childhood lead exposure and subsequent cognitive impairment and extend the range of concern to children with lifetime average blood lead levels < 10 \u03bcg/dL.a) the large number of confounders that must be considered when measuring an effect on children\u2019s intelligence; and b) the frequent finding that the more covariates included in regression models, the smaller the effect of blood lead on IQ becomes, although it remains in the same direction (Epidemiologic studies are subject to two types of error: systematic and random. Systematic errors (or bias) are by far the most problematic as they are generally not measured and they do not decrease as the sample size increases. Key sources of bias include those associated with aspects of selection and the distortion of the cause\u2013effect relation by confounding. Reasons for the controversy over the lead\u2013IQ link include irection . The mosThree studies shed light on the area of confounding . Blood lthe common practice of merely removing the effects of confounding factors, such as SES, appears doubtful. . . . In addition, some of the inconsistencies in this area of research might be due to differential sampling of subgroups of lead-exposed children characterized by different levels of psychosocial adversity.Intuitively, Bellinger\u2019s hypothesis is very attractive and provides a possible explanation for the variability between ostensibly similar studies. In the lead field in the past, study results have been deemed right or wrong, usually on the basis of how the issue of confounding was handled. If dose\u2013effect relationships are not independent of other host characteristics, it will be necessary to model three (or more)-way interactions. However, most prospective studies are designed with only enough statistical power to detect main effects and do not have the power to detect effect modification in subgroups of the main cohort. Bellinger urges a move away from broad, population-based cohorts toward a greater use of focused sampling frames, which should include adequate numbers within specific subgroups . The repThe powerful influence of SES on developmental outcome has been elegantly demonstrated in a report on school-age children born to mothers with heroin dependency . The stuAnimal models using spatial learning in rats have shown the protective effect of an enriched environment on lead-induced neurotoxicity . Of partALAD gene, which codes for \u03b4-aminolevulinic acid dehydratase; the vitamin D receptor (VDR) gene; and the hemochromatosis gene coding for a defective protein known as HFE. There are two forms of the ALAD protein, ALAD1 and ALAD2; lead has a higher affinity for ALAD2. Preliminary evidence has shown adolescents with the ALAD1 phenotype are more resistant to the effects of lead on behavior and attention than ALAD2 individuals. There are at least two alleles (b and B) and three variants of the VDR genotype, and among adults occupationally exposed to lead, b individuals have higher lead levels in blood and bone. Mutated HFE protein is known to cause hemochromatosis, in which large quantities of iron are deposited in internal organs. Because lead can be incorporated into processes requiring iron, polymorphisms in HFE might be expected to influence lead absorption. It is likely that future epidemiologic studies will include analysis of ALAD status and possibly other biomarkers.Genetic predisposition can also affect vulnerability to lead-induced neurotoxicity; this area of research has recently been reviewed by Generally, no single epidemiologic study should be treated as the sole source of convincing evidence. The weight of evidence for any causal link comes when a number of studies using similar or preferably different methodologies in different populations reveal the same finding. In the low-level lead\u2013IQ link, the balance has come down in favor of an association, with the methodologically sound study by Evidence is increasing for a temporal relationship. The finding that 4\u20135 years of age is the critical period for manifestation of earlier  lead exposure  might exN-methyl-d-aspartate glutamate receptor subunits are observed in animals that show cognitive deficits induced by exposure to lead (Mechanistically, no unifying theory explains the neurotoxicity of lead or how lead might affect cognition. The ability of lead to substitute for calcium is a common factor underlying many of its toxic actions, including apoptosis and influences on neurotransmitter storage and release, second messengers, cerebrovascular endothelial cells, and glial cells. A variety of mechanisms may be important, and these are summarized in recent reviews by  to lead . Lead-in to lead .Concerning dose\u2013response relationships, IQ tests are blunt measures of neurologic status, and blood lead is at best only a crude index of lead-induced neurotoxicity. However, a negative association has been found across groups of children from a range of populations around the world. Visual-motor tests and tests of attention are designed to assess more limited cognitive domains than IQ tests, and it is of interest that more consistent decreases have been reported for these measures in cross-sectional studies  and prosIt is clear that blood lead levels have fallen significantly over the last 40 years. During the 1970s, childhood blood lead concentrations of 40 \u03bcg/dL were not unusual. The available evidence suggests that mean blood lead levels are now in the range 2\u20134 \u03bcg/dL in the United States and much of Europe. Despite this reduction in lead exposure, it could be argued that current baseline blood lead levels continue to constitute a global public health risk, as preindustrial humans are estimated to have had 100- to 1,000-fold lower blood lead levels than the population of today . With th"}
+{"text": "Given the well-documented toxicity of lead, it is important to understand how to identify and avoid exposure. NIOSH and the New York State Department of Health are two entities that have posted lead-related information on the Internet in an effort to educate the public and clinicians about this health threat.http://www.cdc.gov/niosh/topics/lead/. This collection starts with a brief overview of how workers can be exposed to lead and the range of health effects caused by exposure. Next is a link to lead-related entries in the institute\u2019s NIOSHTIC-2 bibliographic database of publications, grant reports, and journal articles supported in whole or part by NIOSH. Currently, there are more than 770 entries related to lead. The entries are arranged by date of publication, and most entries include links to the full text of the resource listed.As part of its mission to educate the public about exposures to toxic materials in the workplace, NIOSH has pulled together a variety of resources on the topic of lead exposure and effects and made them available at The NIOSH lead page also provides a link to the Adult Blood Lead Epidemiology Surveillance (ABLES) program page. This voluntary state-based program works to measure trends in adult blood lead levels and to minimize lead exposure. The ABLES program page lists the 37 participating state programs, with links to publications generated by each state. The page also has the latest compiled blood lead level data and a list of relevant publications, reports, and other resources.NIOSH Manual of Analytical Methods for sampling and analysis of lead in different media. There are also numerous resources related to take-home lead exposure and its prevention. Lead poisoning, neurological effects, and mental retardation in family members have been linked to lead brought home by workers on their clothing and in vehicles.The NIOSH lead page also lists selected publications as well as instructions from the http://www.health.state.ny.us/nysdoh/lead/hlthcare.htm. This page, which is also available in PDF form, provides a more in-depth overview of the adverse health effects of lead exposure. It briefly discusses the effects seen at different levels of lead exposure. It also provides information on the responsibilities of health care providers in reporting and evaluating elevated blood lead in patients they see, and advises clinicians on how to help their patients prevent dangerous exposures. The page outlines the New York State voluntary guidelines for controlling lead in workplaces and looks at how lead poisoning is treated clinically.A separate resource geared especially toward health care providers is available through the New York State Department of Health at Clinicians can consult lists of exposure routes, including those associated with the workplace, hobbies (such as target shooting and stained-glass art), and use of substances (such as some folk remedies and moonshine whiskey). The page also has a rundown of six steps that health care providers can give to patients who work in places where lead is present to help reduce their own and their families\u2019 exposure to lead."}
+{"text": "In 2003, residents of the District of Columbia (DC) experienced an abrupt rise in lead levels in drinking water, which followed a change in water-disinfection treatment in 2001 and which was attributed to consequent changes in water chemistry and corrosivity.To evaluate the public health implications of the exceedance, the DC Department of Health expanded the scope of its monitoring programs for blood lead levels in children.From 3 February 2004 to 31 July 2004, 6,834 DC residents were screened to determine their blood lead levels.n = 46; 70.8%) lived in homes without lead drinking-water service lines, which is the principal source of lead in drinking water in older cities. Although residents of houses with lead service lines had higher blood lead levels on average than those in houses that did not, this relationship is confounded. Older houses that retain lead service lines usually have not been rehabilitated and are more likely to be associated with other sources of exposure, particularly lead paint. None of 96 pregnant women tested showed blood lead levels > 10 \u03bcg/dL, but two nursing mothers had blood lead levels > 10 \u03bcg/dL. Among two data sets of 107 and 71 children for whom paired blood and water lead levels could be obtained, there was no correlation (r2 = \u20130.03142 for the 107).Children from 6 months to 6 years of age constituted 2,342 of those tested; 65 had blood lead levels > 10 \u03bcg/dL (the \u201clevel of concern\u201d defined by the Centers for Disease Control and Prevention), the highest with a level of 68 \u03bcg/dL. Investigation of their homes identified environmental sources of lead exposure other than tap water as the source, when the source was identified. Most of the children with elevated blood lead levels (The expanded screening program developed in response to increased lead levels in water uncovered the true dimensions of a continuing problem with sources of lead in homes, specifically lead paint. This study cannot be used to correlate lead in drinking water with blood lead levels directly because it is based on an ecologic rather than individualized exposure assessment; the protocol for measuring lead was based on regulatory requirements rather than estimating individual intake; numerous interventions were introduced to mitigate the effect; exposure from drinking water is confounded with other sources of lead in older houses; and the period of potential exposure was limited and variable. In this article we report the findings of a lead-screening program instituted for residents of the District of Columbia in response to increased lead levels in drinking water in 2003 and 2004. The results are of interest as a population survey of residents, an evaluation of the public health implications of a lead exceedance, and a case study in emergency response to a drinking-water event.A number of advisories and interventions were introduced at the time in order to reduce exposure and to mitigate any public health risk that would result. Among the responses mounted by the District of Columbia Water and Sewer Authority (DCWASA) and the DC Department of Health (DOH) was a screening program for elevated blood lead levels that targeted young children, pregnant women, and nursing mothers.Washington, DC, has had a well-documented problem with lead exposure associated with residual lead paint and contaminated house dust in older housing, mostly built before 1950 and never rehabilitated. Lead levels in the blood of children in the district have been falling for many years and continued to fall through the period of elevated lead in the drinking-water distribution system .Recently, in part in response to the situation in Washington and a similar situation in Greenville, North Carolina, In 2002, lead concentrations in treated water supplied by the DCWASA began to rise. Because the increase was small and did not exceed the U.S. Environmental Protection Agency\u2019s (EPA) lead action level (LAL), the significance of this finding as a harbinger of further increases was not appreciated at the time. The increase followed the substitution in water-disinfection treatment from chlorine to chloramines on 1 November 2002, in anticipation of the new Disinfection Byproducts Rule, later published on 4 January 2006 . ThereafThe DCWASA serves approximately 2 million wastewater customers and supplies about 500,000 customers in the metropolitan Washington area with 135 million gallons (approximately 520 million liters) of drinking water per day at 130,000 locations. In a unique arrangement reflecting national security concerns dating to the Civil War, the DCWASA purchases finished water from the Washington Aqueduct, which is a division of the Army Corps of Engineers. The Washington Aqueduct draws raw water from the Potomac River, treats it, and sells the finished water wholesale to Arlington County, Virginia, and to the City of Falls Church, Virginia, as well as to the DCWASA, which distributes it throughout the District of Columbia. The District of Columbia is also unique because the Government of the District of Columbia does not have direct regulatory oversight (\u201cprimacy\u201d) over the DCWASA for environmental standards. The DCWASA reports directly to U.S. EPA, Region III.Drinking water supplied to the distribution system is essentially free of lead up to and through the main lines, which typically run down the middle of city streets under the pavement. Smaller service lines conduct the water from the main line to a house, where the service line connects with the interior plumbing, which is usually mostly copper. Lead was standard from the nineteenth century until the 1940s as the material of choice for service lines and continued to be used occasionally until the 1970s, when it was completely replaced by copper, polyvinyl chloride, or other materials. Because lead service lines were once used in all houses, regardless of location, design, or price, they are still present in a wide range of older housing types in District of Columbia, from expensive and desirable homes in affluent neighborhoods to neglected housing in marginal areas.Lead is subject to leaching under certain conditions of corrosivity. Over the years, most of these lead service lines have been replaced, particularly when houses have been renovated. As a consequence, certain homes have elevated lead levels at the tap and others, which may be on the same street or even next door, do not. An analysis of 7,158 houses that were directly inspected through test pits by the DCWASA, reported to the U.S. EPA in 2005 , revealed that homes with lead service lines in the District of Columbia are most likely to be on streets with at least one other lead service line (70%), are most likely to be associated with homes built between 1900 and 1933 (81%) or before 1899 , are less likely to have been built between 1934 and 1949 (27%), and are least likely to have been built since 1950 (11%).Drinking water is regulated under several rules promulgated under the Following the LCR , guidancAdvisories were disseminated recommending that water lines should be flushed for 10 min before consuming drinking water.Specific advice for limiting exposure to children < 6 years of age and pregnant and nursing women was sent to all households with suspected lead service lines, in the form of flyers prepared in English, Spanish, Korean, Chinese, Vietnamese, and Amharic.Filters were distributed to homes with suspected lead service lines and later to all homes with a test result > 15 ppb (the LAL). Replacement filter cartridges were then sent to the same homes at 6-month intervals for the duration of the period of the exceedance, ending in June 2006.The board of directors of the DCWASA decided to adopt a voluntarily accelerated program to replace the public segment of all lead service lines in the District of Columbia, exceeding requirements of the LCR .Homeowners were offered replacement of the private segment of lead service lines on their property, at cost, at the same time that the public segments of the lead service lines were replaced. When the public line is replaced but the private line is not, lead levels are reduced proportionally to the length of pipe replaced but not eliminated.Low-cost financing was arranged with a local bank for qualifying property owners who wished to replace the private part of the lead service line on their property. The DC government later made grants available to low-income eligible residents for this purpose.The DCWASA offered free water testing to any customer in the distribution area who requested it.Beginning in August 2004, the DCWASA conducted an Optimal Corrosion Control Treatment (OCCT) study, as required by the LCR , to evalFrom the fall of 2003, the DCWASA embarked on a massive program of replacing lead service lines, as required by the LCR  and acceThe lead elevation has now abated. The DCWASA is now in compliance with the LCR , and heaBlood lead determinations are readily accessible to residents of the District of Columbia through a network of public and private facilities. Blood lead testing is mandatory for DC children at 1 and 2 years of age. Elevated blood lead levels are also reportable in the District of Columbia to the DC DOH Childhood Lead Poisoning Prevention Program. Because of concern over the issue of lead in drinking water, greater capacity was required to handle the demand for screening and also to provide counseling, educational, and referral services as needed. The DC DOH therefore developed a program to supplement the existing clinical screening program at no cost to DC residents. The program involved expanded clinic hours at five existing community outpatient clinics  and blood drawing on site at schools, licensed child-care centers , and the Children\u2019s National Medical Center. The screening program began on 3 February 2004 and was discontinued on 2 August 2004. This special program was funded by the DCWASA at a total cost of $1 million. Passive monitoring through mandatory pediatric lead screening and voluntary testing for all DC residents continues at the five originally designated centers, as before.The program was extensively publicized in local media and health services and by direct outreach to parents whose children were enrolled in day care. A letter recommending screening and outlining the public health advisories was sent individually on 26 February 2004 from the DC DOH to residents of 23,000 homes identified as having a high probability of being served by lead service lines. Notices were also sent home to parents of students in DC public schools.Lead screening was also offered on-site at 84 of 155 active child-care facilities with known or suspected lead service lines in the District of Columbia : 36 child-care facilities had made arrangements for screening to be conducted by a private physician, 28 had no children enrolled at the time, 6 were not tested because parents refused, and 1 facility refused. On 11 May 2004, following monitoring results that showed increased lead levels in water at some school taps, the screening program was extended to pupils in the DC city schools, eventually reaching 32 public (as opposed to charter) schools (Washington has 167 elementary schools) and 3 charter schools (out of 34).a) the \u201ctarget population,\u201d which we defined as children 6 months to 6 years of age (referred to as \u201cchildren < 6 years of age\u201d) and women who were pregnant or nursing; and b) the population \u201coutside the target population,\u201d which we defined as all others for whom testing was requested.For purposes of analysis, we identified two groups: Blood lead levels were measured in the public health laboratory of the DC DOH by graphite furnace atomic absorption spectrometry. Elevated blood lead levels were defined as those > 10 \u03bcg/dL, the level of concern adopted by the Centers for Disease Control and Prevention .We analyzed results of the determinations for all confirmed and probable residents of Washington, DC, for the target population, and for various subgroups. A few subjects who gave DC addresses but actually lived in Maryland (which is served by a different drinking-water distribution system and was not affected by chloramination) were screened inappropriately; they have been omitted from the analysis.The homes of all children and adults with elevated blood lead levels were investigated by the DC DOH. The results of public health investigations in the home for the elevated levels for adults and children were reviewed. To protect confidentiality, results were not communicated to the public in sufficient detail to identify house addresses, institutions, or neighborhoods.The study was undertaken as a public health intervention by the DC DOH rather than a research project and was therefore not subject to internal review board review. The DC DOH complied with all applicable requirements of U.S. and international standards, and participants  gave written informed consent before having blood drawn.A subset of 177 houses with water lead levels of > 300 ppb was identified by the DCWASA through its sampling program, and the residents were invited to participate in the lead-screening program.The records of children screened during the special lead-screening program were entered into the general database for pediatric blood lead levels in the DC DOH. Data on housing has been transferred to a newly created DC Department of Environment. The DC DOH identified 2,482 children < 6 years of age when tested in 2004, of which 107 cases had paired values of blood lead and first-draw water lead concentration. A correlation analysis was performed on this data set.We obtained a data set from the DCWASA that was prepared at the request of the U.S. EPA in 2005; this data set included 71 individual children (at 67 addresses) with blood lead levels of \u2265 10 \u03bcg/dL for which paired blood lead levels  and water concentration were available. An address identifier was available for each individual. It is not possible to know how many subjects appear in both data sets because individual cases can only be identified by a match on exact numerical value of both parameters. However, in a preliminary check of the seven highest blood lead levels (those \u2265 10 \u03bcg/dL on the DC DOH data set), only three cases appeared to be represented on both lists. We performed a correlation analysis on this data set on all data points, including repeated measures on each individual, by address, and on the highest reported value among multiple values of either blood lead or water lead concentration, whether first draw or second draw (10 min running tap) or multiple samples.Of the 2,342 children < 6 years of age, 361 (15.4%) had lead service lines supplying water to their residences. Of these, 19 (5.3%) had elevated blood lead levels. Among the subset of 1,098 pupils screened in the DC city schools, 232 were children < 6 years of age; of these, 15 (6.5%) had lead service lines supplying their residences, and 1 of the 15 had an elevated blood lead level. Another subset consisted of 155 children screened in child-care centers, 2 of whom had elevated blood lead levels.n = 46; 70.8%) did not live in homes with lead service lines.The characteristics of all cases with elevated blood lead levels are presented in In every case in which the blood lead level exceeded 10 \u03bcg/dL in a subject in the target population, an investigation of the homes was conducted. Most identified at least one source of lead exposure other than drinking water, usually peeling lead paint and dust. Two cases remain in dispute because a source has not been positively identified, but there is no evidence that either is water related. This investigation is continuing.p < 0.05).Among those children < 6 years of age who had blood lead levels < 10 \u03bcg/dL, the blood lead level (mean \u00b1 SD) for the 344 children who lived in homes with lead service lines was 3.28 \u00b1 2.05 \u03bcg/dL compared with 2.60 \u00b1 1.69 for children living in homes without lead service lines, a statistically significant difference . The geometric mean blood lead of children who lived in houses with lead service lines was 3.28 \u03bcg/dL  compared with 2.60 \u03bcg/dL  for those living in houses without lead service lines.Of the 177 homes with > 300 ppb lead in drinking water, the residents or owners of 44 could not be contacted after multiple home visits and telephone calls; the residents of 14 had their lead levels tested privately; the residents of 10 homes refused to participate; and 210 residents of 119 houses participated in the screening program. None had a blood lead level > 10 \u03bcg/dL.r2 = \u20130.03142).In the data set obtained from the DC DOH on 2,482 blood lead determinations, we found 107 children with paired blood lead level and first-draw water lead concentrations. Of these, 7, and an additional 52 for which paired values were not available, were at \u2265 10 \u03bcg/dL. The range of blood lead levels was 1\u201368 \u03bcg/dL in the total list and 1\u201325 \u03bcg/dL among the 107 with paired values. The range of first-draw water lead concentration was 1.04\u2013310 ppb. There was no correlation , and the testing centers were readily accessible by public transportation and even by foot. The distribution of subjects mapped as of March 2004 closely matched both the distribution of housing dating before 1950 and density of children < 6 years of age . There is no evidence for a strong selection bias against residents at lower risk in the screening program; rather, it is likely that a disproportionate number of residents at higher risk were screened and that their screening was motivated by parental concern. The 2,342 children < 6 years of age who were screened represent 5.1% of an estimated 45,549 children in the District of Columbia in that age group. Many of those not screened who were 1 or 2 years of age at the time would have already had recent mandatory blood lead determinations, and their parents or guardians, knowing the results, may not have sought a repeat test. The District of Columbia covers a small area , and 9 stories in the Washington Afro-American. Direct information was also provided during this period to thousands of callers to the DCWASA customer service line, which served 51,031 calls during the 10 weeks of the first extensive news coverage of the issue in late January 2004: 5,429 calls the first week and similar numbers thereafter until tapering in weeks 8 and 9, peaking at 8,556 in week 5, compared with a normal volume of \u2264 40 calls/week. The story was sufficiently prominent that it is unlikely that any families in the District of Columbia with young children were completely unaware of the issue or the availability of the screening program.Recruitment for this study took place through many channels and was reinforced by media coverage of the issue, which was close to saturation at the time, as tracked by the DCWASA Office of Public Affairs using the following indicators. There were 46 stories on the subject in the first 10 months of 2004 on one popular radio station (WJLA) alone, 31 stories in the Although the percentage of all children < 6 years of age with blood lead levels above the level of concern who were living in homes with lead service lines (5.2%) is larger than the percentage of all children in this age group who were living in homes without lead service lines (2.3%), it is misleading to make a direct comparison. The presence of lead service lines to a house is a marker for age of the house and unrehabilitated status, and therefore indicates higher risk for exposure to lead in paint, soil, and fixtures unrelated to drinking water . Homes wThe District of Columbia Plumbing Code (2003) has required since at least the 1980s that lead service lines be replaced in houses undergoing substantial rehabilitation, defined as involving cumulative repairs or alterations to \u2265 50% of the water system. The requirement was enforced by the permitting process, which was enforced by a bond on master plumbers. A 1990 consultant firm\u2019s report  estimateIn collaboration with the CDC, the DC DOH reported blood lead levels of children who lived in homes with and without lead service lines in 2004 and compared them with historical trends . ChildreThe present study cannot be reconciled with the findings of There appears to have been no identifiable public health impact from the elevation of lead in drinking water in Washington, DC, in 2003 and 2004. This may reflect effective measures to protect the residents, as 153 reported compliance with recommendations to filter their drinking water. However, the screening program developed in response to the issue uncovered the true dimensions of a continuing problem with sources of lead in homes . The inca) it is based on an ecologic rather than individualized exposure assessment; b) the protocol for measuring lead was based on regulatory requirements rather than estimating individual intake; c) numerous interventions were introduced to mitigate the effect; d) exposure from drinking water is confounded with other sources of lead in older houses; e) the period of potential exposure was not uniform among houses; and f ) actual exposure was variable for individual residents. It is of value as a population survey of residents, an evaluation of the public health implications of a lead exceedance in the face of an appropriate response, and as a case study in emergency management of a drinking-water event.The present study cannot be used to correlate lead in drinking water with blood lead levels directly because The public health objective remains to reduce lead intake further from all sources, to lower mean blood levels in DC  children still further, and to eliminate individual cases of elevated blood lead levels, as determined by the current, or any future revised, CDC level of concern ."}
+{"text": "Blood lead was not associated with dietary exposure to other local or imported food items.Although blood lead levels have declined in Greenland, they are still elevated despite the fact that lead levels in the Greenland environment are very low. Fragments of lead shot in game birds have been suggested as an important source of dietary exposure, and meals of sea birds, particularly eider, contain high concentrations of lead. In a cross-sectional population survey in Greenland in 1993\u20131994, blood lead adjusted for age and sex was found to be associated with the reported consumption of sea birds. Participants reporting less than weekly intake of sea birds had blood lead concentrations of approximately 75 \u03bcg/L, whereas those who reported eating sea birds several times a week had concentrations of approximately 110 \u03bcg/L, and those who reported daily intake had concentrations of 170 \u03bcg/L ( Lead has been recognized as a poison for millennia and has recently been the focus of public health regulations in most of the developed world. Consequently, fatalities and symptomatic lead poisoning have declined dramatically during the latest decades and are continuing to decline . In recoBlood lead levels in samples collected before 1980 from the indigenous (Inuit) adult population of Greenland were found to be similar to those of populations in western European cities, where leaded gasoline was the main source . BecauseIn Canada, elevated levels of blood lead in children were proposed to be caused by the consumption of birds containing lead shot , and higThe purpose of the study reported here was to analyze the association of blood lead with the consumption of traditional and store-bought food items in a cross-sectional population survey in Greenland conducted in 1993\u20131994. Since then, there have been no changes in the use of lead shot for hunting. Also, traditional food  still constitutes an important part of the diet in Greenland, although with large variation among regions and individuals.The total population of Greenland was 55,000 in 1993, of whom 86% were born in Greenland (a proxy measure of Inuit ethnicity). Genetically, the Greenlanders are Inuit with a substantial admixture of European genes. They are historically, culturally, and genetically closely related to the Inuit of Canada and the Inupiat of Alaska and speak mutually intelligible dialects of the same language. The population is scattered along the coastline in 17 towns and 60 villages, most of which are situated on the west coast between the 60th and the 75th parallels. Only 19% of the 18- to 59-year-old male Greenlanders rely on hunting or fishing for a living, but subsistence hunting as a supplement to a paid job is common .n = 228). Among these, the interview was supplemented with a clinical examination and blood sampling. The subsample consisted of fewer men than the total Inuit population of Greenland , and the 18- to 34-year-old age group was especially underrepresented.During 1993\u20131994, a sample of the inhabitants in Greenland, selected at random from the central population register, was asked to participate in a health interview survey. From the 1,728 participants, a subsample of Greenlanders (Inuit) from three towns and four villages on the west coast of Greenland were selected at random for the present study , and fish. The frequency categories were daily, 4\u20136 times a week, 1\u20133 times a week, 2\u20133 times a month, once a month or less, and rarely.Blood samples were obtained after overnight fasting. The blood was separated, frozen at \u221220\u00b0C, and shipped to Denmark, where the samples were analyzed for lead by atomic absorption spectrometry at the National Environmental Research Institute of Denmark  . The detp-Values were calculated by analysis of variance from log-transformed blood lead values. The association between several dietary variables and blood lead was explored in a general linear model with control for age and sex .  and sex . NonsignEthical approval was obtained from the Commission for Scientific Research in Greenland. Informed consent was obtained verbally.p < 0.001) and were higher among men than among women  but were not significantly associated with body mass index, smoking, or consumption of alcohol.Dietary information was obtained from 222 participants, and blood lead analysis was carried out on 162 of these (73%). The sub-sample consisted of 67 men  and 94 women . After the removal of one outlier with a lead concentration of 1.0 \u03bcg/L, the mean \u00b1 SD concentration of blood lead in this population was 94.4 \u00b1 69.6 \u03bcg/L . Lead concentrations increased significantly with age . In a multivariate analysis age, sex, and consumption of sea birds were retained in the model, whereas the other dietary variables were not. Adjusted for these covariates, consumption of sea birds was still significantly associated with blood lead  are very low . The cauWe made a rough estimate of the lead intake from birds in Greenland. The dominating species in Greenland bird hunting are the thick-billed murre and the common eider. From 1994 to 1999, the annual reported hunt ranged from 187,685 to 254,728 murres and from 72,109 to 83,810 eiders . JohanseThe Food and Agriculture Organization (FAO)/World Health Organization (WHO) (1993) has established a provisional tolerable weekly intake (PTWI) equivalent to 1,500 \u03bcg lead/week for a person weighing 60 kg (25 \u03bcg/ kg/day). This recommendation was maintained at the meeting of the Joint WHO/FAO Expert Committee of Food Additives in 1999 . The calThe lead intake from other dietary sources is estimated to be significantly lower than that from tissue contaminated with lead shot. The lead intake from the traditional diet in Greenland has been estimated to be only 15 \u03bcg per person per week , and theEarlier theories that elevated blood levels in Greenland were caused by long-range transport of lead, mainly from leaded gasoline , must beHowever, blood lead levels in Greenland have declined over the past 20 years . It is p"}
+{"text": "Childhood lead poisoning remains a critical environmental health concern. Low-level lead exposure has been linked to decreased performance on standardized IQ tests for school-aged children.In this study we sought to determine whether blood lead levels in early childhood are related to educational achievement in early elementary school as measured by performance on end-of-grade (EOG) testing.Educational testing data for 4th-grade students from the 2000\u20132004 North Carolina Education Research Data Center were linked to blood lead surveillance data for seven counties in North Carolina and then analyzed using exploratory and multivariate statistical methods.The discernible impact of blood lead levels on EOG testing is demonstrated for early childhood blood lead levels as low as 2 \u03bcg/dL. A blood lead level of 5 \u03bcg/dL is associated with a decline in EOG reading (and mathematics) scores that is roughly equal to 15% (14%) of the interquartile range, and this impact is very significant in comparison with the effects of covariates typically considered profoundly influential on educational outcomes. Early childhood lead exposures appear to have more impact on performance on the reading than on the mathematics portions of the tests.Our emphasis on population-level analyses of children who are roughly the same age linked to previous (rather than contemporaneous) blood lead levels using achievement (rather than aptitude) outcome complements the important work in this area by previous researchers. Our results suggest that the relationship between blood lead levels and cognitive outcomes are robust across outcome measures and at low levels of lead exposure. Although much progress has been made, childhood lead poisoning remains a critical environmental health concern. Since the late 1970s, mounting research demonstrates that lead causes irreversible, asymptomatic effects far below levels previously considered safe. Thus, the Centers for Disease Control and Prevention (CDC) lowered incrementally its intervention threshold for lead levels considered dangerous in children by 88% from 60 to 10 \u03bcg/dL over the last 40 years . The 200Low-level lead exposure, including prena-tal exposure, has been linked to decreased performance on standardized IQ tests for school-age children . A meta-Another study examining repeated blood lead levels in children followed from < 1 to 5 years of age detected steeper declines in cognitive abilities in children whose maximum blood lead level never reached 10 \u03bcg/dL . Linear Thus, research suggests that significant adverse health effects occur at blood lead levels below the current CDC blood lead action level, leading several researchers to call for its lowering. Learning and behavioral deficits may occur at blood lead levels < 5 \u03bcg/dL . Meta-anLinking blood lead surveillance data with end-of-grade testing data for several counties in North Carolina, this study explores the potential relationship between early childhood lead exposure and educational achievement in elementary school. The objective of the current study is to determine whether blood lead levels in early childhood are related to educational achievement in early elementary school as measured by performance on end-of-grade testing. In undertaking this study, we link two large databases generated by two different offices of the State of North Carolina in the same populations but at different time periods.Our study focuses on seven counties in the Piedmont region of North Carolina . By asseKey data for this study include blood lead surveillance data from the state registry maintained by the North Carolina Childhood Lead Poisoning Prevention Program of the Children\u2019s Environmental Health Branch, North Carolina Department of Environment and Natural Resources in Raleigh, North Carolina (2004), and educational testing data from the North Carolina Education Research Data Center (NCERDC) of Duke University, in Durham, North Carolina (2006). Methods for receiving, storing, linking, analyzing, and presenting results related to this study were all governed by a research protocol approved by the Duke University Institutional Review Board.The blood lead surveillance data include child name, birth date, test date, blood lead level, type of test (venous or capillary), and home address. The North Carolina State Laboratory for Public Health  conducted 90% of the lead analyses of the blood samples. The limit of detection for lead in blood as analyzed by the State Laboratory is 1 \u03bcg/dL, but all children whose blood lead levels are below the level of detection are assigned a value of 1 \u03bcg/dL in the state database. Blood lead levels are stored in the state database as integer values only. Most of the samples were sent to the State Laboratory from private providers, indicating that the samples were collected by trained health care professionals. Thus we can be confident in the consistency of blood lead sample collection across samples. We used blood lead screening data from 1995\u20131998. During this period, North Carolina estimates that it screened between 21.9 and 30.4 percent of children 1 and 2 years of age . In theoNorth Carolina Standard Course of Study\u201d (a) cognition, b) interpretation, c) critical stance, and d) connections (a) number sense, numeration, and numerical operations; b) spatial sense, measurement, and geometry; c) patterns, relationships, and functions; and d) data, probability, and statistics  were linked to their records in the 4th-grade EOG testing data in age-corresponding years. The early childhood environmental data (blood lead levels) were linked to elementary school educational outcome data (EOG test results) using 16 different combinations of social security number, date of birth, county federal information processing standards code, and first and last name. The linking schemas were designed to ensure accuracy while trying to achieve the highest number of linked records possible. Records that were linked were given a code for the particular type of linking method used, which enabled each method to be reviewed for the number of accurate matches that it provided. Each of the linking methods used educational data from 2000 to 2004, which allowed individuals to potentially be linked from the blood lead surveillance data to multiple end-of-grade tests from the educational data. Our process linked 42.2% of screened children to at least one EOG record. The percent linked for each county ranges from 24.4% for Orange County to 44.9% for Alamance County.Assessing educational achievement based on standardized testing data is especially problematic for children for whom English is a second language. Thus we restricted our analysis to students who self-reported race as either white or black and who did not report any limited English proficiency. In so doing, we decreased our linked sample size by roughly 8%. We conducted all analyses on 4th-grade scores, both reading and mathematics. The final linked data set for 4th-grade reading and mathematics results contained 8,603 and 8,627 observations, respectively. R2, Akaike Information Criterion (AIC), and root mean squared error (MSE). All analyses were conducted using STATA 9.2 .We employed both descriptive and multivariate statistical methods in our analysis, including Mantel-Haenzel chi-square tests to check equality of distributions of the black and white subsamples, and three different multivariate models to regress the EOG scores on a series of covariates. All models controlled for the following covariates as listed in the EOG test data: sex and race as standard demographic variables; participation in the free or reduced-price lunch program as a measure of socioeconomic status; parental education as a proxy for parental IQ and as a measure of socioeconomic status; daily computer use as a measure of stimulation in the home environment; and whether the school is a charter school, which in North Carolina is typically a measure of lower socioeconomic status of the enrolled children as a group. We included a covariate for age at which the blood lead screen occurred (taken from the blood lead screening data) to control for age-dependent effects of lead exposure. We also incorporated dummy variables for each of the school systems. The three models differed only by how the blood lead level variables are constructed in the model\u2014as a continuous variable or multiple dummy variables. The models are compared via several test statistics such as adjusted We began our descriptive analysis by examining patterns in the linked data. For space reasons, we present here only the descriptive statistics for 4th-grade reading results. The 4th-grade mathematics results follow strikingly similar patterns. The multivariate analyses presented below include both 4th-grade reading and mathematics.p < 0.0001).At the lower end of the achievement scale, Although this descriptive evidence is consistent with claims of a causal relationship between blood lead levels and test performance, alternative interpretations are plausible and can be addressed using multivariate analysis. For instance, given the higher blood lead level for children of lower socioeconomic status , perhaps these factors are responsible for the observed association of blood lead levels and test scores. Thus we used multivariate analysis to control for the covariates noted in \u201cMethods.\u201d The referent group is defined as white female students, enrolled in the Wake County School System, who do not participate in the free or reduced-price lunch program, who do not use a computer daily, and whose parents graduated high school.To explore the functional form of the association between the lead variable and test scores, we compare three alternative specifications. The 6 analyses (3 models \u00d7 2 data sets) are presented in In all models, the coefficients on the covariates are of the expected sign. The coefficient on the age at which the blood screen occurred is negative and highly significant, indicating that a higher blood lead level at a later age has a stronger depressive effect on test performance. This likely results from the fact that children who have high blood lead levels at 4 or 5 years of age typically would have had even higher blood lead levels at 2 or 3 years of age, given that the latter is typically considered the age of peak exposure .p < 0.0001). This effect and others discussed below are net of all control variables shown in the table.The first model represents blood lead level as a continuous variable: We constrain the effect of a one-unit increase in blood lead level to be identical over the full range of observed scores. The coefficient on blood lead level is negative and statistically significant for 4th-grade reading and 4th-grade mathematics (both p < 0.0001). In addition, the coefficient on the dummy variable for a blood lead level of 10 \u03bcg/dL is negative and significant in both the reading and mathematics models . In analysis not shown here, we also estimated a model that used a single dummy variable for blood lead level \u2265 5 \u03bcg/dL and a separate model with a single dummy variable for blood lead level \u2265 10 \u03bcg/dL. The results in The second model includes two dummy variables: one that is set equal to 1 if the blood lead level is 5\u20139 \u03bcg/dL; and one that is set equal to 1 if the blood lead level is \u2265 10 \u03bcg/dL. The coefficient on the dummy variable for a blood lead level of 5\u20139 \u03bcg/dL is negative and significant in both the reading and mathematics models . The last dummy variable combines all blood lead levels \u2265 10 \u03bcg/dL, and the referent group is a blood lead level of 1 \u03bcg/dL. This scoring is the most flexible and allows a distinct estimate at each blood lead level score.p = 0.05. The coefficients on the dummy variables for blood lead levels of 3\u20138 and 10 \u03bcg/dL are consistently negative and statistically significant, and generally increase in absolute magnitude as the blood lead levels increase . The coefficient on the dummy variable for a blood lead level of 9 \u03bcg/dL is also negative but significant only at the p = 0.02 level, likely due to the small sample size in this grouping. The results for the 4th-grade mathematics analysis follow a very similar pattern to those of the reading analysis, although the coefficient on the dummy variable for a blood lead level of 2 \u03bcg/dL is significant at the p = 0.03 level, and the coefficient on the dummy variable for a blood lead level of 9 \u03bcg/dL is significant at the p < 0.0001 level.For the 4th-grade reading analysis, the coefficient on the dummy variable for a blood lead level of 2 \u03bcg/dL is negative and marginally significant at Model 3 results demonstrate a strong dose\u2013response effect between early childhood lead exposure and performance on elementary school achievement tests. These results indicate clearly that early childhood lead exposure has a statistically significant and negative impact on school performance at levels well below the current CDC blood lead action level. These results are consistent with the observed association between blood lead levels and elementary school achievement scores demonstrated in both the descriptive analysis and regression models 1\u20132. All three models indicate, net of a set of control variables, that higher blood lead levels are associated with lower test scores. The least constrained model (model 3) reveals a general decline in test scores with rising blood lead levels. Model 1 constrains this decline to be uniform across all blood lead levels. With our data, we cannot reject the latter in favor of the former; any divergence from a linear decline could be attributed to sampling variability. Model 2 can be aligned with the following question: Once we take account of high blood lead levels  is additional variation in blood lead levels important? Results clearly indicate that blood lead levels of 5\u201310 \u03bcg/dL are consequential for test scores. We conclude from these various representations that early childhood blood lead levels reduce test scores and that this effect is clear even at levels < 10 and even < 5 \u03bcg/dL.R2, AIC, and root MSE), all three models show adequate and substantially similar model fit. Given the statistical measures of model fit provided in As perhaps is best seen in In addition, early childhood lead exposures appear to have more impact on performance on the reading than on the mathematics portions of the EOG, although the differences may not be statistically significant. This differential impact on reading versus mathematics is consistent with previous studies .The estimated effects are mean effects\u2014averages of the adverse effects across children. These shifts will affect a substantial number of children at any given test threshold. For example, at the low end of the distribution, the impact of lead on EOG test results is sufficient to ensure that some students, who would otherwise have passed the test, will fail. This in turn has implications for retention in grade. In addition, at the high end of the distribution, the impact of lead on EOG test results will essentially block some students from gaining access to the enriched resources provided through advanced and intellectually gifted (AIG) programs. As is true for many states, the use of EOG scores to determine placement into AIG programs is ubiquitous in North Carolina. These two phenomena are especially troubling given that we know that low-income and minority children are systematically exposed to more lead in North Carolina and nationally.It is also notable that the size of the coefficients on the lead variables is very meaningful compared with other covariates that we typically think of as profoundly influential on educational outcomes. For example, in model 3, in the 4th-grade reading analysis, a blood lead level of 3 \u03bcg/dL has an impact roughly equal to 59% of the impact of participating in the free or reduced-price lunch program (the classic poverty indicator in school data). A blood lead level of 4 \u03bcg/dL has an impact roughly equal to 90% of the impact of participating in the free or reduced-price lunch program, and a blood lead level of \u2265 6 \u03bcg/dL has a greater impact. In addition, the size of the coefficients, which may seem small compared with the constants (~ 250\u2013265), are in fact quite substantial in context. For example, across North Carolina in 2003\u20132004, the interquartile range for 4th-grade reading EOG test scores spanned 12 points, and the interquartile range for 4th-grade mathematics EOG test scores spanned 10 points. Thus a blood lead level of 5 \u03bcg/dL is associated with a decline in EOG reading (mathematics) scores that is roughly equal to 15% (14%) of the interquartile range.This study has several limitations. First, previous cohort studies have shown that direct measures of parental IQ and quality of the home environment are important explanators of test performance in children . Our stuDespite its limitations, this study enriches the existing literature on the link between early childhood lead exposure and cognitive outcomes. Our emphasis on a population-level analysis of children who are roughly the same age linked to previous (rather than contemporaneous) blood lead levels using achievement (rather than aptitude) outcome complements the important work in this area by previous researchers . Our resIn conducting this analysis, we noted that a higher proportion of black children had higher blood lead levels. Thus, in future analyses we plan to explore whether this differential exposure to lead in early childhood might explain part of the so-called achievement gap. We are also interested in following the same children through their elementary, middle school, and high school years to assess the persistence of the effects we note here."}
+{"text": "The impact of prenatal lead exposure on neurodevelopment remains unclear in terms of consistency, the trimester of greatest vulnerability, and the best method for estimating fetal lead exposure.We studied prenatal lead exposure\u2019s impact on neurodevelopment using repeated measures of fetal dose as reflected by maternal whole blood and plasma lead levels.We measured lead in maternal plasma and whole blood during each trimester in 146 pregnant women in Mexico City. We then measured umbilical cord blood lead at delivery and, when offspring were 12 and 24 months of age, measured blood lead and administered the Bayley Scales of Infant Development. We used multivariate regression, adjusting for covariates and 24-month blood lead, to compare the impacts of our pregnancy measures of fetal lead dose.p < 0.05) of poorer Mental Development Index (MDI) scores. In models combining all three trimester measures and using standardized coefficients, the effect of first-trimester maternal plasma lead was somewhat greater than the effect of first-trimester maternal whole blood lead and substantially greater than the effects of second- or third-trimester plasma lead, and values averaged over all three trimesters. A 1-SD change in first-trimester plasma lead was associated with a reduction in MDI score of 3.5 points. Postnatal blood lead levels in the offspring were less strongly correlated with MDI scores.Maternal lead levels were moderately high with a first-trimester blood lead mean (\u00b1 SD) value of 7.1 \u00b1 5.1 \u03bcg/dL and 14% of values \u226510 \u03bcg/dL. Both maternal plasma and whole blood lead during the first trimester (but not in the second or third trimester) were significant predictors (Fetal lead exposure has an adverse effect on neurodevelopment, with an effect that may be most pronounced during the first trimester and best captured by measuring lead in either maternal plasma or whole blood. The findings of a wide variety of international studies on the impacts of lead exposure on mental development persuaded many countries to progressively reduce the amount of lead exposure deemed safe during childhood. Since 1991, the U.S. Centers for Disease Control and Prevention (CDC) has recommended 10 \u03bcg/dL (0.48 \u03bcmol/L) as the pediatric blood lead screening action guideline , with reA related issue that has received less attention is the extent to which prenatal lead exposure may produce adverse outcomes. This issue has emerged as a potentially large public health problem because of two recent insights. First, substantial fetal lead exposure can occur from mobilization of maternal skeletal lead stores, which, in turn, can persist many years after external lead exposure has declined . Second Until now, few epidemiologic studies have used designs that allow the neurodevelopmental impacts of prenatal lead exposure to be distinguished from those of postnatal lead exposure. Among these, some have shown an inverse association between prenatal lead exposure and infant neurodevelopment  and someAn important factor that might contribute to inconsistency across studies is variability in the assessment and timing of dose to the fetus. Some studies measured maternal whole blood lead during the second and third trimesters and at delivery , whereasThe toxicokinetics of lead in the maternal\u2013fetal unit are poorly understood. Lead levels in different compartments and at different stages of pregnancy are only modestly correlated, suggesting that each measure captures different aspects of fetal exposure . It is wRecent evidence also suggests that whole blood lead levels in a pregnant woman might not be the optimal marker for lead concentrations in the fetal brain. Over 99% of lead in whole blood is bound to red cells and thus not available to cross the placenta ; insteadTo date, no study of fetal lead neurotoxicity has included the biomarker measurements needed to compare whole blood and plasma lead levels during each trimester of pregnancy as predictors of infant neurodevelopment. It is such a comparison that we report here.Subjects were recruited between May 1997 and July 1999 from 2,273 women approached during prenatal visits at one of three clinics of the Mexican Institute of Social Security (IMSS) in Mexico City. Women were eligible if they had a confirmed positive \u03b2-human chorionic gonadotropin test or were trying to become pregnant, lived in Mexico City, and were willing to participate in the 3-year follow-up study protocol. Of the 2,273 women approached, 1,502 (66%) declined to be enrolled. We applied the following exclusion criteria to the 771 (34%) women who were willing to participate (percent excluded in parentheses): having plans to leave the area in the following 5 years (3.7%); having a psychiatric disorder (0%); daily consumption of alcoholic beverages (0%); addiction to illegal drugs (0%); continuous use of prescription drugs (0%); diagnosis of high-risk pregnancy (10.9%), preeclampsia (0.9%), renal or circulatory disease including hypertension (8.4%), or gestational diabetes (0.7%); suffering from seizures that required medical treatment (0.3%); and being pregnant with > 14 weeks of gestation (15.3%). A total of 280 already pregnant women were recruited; 182 women with a negative pregnancy test declared an intention to become pregnant in the near future and were also recruited. Of the latter group, 47 became pregnant, agreed to participate, and were enrolled in the cohort comprising a total of 327 pregnant women.Of these 327 women, 216 continued the full follow-up and bore children who were evaluated for the Bayley Mental Development Index (MDI)  at 24 moAll mothers were informed about the study; those who agreed to participate read and signed a letter of informed consent. The research protocol was approved by the Ethics Committees of the National Institute of Public Health of Mexico, the Harvard School of Public Health, the Brigham and Women\u2019s Hospital, the University of California, and the participating hospitals.3 venous blood was then collected into a polyethylene tube containing 100 ISP  sodium heparin , processed, and shipped to the trace metal facility at the University of California, Santa Cruz, for measurement of whole blood lead and plasma lead using ultra-clean methods detailed elsewhere  Hospital in Mexico City. Visits were scheduled at 12, 24, and 34 weeks of pregnancy, and samples were classified as corresponding to first, second, or third trimester according to the timing of these visits. Subjects were instructed to fast overnight before sample collection. Before venipuncture, each subject\u2019s arm was washed with ultrapure water and disinfected with reagent-grade alcohol. Three milliliters of venous whole blood was collected with a butterfly catheter (19 gauge) into a low-lead container  for blood lead analysis, and 13 cmlsewhere . All samlsewhere . Accordip = 0.32); and accuracy was comparable (with difference in means < 1.0 \u03bcg/dL).Umbilical cord and infant venous blood samples at 24 months were collected in trace metal\u2013free tubes. Due to the logistical constraints posed by the collection of samples during birth from multiple hospitals and at unpredictable hours, we obtained data on cord blood on only 57% of the mothers participating in this study. Samples were analyzed for lead using an atomic absorption spectrometry (AAS) instrument  at the metals laboratory of the ABC Hospital, which participates in the external validation protocol of the Wisconsin Laboratory of Hygiene. The Pearson correlation coefficient between all available measurements by AAS and those by ICP-MS was 0.93 (in mothers). Precision was similar using either measuring technique; standard deviations were not significantly different   using a ce Score .Z-scores by using World Health Organization (WHO)/National Center for Health Statistics/ CDC reference data (p < 0.1) associated with MDI scores in bivariate analyses were included in multiple linear regression models; given these criteria, confounders included were child\u2019s sex, blood lead at 24 months of age, height for age z-score and weight, as well as maternal age and intelligence quotient. All models featured loge-transformed lead measures because this procedure provided the best fit. We first generated \u201csingle-trimester\u201d models, in which we evaluated the associations between MDI score and loge-transformed plasma and whole blood lead levels during each trimester of pregnancy adjusting for potential confounders. We generated \u201cmultitrimester\u201d models, incorporating, in each model, the data from either plasma or whole blood lead concentrations from all three trimesters. We also ran models using maternal plasma lead or whole blood lead, averaged over all three trimesters.Descriptive statistics and appropriate transformations were performed before bivariate analyses. Outliers were identified using the ESD (Extreme Studentized Deviate) Many-Outlier procedure . We calcnce data  and intee-transformed cord blood lead levels as a proxy variable for prenatal lead exposure. To account for environmental exposure to lead in postnatal life, we also modeled MDI as a function of the child\u2019s blood lead concentrations at 24 months of age.To enable better comparability of the relative effects of plasma lead and blood lead, we compared effect estimates for a 1-SD change in each exposure metric. We carried out a similar analysis using logDue to postponed visits to the research center visits of some women, misclassification of the timing of some of the visits occurred .n = 70; data not shown). Circulating levels of lead in the included mothers were moderately high, with mean (\u00b1 SD) values for first-trimester whole blood lead of 70.7 \u00b1 51.0 \u03bcg/L and 14% of values \u2265 10 \u03bcg/L ; Spearman correlations between blood lead measurements at different stages of pregnancy  were, on average, higher than their plasma lead counterparts . Cord blood lead was most highly correlated with maternal whole blood lead measured during the third trimester of pregnancy . Cord blood lead concentrations were 10.6 \u03bcg/L lower, on average, than maternal whole blood lead levels at delivery. Children\u2019s whole blood lead levels at 12 and 24 months of age were correlated  and lower, on average, than their cord blood lead levels.As expected, measurements of lead biomarkers in the three stages of pregnancy were moderately well correlated  and whole blood lead . Both maternal plasma and whole blood lead averaged over all three trimesters had associations with MDI of borderline significance .Single-trimester models of MDI scores  suggesten = 56) were \u22126.39 (p = 0.04) and \u22126.94 (p = 0.04) points per log micrograms per liter of plasma and whole blood lead, respectively. The coefficients for the second trimester plasma and whole blood lead levels (n = 102) were much smaller . Umbilical cord lead at birth and infant whole blood lead at 12 and 24 months were inversely but weakly (p > 0.20) associated with MDI at 24 months.When we repeated the analysis using only those measurements correctly classified in each trimester of pregnancy, we found that lead concentrations during the first trimester were significantly associated with a decrease in MDI at 24 months of age. The estimated coefficients in the first trimester (e-transformed plasma lead in the first trimester is associated with a 3.5-point lower MDI score at 24 months of age (p = 0.03). The corresponding increase in whole blood lead during the first trimester is associated with a 2.4-point lower MDI score at 24 months of age (p = 0.19). When first-trimester plasma lead concentrations were included in the model, plasma lead concentrations in the second and third trimester were not significantly associated with MDI. When both plasma and whole blood lead are simultaneously evaluated, although none of the standardized coefficients are statistically significant, the plasma lead coefficient is more than twice as great as its blood lead counterpart .In multitrimester models , the plaThe logarithmic nature of the relationship between first-trimester plasma lead levels and MDI at 24 months of age is depicted in This study is the first of which we are aware that attempted to compare the relative influence on neurodevelopmental toxicity of two different biomarkers of fetal lead exposure at each stage of pregnancy. We found that both maternal blood lead and maternal plasma lead vary considerably over pregnancy; first-trimester levels of either measures were better than second- or third-trimester levels or levels averaged over all three trimesters at predicting infant neurobehavioral performance at age 24 months; and first-trimester maternal plasma lead levels were somewhat better than first-trimester maternal whole blood lead levels at predicting infant neurobehavioral performance at 24 months of age.n = 2,273), raising the issue of the generalizability of our study. However, the women included in our final sample did not differ significantly from other eligible subjects on key covariates, suggesting that our sample was quite representative of the women serviced by our participating clinics. Some of our observations were misclassified with respect to trimester; however, our results were very similar in the reanalysis using classification corrections. Indeed, the association between first-trimester lead exposure and infant neurodevelopment appeared to be even greater, a finding that suggests that there was downward bias due to improper assignment of second-trimester women to the first trimester category. We did not control for a summary measure of home conditions, such as the Home Observation for Measurement of the Environment (HOME) score; however, the absence of this covariate is unlikely to explain differences in effects among the three trimesters of lead exposure. Finally, offspring blood lead levels at 24 months did not significantly predict lower MDI score; on the other hand, our sample size, again, was modest, and in a separate analysis of the larger group of mother\u2013infant pairs participating in this research (n = 294) that was not confined to women who had plasma lead measurements, we found a significant adverse impact of offspring blood lead levels at 24 months of age on 24-month MDI score , their observations began after the 12th week of pregnancy and thus precluded examination of the direct effects of first-trimester lead exposure.We are not aware of previous studies for comparison that have included maternal measures of circulating lead at each stage of pregnancy. Although In experimental studies, lead is known to affect a wide range of processes critical to central nervous system development, including differentiation , myelinaMobilization of maternal bone lead stores has been clearly identified as a major source of fetal lead exposure , and eleOur findings do not mean that measurement of maternal plasma lead is likely to become a clinically useful environmental health tool. The methods required to measure plasma lead are laborious and require special and expensive equipment. However, this biomarker is a useful research tool in efforts to understand and detect the health impacts of environmental lead exposure.In conclusion, we found that first-trimester measures of fetal lead exposure\u2014particularly levels of lead in maternal plasma, but also levels of lead in maternal whole blood\u2014were predictive of adverse neurodevelopment later in life, with an effect that was independent from that of postnatal lead exposure and that was stronger than the effects associated with second- or third-trimester measures. This is of major potential public health concern because lead remains a widespread environmental health hazard and current efforts at primary prevention have focused almost entirely on childhood rather than fetal exposure. If future research confirms this finding, ascertaining women at risk and identifying effective strategies for prevention of fetal lead exposure may become an important public health priority; moreover, it may be necessary to consider prepregnancy interventions, because our research suggests that screening and intervention any later than the first trimester may be too late to prevent the greatest fetal neurotoxic effects."}
+{"text": "Lead hazard control measures to reduce children\u2019s exposure to household lead sources often result in only limited reductions in blood lead levels. This may be due to incomplete remediation of lead sources and/or to the remobilization of lead stores from bone, which may act as an endogenous lead source that buffers reductions in blood lead levels. Here we present a noninvasive isotopic approach to estimate the magnitude of the bone lead contribution to blood in children following household lead remediation. In this approach, lead isotopic ratios of a child\u2019s blood and 5-day fecal samples are determined before and after a household intervention aimed at reducing the child\u2019s lead intake. The bone lead contribution to blood is estimated from a system of mass balance equations of lead concentrations and isotopic compositions in blood at the different times of sample collection. The utility of this method is illustrated with three cases of children with blood lead levels in the range of 18\u201329 \u03bcg/dL. In all three cases, the release of lead from bone supported a substantial fraction of the measured blood lead level postintervention, up to 96% in one case. In general, the lead isotopic compositions of feces matched or were within the range of the lead isotopic compositions of the household dusts with lead loadings exceeding U.S. Environmental Protection Agency action levels. This isotopic agreement underscores the utility of lead isotopic measurements of feces to identify household sources of lead exposure. Results from this limited number of cases support the hypothesis that the release of bone lead into blood may substantially buffer the decrease in blood lead levels expected from the reduction in lead intake. Becaused plasma . In child plasma . Moreoved plasma . These aThe importance of bone lead storage and mobilization in controlling blood lead levels has been documented in adults . IncreasMeasurements of bone lead content in children could be used to establish empirical relationships between bone and blood lead levels in pediatric populations. However, this relationship would be affected by other factors such as current lead intake, age, and history of exposure that are thought to affect the nature of the bone lead\u2013blood lead relationship. Nevertheless, because of the importance of bone lead in human lead toxicokinetics, the potential effect of bone turnover on blood lead content has been included in the structure of pharmacokinetic models of childhood lead poisoning. These include the Integrated Exposure and Uptake Biokinetic model , O\u2019FlaheLead isotopic methods provide an alternative approach to estimate the impact of endogenous sources of lead on blood lead content . In its Studies by Here we present a noninvasive isotopic approach to estimate the magnitude of the bone lead contribution to blood in children following household lead remediation. This approach does not require lead isotopic measurements of bone, nor does it assume the lead isotopic ratio of bone on the basis of the child\u2019s lead exposure history. Instead, blood and feces are sampled for lead concentration and isotopic analyses before and after implementation of environmental lead hazard control measures to reduce the child\u2019s lead exposure(s). Estimation of the bone lead contribution to blood using this method is illustrated with three cases of childhood lead poisoning. In addition, the sources of lead exposure to the child are identified from a comparison of the lead isotopic compositions of household sources and feces, using the latter as a surrogate measure of the magnitude and isotopic composition of lead intake.The isotopic composition of blood is a function of the isotopic compositions and relative lead contributions of exogenous intake and endogenous sources. Here, we assume that the isotopic composition of feces reflects the isotopic composition of lead intake. However, the isotopic composition of bone is not known. To calculate this value and be able to solve the relative lead contributions from intake and from the skeleton to blood, we rely on an induced change in the magnitude and isotopic composition of lead intake through the elimination of identified household sources of lead exposure . The assumption in this approach is that by reducing the magnitude of the child\u2019s lead intake, the relative contribution of lead to blood from the endogenous skeletal source increases and the lead isotopic composition of blood shifts toward the isotopic value of bone.We applied a system of linear equations to calculate the endogenous lead contribution to blood, with lead content and isotopic composition of blood and feces before and after intervention as independent variables. More generally, this system of equations can be applied between any two time points with different blood lead levels, regardless of the cause and direction of change in blood lead content (increase or decrease).t1 and t2, to describe the mixing of lead in blood:We used the following mass balance equations for lead content and for lead isotopes at two different time points, blood is the concentration of lead in blood, in micrograms per deciliter. Pbin and Pbbone are the amounts of lead in blood from external intake and from bone, respectively, in micrograms per deciliter. (207Pb/206Pb)in is the isotopic ratio of lead in blood derived from external intake, and it is assumed to be identical to the isotopic composition of lead measured in feces, as follows:where PbIt is also assumed that the lead isotopic composition of bone did not change between the two time points considered, as follows:in, is proportional to the rate of lead intake. Here, the rate of lead excretion  is used as a surrogate of the rate of lead intake, as follows:It is assumed that the amount of lead in blood from the external intake, PbK is a biokinetic constant (in micrograms per deciliter/micrograms excreted per day) that relates the lead content of feces to the amount of lead in blood from external intake. This biokinetic constant K is different from the more familiar term biokinetic slope factor (BKSF), which refers to the increase in blood lead per unit of lead absorbed (instead of excreted) across the gastrointestinal (GI) tract bone, with no need for parameterization .where Notably, this method can be applied to obtain the relative contributions of lead from the intake and the skeleton to blood only when the lead isotopic compositions of the external (intake) and internal (skeleton) sources are different. In practical terms, because the isotopic composition of the skeletal lead source typically cannot be known, this approach can be applied only if the difference between the blood and intake lead isotopic compositions is greater than the isotopic measurement error.Children were recruited by the Children\u2019s Hospital of Philadelphia from referrals by the Philadelphia Childhood Lead Poisoning Prevention Program. Inclusion criteria were that blood lead level was between 15 and 35 \u03bcg/dL, the child was < 6 years of age, the child spent most of his or her waking time within a single household environment, and the blood and fecal lead isotopic compositions were measurably different . Four cases were recruited. Three boys, 14, 20, and 46 months of age, met the inclusion criteria and were retained in the study . One cast2) at least 1 month after the house-hold cleaning. Finally, a third round of blood and 5-day fecal collections was performed at least 3 months after the second round of sample collection  vacuuming and wet washing of all horizontal surfaces with trisodium phosphate detergent. Blood and 5-day fecal samples were collected a second time (llection .Blood samples (3 mL) were collected into low-lead heparinized Vacutainer tubes  by the Children\u2019s Hospital of Philadelphia. Parents collected daily fecal samples in diapers provided by the study  or in perforated urine collection \u201chats\u201d  that had been prewashed with distilled water and air-dried in a filtered-air environment. Household samples of all deteriorated paints, floor dusts, and soils, if appropriate, were sampled by the Philadelphia Health Department following U.S. Department of Housing and Urban Development (HUD) guidelines (HUD 1995). All samples were shipped to the University of California at Santa Cruz for lead concentration and isotopic composition analyses, as described below.Processing of biologic samples was conducted under trace-metal\u2013clean HEPA-filtered air (Class-100) conditions using clean techniques . Acids u3. After evaporation to dryness, samples were reconstituted in 1N HNO3, and centrifuged at 15,000 \u00d7 g. The supernatant was spiked with 209Bi for analysis in an inductively coupled plasma mass spectrometer (ICP-MS), as described below.Blood samples were processed in triplicate as described in 3 for at least 12 hr. After evaporation to dryness, samples were reconstituted in 1N HNO3, filtered , and spiked with 209Bi for analysis by ICP-MS. Dust wipes were digested in a similar fashion.Paint (0.1\u20130.2 g) and soil (~1 g) samples were homogenized with mortar and pestle, weighed, and digested in trace-metal\u2013grade 16N HNO204Pb abundance was not measured. National Institute of Standards and Technology (NIST) standard reference material (SRM) 955b level 4 (lead in blood) was used to evaluate the precision of lead isotopic and accuracy of lead concentration measurements in blood. The measured lead concentration of the 955b blood SRM was 38.6 \u00b1 1.3 \u03bcg/dL , in good agreement with the certified value of 39.4 \u03bcg/dL. The precision of the blood 207Pb/206Pb ratio measurements over the course of the study was 0.2% [2\u00d7 relative standard deviation (RSD)], based on the analyses of NIST 955b blood SRM over 5 different days of analyses. The precision of blood 207Pb/206Pb and 208Pb/206Pb ratio measurements within an analytical run was 0.16 and 0.26% (2\u00d7 RSD), respectively, based on triplicate analyses of the children\u2019s blood samples at each single collection interval. The average difference in 207Pb/206Pb and 208Pb/206Pb ratios between homogenized feces duplicates was 0.11 and 0.16%, respectively (n = 39 pairs). Precision and accuracy of lead isotopic ratios of environmental samples were estimated from repeated measurements of NIST 981 . The long-term precision of NIST 981 207Pb/206Pb and 208Pb/206Pb ratios was 0.13 and 0.10% , and the accuracy was within 0.05% of the certified ratio values.A double focusing magnetic sector ICP-MS  was used for lead isotopic and concentration measurements using the method of n = 12). Fecal sample contamination associated with homogenization was < 5 ng lead, based on total procedural homogenization blanks (n = 6) processed with each batch of feces. These lead blank values are three orders of magnitude less than the typical amount of lead found in feces in a diaper, indicating that fecal lead contamination associated with collection and processing was negligible.Diaper blank was estimated to be approximately 5.8 ng lead per diaper, based on the analyses of ultrapure water rinsed over the inner surface of new diapers  was approximately 20 times larger than the isotope ratio measurement error (< 0.2%)  . In gene(< 0.2%)  by the lt1) are in much closer proximity to each other than what is observed in the other two cases, consistent with a greater relative impact of recent lead exposures on blood lead levels.The lead content of feces of case 3 in the first visit indicates very variable daily lead intake . The higt1) were low, as reflected in the lead content of feces  . However, the blood lead levels in these two cases  are comparable with or higher than in case 3 (18.3 \u03bcg/dL). In addition, in both cases 1 and 2, blood from all sampling rounds contained higher 207Pb/206Pb ratios than the average feces .In contrast to case 3, the lead intakes of cases 1 and 2 in the first round of sampling (t1) and second (t2) visits in all three cases, even though in cases 1 and 2 there was no significant change in the fecal lead content . In these two cases the blood isotopic composition at the second visit (t2) moved toward the isotopic composition of feces (case 1) or remained unchanged .Blood lead levels declined between the first (t2) and the blood 207Pb/206Pb ratios shifted away from the isotopic composition of feces (t3), the blood lead level also increased , and its isotopic composition shifted back closer to the fecal lead 207Pb/206Pb ratio . Thus, in cases 2 and 3, where three sampling rounds took place, it is possible to obtain two estimates of the bone lead contribution to blood for each collection time point. This is because each sampling round is used in two different pairs of time points in the calculations. For example, two estimates of bone lead contribution to blood were calculated for t2, one estimate based on the t1 and t2 sample collection pair, and the other based on the t2 and t3 sample collection pair  is consistent throughout the three sampling rounds and amounts to > 90% of blood lead. In other words, uptake of lead from external sources in that child supported < 10% of the lead in blood throughout the 7.4 months encompassed by the sampling rounds. Because blood lead levels in that child ranged between approximately 25 and 29 \u03bcg/dL throughout the study, these results indicate that the chronically elevated blood lead levels may be attributed to the mobilization of substantial bone lead stores. In case 1, where only two sampling visits took place, the estimated bone lead contribution averaged approximately 65% but decreased slightly from the first visit (73%) to the second visit (58%), consistent with the reduction in blood lead levels (from 20.3 to 14.9 \u03bcg/dL) and with the absence of a reduction in fecal lead elimination  over the time interval .t1 , 65% at t2 , and 40% at t3 . This variability in the estimates of bone lead contribution calculated using two different sampling pairs is produced by the relative size of the analytical measurement error compared with the isotopic differences between blood and feces from two collection time points. When isotopic differences between samples collected at different times are small, the measurement uncertainty in the isotopic values results in large uncertainties in the estimates of all parameters calculated from Equations 1\u20136.In case 3, the amount of lead in blood from bone is more variable. For this case, the estimates of the bone lead contribution to blood on the basis of the two different sampling pairs are 36% at K (Equations 5 and 6) relates the amount of lead in blood from external intake with the lead content of feces, that is, with the amount of lead ingested but not absorbed. If it is assumed that GI absorption of lead in infants and small children is on the order of 50%  (K) across children, and even across studies, should be done with caution because this term is not normalized to body weight.The biokinetic factor r of 50% , the valGI tract  suggest ract (K)  range frThe three case studies presented here serve to illustrate the application of this noninvasive isotopic approach to estimate the bone lead contribution to blood in lead-poisoned children. These results substantiate that in lead-exposed children reductions in blood lead levels post-intervention may be buffered by the release of significant amounts of lead from bone into blood and thus may not adequately reflect reductions in lead exposure from environmental sources. The endogenous source of this lead mobilized into blood is presumed to be the skeleton, because the skeleton contains most of the body lead burden. Thus, the ability of a household lead abatement intervention to produce considerable reductions in the blood lead level of a chronically lead exposed child may be substantially limited by the large contribution of bone lead to blood.This is best demonstrated by case 2, the oldest child examined here (46 months of age at enrollment), whose fraction of lead in blood from bone was calculated to be > 90% throughout the study. Supporting this, the lead intake of this child was comparatively low  and constant throughout the three sampling visits, yet the blood lead level was very elevated and decreased only slightly over time (from 29.3 down to 25.2 \u03bcg/dL over 7 months). Thus, even if the lead intake had been completely eliminated by the household abatement intervention, the expected decrease in blood lead level would have been very small. This case, in particular, illustrates the limitations of assuming that blood lead levels are direct indicators of current environmental lead exposure and that lead hazard control measures would necessarily be efficacious in significantly reducing blood lead levels.In cases 1 and 3, the estimated bone lead contribution to blood was calculated to be smaller than in case 2  and, at least in case 3, more variable over time. The different estimated contributions of bone lead to blood lead over time in the three children studied here could be due to a number of factors, including differences in exposure history and levels of lead accumulated in bone. The child with the largest bone lead contribution to blood  was the oldest of the three children and had a very low lead intake, based on fecal lead elimination. In this case, a larger store of bone lead accumulated over a prolonged period  of exposure to elevated environmental lead levels could have maintained elevated blood lead levels that only very slowly decreased over time once the exposures were controlled. Under this scenario, reduction of the elevated environmental exposures to the case 2 child may have occurred before the conduct of this study, consistent with his relatively low fecal lead content at enrollment. In the other two cases of younger children (~ 1.5 years old), the bone lead contribution to blood was smaller and more variable (at least in case 3), suggesting a smaller reservoir of lead in bone, possibly due to a shorter history of environmental exposure.Historically, the efficacy of lead abatement practices for reducing childhood lead exposures has been evaluated based on reductions in blood lead levels as indicators of lead exposure/uptake . This apFecal lead content measured over several days is one possible approach to estimating the overall magnitude of childhood lead intake. Fecal lead content should give an integrated measure of lead exposure/intake from all sources, dietary and environmental, inside and outside the home. In contrast, other approaches such as duplicate diet sampling may not sufficiently reflect total lead exposure/intake because duplicate diets do not reflect potentially important environmental sources of lead to children living in older housing or in the proximity of soils with high lead content. Similarly, hand wipes may provide an estimate of nondietary environmental lead exposure in some cases , althougThere are, however, limitations with the use of fecal lead content as a measure of lead intake. First, collection of complete fecal samples over multiple days may not be feasible in some cases. Second, variability among children in GI lead absorption should ideally be taken into consideration if fecal lead content were to be used as a direct surrogate of lead uptake and intake. Third, because excreted fecal lead reflects unabsorbed ingested lead in addition to lead eliminated via endogenous fecal  routes, variation in these physiologic processes from child to child may introduce variation not attributable to environmental lead exposure. Nonetheless, fecal lead content still may be the among the most accurate indicators of the amount and isotopic composition of lead the child is ingesting, and as a result, it may serve as a useful quantitative index of the extent of oral lead exposure from all sources (diet and environment).a) that the lead isotopic composition of feces reflects the lead isotopic composition of ingested lead that is incorporated into the circulation, and b) that the isotopic composition of the skeleton remains constant throughout the 3- to 6-month interval between consecutive sampling visits. Although prior studies have not systematically validated the first assumption, it is supported by a number of published observations. Studies where lead intake and excretion were measured in animals and humans showed that an increase in lead intake is quickly followed by an increase in fecal lead excretion  pathways. Biliary lead excretion has been shown to range between 40 and 85% of total body lead excretion in nonhuman primates  and < 46207Pb/206Pb)bonet1 = (207Pb/206Pb)bonet2]. It is possible, however, that changes in the blood isotopic composition because of reductions in lead intake after intervention, for example, could produce small changes in the isotopic composition of metabolically active regions of bone that exchange lead with blood. Accordingly, the bone lead isotopic composition could change slightly toward that of blood, rather than remain constant throughout the study. If allowance is made in the model for a change in bone isotopic composition toward that of blood, as the magnitude of external sources of exposure changes, the estimated contribution of lead from bone to blood actually increases. Thus, the approach used here, which assumes that the bone lead isotopic composition does not change with time, yields a minimum calculated value for the contribution of bone lead to blood.The second assumption of this model is that the isotopic composition of the skeleton remains constant throughout the sampling visits [i.e., the model assumes  to allow adequate time for depletion of accumulated skeletal lead stores and a reduction in their absolute contribution to blood lead levels. Observations from this study also support the use of fecal lead content and isotopic composition as a proxy for the identification of sources of lead exposure."}
+{"text": "EHP 113:1730\u20131734][.Long-term lead exposure among industrial workers can result in neuropathy , while lower exposure levels cause muscle weakness. Until recently, however, the interaction between lead toxicity and chronic repetitive muscle use had not been investigated. Researchers from the Center for Occupational and Environmental Neurology in Baltimore now report that the impact of chronic lead exposure is augmented by concomitant ergonomic stress The study included 80 lead smelter workers who were routinely exposed on the job to inorganic lead dust and (to a lesser extent) lead fumes. Historical blood lead records for all the workers were available from the smelter, which checked all employees\u2019 blood lead at least quarterly. These records showed that workers had high chronic exposure in the distant past, much lower exposure in the more proximate past, and still lower exposure at the time of the study. The researchers also measured current blood and bone lead levels and used the historical records to calculate two metrics of cumulative lead exposure\u2014working-lifetime integrated blood lead (IBL) and working-lifetime weighted-average blood lead (TWA).The team used the current perception threshold test to examine nerve fiber populations in the workers\u2019 shoulders, arms, wrists, and hands. This test measures the amount of electrical current needed to induce a sensation. The team also created a three-tiered ergonomic stress rating based on all the different jobs the workers had ever performed, cumulated over their employment history. This was used to arrive at a time-weighted average ergonomic stressor. Sensory nerve conduction threshold was measured in large myelinated, small myelinated, and unmyelinated nerve fibers.The results showed that decrements in nerve function\u2014a precursor to neuropathy\u2014were limited to large and small myelinated sensory nerve fibers, with a threshold effect at a TWA of 28 micrograms per deciliter. At higher levels of lead exposure and presence of ergonomic stress, nerve fibers were more susceptible to increased damage, something that has never before been shown in human studies. The investigators suggest that nerves affected by lead are more susceptible to traction or mechanical compression, as would occur in the carpal tunnel of workers who perform activities such as heavy lifting and shoveling.Measures of chronic lead exposure may serve as strong predictors of impaired nerve function. In addition, the authors believe they have been able to separate the impact of two components of cumulative blood lead\u2014duration and intensity\u2014with exposure intensity appearing to have a greater influence than duration on the outcome studied. Finally, the authors point out that although TWA and IBL are associated with peripheral nerve damage, bone lead\u2014another measure of chronic exposure\u2014is a weak predictor of lead effects in the nervous system because it reflects only that lead stored in the bone compartment and not necessarily the cumulative blood lead to which peripheral nerves were exposed."}
+{"text": "Schaumberg DA, Mendes F, Balaram M, Dana MR, Sparrow D, Hu H. 2004. Accumulated lead exposure and risk of age-related cataract in men. JAMA 292:2750\u20132754.Although lead toxicity in humans had been recognized for centuries, lead was widely used in industrial products and practices in the twentieth century, resulting in broad exposures and distribution of its effects. Worldwide, lead was a common component of many consumer products including gasoline, paint, craft supplies, and plumbing materials. Some of these routes of exposure still exist in countries outside the United States, making lead a lingering concern around the world.Researchers have identified a number of adverse health effects of lead including neurotoxic effects and learning disorders in children. Other studies have shown that the intrusion of lead into the lens of the eye may cause protein conformational changes that decrease lens transparency. Now NIEHS grantee Howard Hu and colleagues at Harvard University have uncovered what could be another adverse health effect with global implications: cataracts.Cataracts are the leading cause of blindness. About 13 million people over the age of 40 in the United States alone have cataracts, and the costs of cataract surgery reach almost $4 billion annually.k X-ray fluorescence in a subset of participants in the Normative Aging Study, a Boston-based longitudinal study of aging in men. For 600 men aged 60 years and older, the researchers then reviewed eye examination data (collected routinely every 3\u20135 years) for the period after bone lead measurements were taken. Blood lead levels were also measured. Results were adjusted for pack-years of cigarette smoking, diabetes, blood lead, and intake of vitamin C, vitamin E, and carotenoids.The Harvard researchers measured tibial and patellar bone lead levels by The researchers found that participants with high tibial lead were more than 2.5 times as likely to develop cataracts as men with low tibial lead (bone lead is a measure of long-term lead exposure). Blood lead levels, which are more indicative of short-term lead exposure, were not significantly associated with increased risk of cataract development.This study suggests that accumulated lead exposure, common in the United States and other parts of the industrialized world, may be an important but as yet unrecognized risk factor for development of cataracts. Furthermore, reducing lead exposure could help decrease the global human suffering and financial burden caused by cataracts, and preserve the vision of many people as they age."}
+{"text": "Research conducted in recent years has increased public health concern about the toxicity of lead at low dose and has supported a reappraisal of the levels of lead exposure that may be safely tolerated in the workplace. In this article, which appears as part of a mini-monograph on adult lead exposure, we summarize a body of published literature that establishes the potential for hypertension, effects on renal function, cognitive dysfunction, and adverse female reproductive outcome in adults with whole-blood lead concentrations < 40 \u03bcg/dL. Based on this literature, and our collective experience in evaluating lead-exposed adults, we recommend that individuals be removed from occupational lead exposure if a single blood lead concentration exceeds 30 \u03bcg/dL or if two successive blood lead concentrations measured over a 4-week interval are \u2265 20 \u03bcg/dL. Removal of individuals from lead exposure should be considered to avoid long-term risk to health if exposure control measures over an extended period do not decrease blood lead concentrations to < 10 \u03bcg/dL or if selected medical conditions exist that would increase the risk of continued exposure. Recommended medical surveillance for all lead-exposed workers should include quarterly blood lead measurements for individuals with blood lead concentrations between 10 and 19 \u03bcg/dL, and semiannual blood lead measurements when sustained blood lead concentrations are < 10 \u03bcg/dL. It is advisable for pregnant women to avoid occupational or avocational lead exposure that would result in blood lead concentrations > 5 \u03bcg/dL. Chelation may have an adjunctive role in the medical management of highly exposed adults with symptomatic lead intoxication but is not recommended for asymptomatic individuals with low blood lead concentrations. In deriving the recommendations in this article, we took note of a body of literature that establishes the potential for adverse health effects at blood lead concentrations or exposure levels permissible under current workplace regulations established in the 1970s by the U.S. Occupational Safety and Health Administration (OSHA). These regulations generally require removal from lead exposure when whole-blood lead concentrations exceed 50 or 60 \u03bcg/dL. These values are considerably above blood lead concentrations of the general population of the United States, which had a geometric mean of 12.8 \u03bcg/dL in the late 1970s , the average blood lead concentration was 6.3 \u03bcg/dL. On the basis of the subjects\u2019 ages (mean 67 \u00b1 7.2 years), it may be expected that they lived most of their adult lives at a time when the blood lead concentration of the general population ranged from 10 to 25 \u03bcg/dL , the subgroup with blood lead concentration \u2265 10 \u03bcg/dL  had a relative risk of cardiovascular mortality of 1.59  compared with subjects with blood lead < 5 \u03bcg/dL , the relative risk for cardiovascular mortality was 1.53 , comparing a blood lead of 4.92 \u03bcg/dL (80th percentile of the distribution) with a blood lead of 1.46 \u03bcg/dL (20th percentile of the distribution)  .N-acetyl-\u03b2-d-glucosaminidase (NAG), a biomarker of early biological effect on the renal tubule, but in an analysis of a smaller subset of the lead workers (n = 190) that controlled for the relatively low levels of urinary cadmium (1.1 \u00b1 0.78 \u03bcg/g creatinine), only the relationship with tibia lead and NAG remained significant , and between cumulative blood lead index and NAG   .n = 744), there was a negative correlation between blood lead  and measured creatinine clearance, after natural log transformation of both variables and adjustment for other covariates ; n = 1,016 women ], log-transformed blood lead concentration was inversely correlated with measured creatinine clearance (n = 820), low levels of blood lead  were inversely correlated with creatinine clearance and glomerular filtration rate, after adjusting for age, body mass index, urinary or blood cadmium, hypertension, diabetes, and regular use of nonsteroidal anti-inflammatory drug (NSAID) medication . In a cross-sectional investigation of a subcohort of middle-aged to elderly men enrolled in the Normative Aging Study , blood lead was a risk factor for elevated serum creatinine  and \u201cchronic kidney disease\u201d (defined as an estimated glomerular filtration rate < 60 mL/min) only among subjects with hypertension (n = 4813) , multiple regression analysis revealed that log-transformed blood lead was positively correlated with serum creatinine in hypertensive but not normotensive subjects  . Comparesubjects . In a losubjects . An intesubjects . Althougn \u2264 100) with blood lead concentrations ranging approximately 20\u201340 \u03bcg/dL have associated lead exposure with subclinical decrements in selective domains of neurocognitive function (n = 803 workers) (n = 576 workers) (n = 48) and age-matched controls with similar blood lead concentrations , increases in current blood lead concentration within the entire study population were correlated with poorer performance on several tests of neurocognitive function but on only one measure was cumulative lead exposure (measured in the workers) associated with poorer performance   and a 3-workers)  found thformance .n = 4937), there was no relationship between blood lead concentration  and covariate-adjusted performance on neurocogntive function (n = 325) with background, community lead exposure , certain measures of neuropsychologic function (Trailmaking part B and Digit Symbol test) were performed more poorly by women in the upper 15th percentile of blood lead , no relationship between blood lead  and neuropsychologic performance was discernible  with a mean blood lead concentration of 5.5 \u00b1 3.5 \u03bcg/dL examined as part of the Normative Aging Study, increased blood lead concentration was associated with poorer performance on neuropsychologic assessment of memory, verbal ability, and mental processing speed  from the Normative Aging Study assessed with the Mini-Mental Status Examination (MMSE), the OR for having a test score associated with an increased risk of dementia was 3.4  comparing the mean blood lead of the highest quartile  to that of the lowest quartile  (In the population-based sample of adults 20\u201359 years of age participating in the NHANES III study (function . Howevercernible . In a geng speed . In a la5 \u03bcg/dL) . There wn = 466; mean age, 67.4 \u00b1 6.6 years) examined for longitudinal change in MMSE score over an average of 3.5 \u00b1 1.1 years, higher patella bone lead concentrations, a biomarker of cumulative lead exposure, predicted a steeper decline in performance . Although several earlier studies failed to detect this substantial impact, they may have been subject to methodologic limitations not present in the Mexico City investigation , every increase of 10 \u03bcg/g in maternal tibia lead was associated with a 73-g  decrease in birth weight . The impPrenatal lead exposure assessed by umbilical cord blood lead concentration has been inconsistently associated with an adverse effect on neurobehavioral development in childhood. However, recent studies suggest that mobilization of maternal bone lead during pregnancy may contribute to fetal lead exposure in ways that may be incompletely reflected by the single measurement of umbilical cord whole-blood lead . In a prn = 119). Adjusting for covariates that included maternal age, maternal IQ, child sex, childhood weight and height for age, and childhood whole-blood lead at 24 months, an increase of one SD in loge \u2013transformed plasma lead in the first trimester was associated with a 3.5-point decrease in score on the 24-month MDI of the Bayley Scales of Infant Development. The corresponding impact of one SD increase in loge maternal whole blood during the first trimester was a 2.4-point decrease in the 24-month MDI. The logarithmic relationship between maternal plasma and blood lead concentrations and infant MDI indicated that the strongest effects occurred among mothers with the lowest plasma and blood lead concentrations.A prospective study that measured maternal plasma lead and maternal whole-blood lead during pregnancy found that maternal plasma lead during the first trimester was the stronger predictor of infant mental development at 24 months of age . In thisn = 390) (n = 150); from 1 through 5 years it was 9.8 \u03bcg/dL (2.8\u201336.4 \u03bcg/dL), and from 6 through 10 years it was 6.2 \u03bcg/dL . IQ at 6 to 10 years of age, assessed by the Wechsler Intelligence Scale for Children\u2014Revised, decreased significantly only with increasing natural-log third-trimester blood lead, controlling for other blood lead measurements and covariates. Every doubling of third trimester blood lead  was associated with an IQ decrement of 2.7 points . Notably, the nonlinear  relationships detected in the Yugoslavia and Mexico City studies indicate that across a maternal blood lead range of 1\u201330 \u03bcg/dL, an increase in blood lead from 1 to 10 \u03bcg/dL will account for more than half the IQ decrement.Two long-term prospective studies that conducted multiple measurements of maternal blood lead during pregnancy and childhood have identified an adverse impact of low-level prenatal lead exposure on postnatal neurobehavioral development extending beyond infancy. Applying a repeated measures linear regression technique to analysis of age-appropriate IQ test data obtained in 390 children 3\u20137 years of age, the Yugoslavia Prospective Lead Study found independent adverse effects of both prenatal and postnatal blood lead. After controlling for the pattern of change in postnatal blood lead and other covariates, IQ decreased 1.8 points  for every doubling of prenatal blood lead, which was assessed as the average of maternal blood lead at midpregnancy and delivery  . The Mexn = 390) . Geometrn = 637) without regard to immigration status found that every 10-\u03bcg/g increase in calcaneus (heel) bone lead increased the OR of third trimester pregnancy hypertension (systolic > 90 and/or diastolic > 140 mmHg) by 1.86   were associated with increased systolic blood pressure during labor (1.0 mmHg for every doubling of blood lead) and increased odds of hypertension (not further defined) recorded any time during pregnancy  for every doubling of blood lead . A prosp04\u20133.32) .3 as an 8-hr time-weighted average, the recommendations in The OSHA workplace standard for lead exposure in general industry (adopted in 1978) and a corresponding standard for lead exposure in construction trades (adopted in 1993) set forth medical surveillance requirements that include baseline and periodic medical examinations and laboratory testing. Details of the two standards, which establish distinct criteria for the implementation of surveillance, can be found on the OSHA website . BecauseThe content of the baseline or preplacement history and physical examination for lead-exposed workers should continue to follow the comprehensive scope set forth in the OSHA lead standard for general industry. Measurement of serum creatinine will identify individuals with chronic renal dysfunction who may be subject to increased health risks from lead exposure. With the potential exception of an annual blood pressure measurement and a brief questionnaire regarding the presence of medical conditions  that might increase the risk of adverse health effects of lead exposure, medical evaluations for lead-exposed workers should be unnecessary as long as blood lead concentrations are maintained < 20 \u03bcg/dL. Annual education of lead workers regarding the nature and control of lead hazards, and ongoing access to health counseling regarding lead-related health risks are recommended as preventive measures.As summarized earlier in this article, the recent findings concerning lead-related adverse reproductive outcomes render it advisable for pregnant women to avoid occupational or avocational lead exposure that would result in blood lead concentrations > 5 \u03bcg/dL. Calcium supplementation during pregnancy may be especially important for women with past exposure to lead. Calcium decreases bone resorption during pregnancy  and may Maternal body lead burden and external lead exposure influence the lead concentration of breast milk . The fewRemoval from all sources of hazardous lead exposure, whether occupational or nonoccupational, constitutes the first and most fundamental step in the treatment of an individual with an elevated blood lead concentration. A careful history that inquires about a broad spectrum of potential lead sources is recommended . RemovalMedical treatment of individuals with overt lead intoxication involves decontamination, supportive care, and judicious use of chelating agents. Comprehensive discussion of such treatment is beyond the scope of this article but has been reviewed in recent medical toxicology texts , 2005. AIn our experience, adults with blood lead concentrations \u2265 100 \u03bcg/dL almost always warrant chelation, as levels of this magnitude are often associated with significant symptoms and may be associated with an incipient risk of encephalopathy or seizures. Occasionally, patients with very high blood lead concentrations may have no overt symptoms. Patients with blood lead concentrations of 80\u201399 \u03bcg/dL, with or without symptoms, can be considered for chelation treatment, as may some symptomatic individuals with blood lead concentrations of 50\u201379 \u03bcg/dL. These demarcations are imprecise, however, and decisions on chelation should be made on a case-by-case basis after consultation with an experienced specialist in occupational medicine or medical toxicology.Hair lead analysis or measurement of urine lead concentration seldom provide exposure information of clinical value beyond that provided by the history and the measurement of blood lead concentration. Chelation initiated exclusively on the basis of hair or urine lead levels or chelation of asymptomatic individuals with low blood lead concentrations is not recommended.Adults with overt lead intoxication will generally experience improvement in symptoms after removal from lead exposure and decline in blood lead concentration. This clinical observation on improvement in overt symptoms finds some support from the relatively limited number of studies that have examined the impact of naturally declining blood lead concentrations on cognitive function in occupationally exposed subjects . ImproveWith appropriate engineering controls, safe work practices, and personal protective equipment, workers without a previous history of substantial lead exposure should be able to work with lead in a manner that minimizes the potential for hazardous levels of exposure. For such workers, elevations in blood lead concentration that result from unforeseen transient increases in exposure will often decline promptly once the exposure is controlled. However, in a worker with a long history of high exposure, redistribution of lead from a large internal skeletal burden may result in a prolonged elevation of blood lead concentration despite marked reductions in external lead dose.The recommendations for management of adult lead exposure contained in this article are derived from consideration of risks to health, and have not been the subject of a cost-benefit analysis examining economic feasibility or social impacts. Nonmedical, socioeconomic factors will likely influence how workers, employers, and clinicians respond to the recommendations. In particular, the blood lead concentrations for which some major interventions, such as removal from lead exposure, are recommended are considerably lower than those explicitly specified in the current OSHA lead standards . The OSHClinical laboratories routinely offer brief interpretative guidance on the forms that report the result of blood lead concentrations. There is considerable variability among laboratories regarding the content of such guidance, and laboratories exercise their own discretion regarding the source and detail of the information they provide. Unlike the management guidance chart for childhood blood lead concentrations published by the"}
+{"text": "EHP 114: 1730\u20131735; Hu et al.][.Many countries have set guidelines for levels of environmental lead exposure that are considered safe for children. However, relatively few studies have focused exclusively on the role of prenatal lead exposure on infant neurodevelopment. Indeed, studies conducted in the past 20 years have shown inconsistent results, perhaps because of variability in when prenatal lead was measured  and in what type of sample . A comprehensive study published this month is the first to compare such variables From 1997 to 1999, the investigators measured lead levels of 146 pregnant women living in Mexico City. Leaded gasoline was sold in Mexico City until 1997, and bone lead levels in women there are about three times higher than in the United States. The leaching of lead stored in a mother\u2019s bones provides a major source of fetal lead exposure.The investigators obtained samples of plasma and whole blood during each trimester and umbilical cord blood at delivery. They also tested the neurodevelopment of the children at age 24 months using the Mental Development Index (MDI), which evaluates memory, language, and sensory abilities.The authors found that lead exposure during the first trimester of pregnancy was more strongly linked to later decreases in the MDI scores than exposure during the latter two trimesters. Moreover, maternal plasma lead was the best predictor of a child\u2019s later neurobehavioral performance because most of the lead in whole blood is attached to red cells and cannot cross the placenta. Each increase of 1 standard deviation unit in plasma lead lowered the MDI score by 3.5 points. Neither maternal levels in the second or third trimester nor cord blood levels impacted MDI scores in as strong a fashion.The results raise two questions: should lead be routinely measured in the first trimester of pregnancy, and are there ways to reduce fetal exposure? Plasma lead is expensive and difficult to measure, according to the authors, making routine clinical testing impractical. Studies suggest that calcium supplements slow the release of lead from bone. An ongoing clinical trial of pregnant women is assessing the efficacy of this intervention."}
+{"text": "EHP 112:1178\u20131182][. The Tsaih study is among the first to assess the relationship between low-level bone and blood lead levels and measures of kidney function in a general population sample.Many studies have reported impaired renal function and kidney disease at high levels of lead exposure, as estimated mainly through concentrations of serum creatinine (SCr) and rates of creatinine clearance from the body. However, lower-level lead exposure has not been correlated with renal effects as conclusively, perhaps because blood lead reflects relatively recent exposure, and therefore is not an adequate measure of total body burden. This month, Shirng-Wern Tsaih of the Harvard School of Public Health and her colleagues report that blood lead levels alone may not be enough to determine whether kidney effects are occurring at low exposure; lead levels in bone also need to be determined In contrast with blood lead, bone lead makes up more than 95% of the adult body burden. The lead in more compacted cortical bones, such as the tibia, is less available for mobilization, because this type of bone is less prone to turnover than spongier trabecular bones, such as the patella. Yet, as people age, bone loss often does take place, so lead that has long been held in bone is released to soft tissue and can find its way to the kidneys. Thus, bone lead may be a better marker for studying the chronic toxicity of accumulated exposure and lead burden.The Tsaih study examined data from a cohort of middle-aged and elderly Boston men with no known heavy exposure to lead. Participants were from the Normative Aging Study, a federal study of aging begun in 1961. A blood sample for lead analysis had been collected every 3\u20135 years since July 1988; bone lead measurements began in August 1991, when a subset of participants were recruited for a substudy in which bone lead was measured by K X-ray fluorescence.Tsaih and colleagues examined data for 448 men who had a baseline bone lead measurement between 1991 and 1995, and follow-up measurements of SCr 4\u20138 years later. They examined blood and bone lead concentrations and their correlation with kidney function, taking into account the known nephrotoxic effects of diabetes mellitus and hypertension, which had been diagnosed in 5.8% and 25.7% of the men, respectively, at the time of baseline measurement. Bone lead was measured in the tibia and patella.Tibia lead was observed to be associated with increases in SCr levels in follow-up participants with diabetes. The findings suggest that long-term low-level lead accumulation, estimated by tibia lead, is associated with an increased risk of reduced renal function. This is especially true for diabetics and hypertensives, who already are at risk for kidney impairment because of their disease. In addition, blood lead and tibia lead appeared to be associated with elevated SCr levels and chronic kidney disease among hypertensives. There was no statistical evidence of patella lead being associated with change in renal function, suggesting that chronic absorption of lead is a risk factor for impaired renal function.The study, however, has some limitations. Although SCr is widely used in medicine to measure overall renal function, it provides only a rough estimate of the kidney\u2019s filtration capacity. For instance, increases in SCr definitively show impairment only when kidney function has been reduced by about 50%. Thus, the researchers had great difficulty in detecting more modest effects of lead. In addition, the alternative hypothesis that elevated blood or bone lead levels actually result from impaired kidney function cannot be ruled out.It has not yet been determined whether lead affects blood pressure indirectly through changes in kidney function, or via more direct effects on the circulatory system or neurological blood pressure control. The researchers also know of no studies to date that analyze the potential for diabetes to modify the relationship between lead exposure and renal function. Given that many adults have a history of environmental or occupational lead exposure and the incidence of both type 2 diabetes and hypertension, studies of such interactions, if confirmed, could be of significant public health value."}
+{"text": "Adjusting for cord blood lead, infant weight change, and reported breast-feeding status, a difference of approximately 2 \u03bcg/L  breast milk lead was associated with a 0.82 \u03bcg/dL increase in blood lead for breast-feeding infants at 1 month of age. Breast milk lead accounted for 12% of the variance of infant blood lead levels, whereas maternal blood lead accounted for 30%. Although these levels of lead in breast milk were low, they clearly have a strong influence on infant blood lead levels over and above the influence of maternal blood lead. Additional information on the lead content of dietary alternatives and interactions with other nutritional factors should be considered. However, because human milk is the best and most complete nutritional source for young infants, breast-feeding should be encouraged because the absolute values of the effects are small within this range of lead concentrations.Nursing infants may be exposed to lead from breast milk, but relatively few data exist with which to evaluate and quantify this relationship. This route of exposure constitutes a potential infant hazard from mothers with current ongoing exposure to lead as well as from mothers who have been exposed previously due to the redistribution of cumulative maternal bone lead stores. We studied the relationship between maternal breast milk lead and infant blood lead levels among 255 mother\u2013infant pairs exclusively or partially breast-feeding through 1 month of age in Mexico City. A rigorous, well-validated technique was used to collect, prepare, and analyze the samples of breast milk to minimize the potential for environmental contamination and maximize the percent recovery of lead. Umbilical cord and maternal blood lead were measured at delivery; 1 month after delivery (\u00b1 5 days) maternal blood, bone, and breast milk and infant blood lead levels were obtained. Levels of lead at 1 month postpartum were, for breast milk, 0.3\u20138.0 \u03bcg/L ; maternal blood lead, 2.9\u201329.9 \u03bcg/dL ; and infant blood lead, 1.0\u201323.1 \u03bcg/dL . Infant blood lead at 1 month postpartum was significantly correlated with umbilical cord (Spearman correlation coefficient  Breast milk has been suggested as a significant potential source of lead exposure to nursing infants , but relStudies of lead in human milk have found concentrations ranging over three levels of magnitude from < 1 to > 100 \u03bcg/L (ppb) . HoweverThere are some data from rodents on the lactational transfer and uptake of lead in the newborn. r2 = 10%, p = 0.009). By examining the lead isotopic ratios in a small number of infants born to recent immigrants to Australia , In humans, We evaluated the effect of breast milk lead on infant blood lead levels to quantify the dose\u2013response relationship in a large, population-based sample of infants exclusively or partially breast-fed through 1 month of age. We used a rigorous, well-validated technique to collect, prepare, and analyze the samples of breast milk to minimize the potential for contamination and maximize the percent recovery of lead.We conducted a cross-sectional study of 255 nursing infants at 1 month postpartum in Mexico City. Subjects included infants born to a subcohort of women recruited for later participation in a randomized placebo-controlled trial of calcium supplementation during lactation. Informed consent, questionnaire information, and samples for the present study were obtained before the initiation of calcium supplementation. All participating mothers received a detailed explanation of the study and counseling on reduction of lead exposure. The research protocol was approved by the human subjects committees of the National Institute of Public Health of Mexico, Harvard School of Public Health, and the participating hospitals.Data collection methods have been described in detail elsewhere . BetweenBlood lead measurements were performed using graphite furnace atomic absorption spectrophotometry  at the ABC Hospital Trace Metal Laboratory according to a technique described by 109Cd KXRF instrument constructed at Harvard University and installed at the research facility in Mexico City to measure maternal bone lead. Thirty-minute in vivo measurements of each subject\u2019s mid-tibial shaft  and patella (trabecular bone) were obtained after each region had been washed with a 50% solution of isopropyl alcohol. The physical principles, technical specifications, validation, and use of the KXRF technique have been described in detail elsewhere (n = 12) and patella (n = 38), respectively, from the entire cohort of 629 women. These measurements generally reflect excessive patient movement outside the measurement field or excessive thickness of overlaying tissue and do not produce acceptable results.We used a spot-source lsewhere . The insBreast milk samples were collected at 1 month postpartum from lactating women using techniques to minimize potential for environmental contamination. Before manual expression of milk, the breast was washed with deionized water, which also was collected and analyzed for lead contamination. Ten milliliters of milk was collected in preleached polypropylene tubes. Samples were frozen, shipped to the Channing Laboratory, and stored at \u221230\u00b0C  until analysis.3 acid in high-temperature high-pressure asher . Lead content in the samples was analyzed by isotope dilution\u2013inductively coupled plasma mass spectrometry  by methods previously described in detail , and instrumental analysis was performed at the Trace Metals Laboratory of Harvard School of Public Health. Digestion was performed using HNOn detail . The lime)-transformed values of the dependent variable were used. Possible associations between infant blood lead and the independent variables were separately explored with bivariate linear regression models. Spearman correlation coefficients with p-values are reported. Characteristics of the participants were compared by reported breast-feeding practice  using Wilcoxon sign rank/chi-square tests of equality of two sample population means/proportions. Extreme values of infant blood lead (n = 3) and breast milk lead (n = 9) were identified using the generalized extreme studentized deviation many-outlier procedure (a priori based on biologic considerations. Infant weight change (weight at 1 month minus birth weight) was used as a surrogate for the amount of breast milk consumed. The final model for infant blood lead included breast milk lead, umbilical cord lead at delivery, breast-feeding status , and infant weight change. Breast milk lead was divided into quartiles, and the midpoint of the quartile was used to predict the infant blood lead level for exposure at that level based on the final model for infant blood lead. To explore potential nonlinear associations between breast milk lead and infant blood lead levels, we examined the relations between the variables using generalized additive models. All statistical analyses were performed using Statistical Analysis System (SAS) software  and S-PLUS .Univariate and bivariate summary statistics and distributional plots were examined for all variables. Infant blood lead levels were highly positively skewed, so for the subsequent regression analyses, the log (base rocedure  and excln = 255) are shown in rS = 0.40, p < 0.0001) and maternal  blood lead at delivery and with concurrent maternal blood , patella , and breast milk  lead at 1 month postpartum (Summary statistics for the lead biomarkers of mothers and infants in the study (stpartum .n = 55) had completed 12 or more months of total breast-feeding of their previous infants.On average, mothers in the study were 24.3 years of age  and had lived in Mexico City for 20 years . Forty percent of women were primiparous. Of the 152 women with prior pregnancies, 22%  at 1 month postpartum are shown in p = 0.84) among women who reported practicing exclusive breast-feeding (1.4 \u00b1 1.1) compared with women who practiced partial lactation (1.5 \u00b1 1.2). With respect to other subject characteristics, subjects differed somewhat by lead-glazed ceramics use. Subjects who were exclusively breast-feeding at 1 month postpartum were less likely to have used lead-glazed ceramics to store, prepare, or serve food in the past (p = 0.03), with 69% of women reporting past use of lead-glazed ceramics compared with 81% of partially breast-feeding mothers. In addition, those subjects who were partially breast-feeding reported slightly higher, although not statistically significant, current use of lead-glazed ceramics (p = 0.08). However, exclusively breast-feeding women (10%) were more likely to have reported current smoking or smoking during pregnancy than were partially breast-feeding women . Partially breast-feeding women were more likely to be married  and reported slightly higher dietary calcium intake  than were women who were exclusively breast-feeding at 1 month postpartum.Differences in maternal and infant characteristics by reported breast-feeding practice (exclusive p = 0.02) of infant blood lead after controlling for umbilical cord lead, infant weight change, and breast-feeding practice. Breast milk accounted for 12% of the variance of infant blood lead levels (In multivariate linear regression models, breast milk was a significant predictor (d levels , whereasd levels . This efFrom birth to 6 months, the infant\u2019s exposure to lead is typically dominated by dietary sources. Although the levels of lead in breast milk reported here were low, they clearly had a strong influence on infant blood lead levels over and above the influence of maternal blood lead. In our study, breast milk lead accounted for 12% of the variance of infant blood lead levels at 1 month of age. In the only other large-scale study of breast milk and infant blood lead levels, milk lead accounted for 10% of the variance in 6-month blood lead .It is important to estimate the contribution from the non\u2013breast milk sources to total lead exposure from dietary intake. Our study was completed during the voluntary removal of lead soldered cans from the market in Mexico , so leadEstimating the potential lead dose to infants from breast milk requires information about the quantity of breast milk consumed per day and the duration over which breast-feeding occurs . AverageIt may also be important to estimate the contribution from the nondietary sources of lead to total body burden of young children. Although it is widely assumed that infant exposures to lead during the first 4\u20136 months of life are derived from diet, Our previous research  and the Due to the unique nutritional characteristics of human milk, breast-feeding is thought to be the optimal mode of nutrient delivery to term infants . Better"}
+{"text": "Surveys undertaken in South Africa have shown that a large proportion of children are exposed to lead from a variety of sources.The overall objective of this work was to examine, through a series of small-scale investigations, the role of lead-based paint in the blood lead distribution of South African children.We suggest that the African public health community strengthen their efforts to prevent lead poisoning in African children through a holistic approach that includes the promulgation and enforcement of appropriate legislation as well as research to identify further sources of exposure to lead. In a 2002\u20132003 South African Medical Research Council survey of blood lead levels and associated risk factors in 383 first-grade Johannesburg school children, lead concentrations (apart from one extreme observation of 44.4 \u03bcg/dL) were shown to range from 1.0 to 18.1 \u03bcg/dL. The mean and median blood lead levels were 9.1 and 8.9 \u03bcg/dL, respectively, the interquartile range was 6.7\u201311.3 \u03bcg/dL, and 35% of children had blood lead levels \u226510 \u03bcg/dL . Peeling paint in homes was identified as a risk factor for elevated blood lead levels in children, as was pica for paint. The subject with the highest blood lead concentration was a 7-year-old girl whose repeat blood lead test, 3 weeks after the initial sampling, showed an increase to 51.5 \u03bcg/dL. Home assessments and interviews with her parents revealed a long history of pica for paint in particular , and lead concentrations up to 46,000 \u03bcg/g were measured in paint samples collected from her home  .The case outlined above raised concerns among the researchers of the potential for children\u2019s exposure to lead-based paint in South Africa. Consequently, a survey was conducted by the South African Medical Research Council of the lead concentrations in paint samples collected from dwellings located in randomly selected Johannesburg suburbs. Of 239 dwellings included in the survey, 20% had paint lead concentrations > 5,000 \u03bcg/g (the U.S. reference level). Paint with high lead levels was found in old as well as newly constructed dwellings .Suspecting the ongoing use of lead in paint in South Africa, researchers from this study purchased paint samples directly from Johannesburg and Cape Town stores, for lead content analysis. Although no lead was found in water-based or white shades of enamel paint, alarmingly high lead concentrations  were measured in samples of pigmented enamel paints. In total, 83% of the samples of pigmented enamel paints were lead based. High lead concentrations were found in popular as well as lesser-known brands of enamel paint, and only 2 of 25 samples of lead-based paint displayed warnings of the high lead content. Similarly high lead concentrations  were found in paint removed from widely used children\u2019s toys (such as building blocks) that were purchased from major toy, supermarket, and stationery chain stores as well as flea and craft markets. High lead levels were found in locally manufactured as well as imported toys. On presentation of evidence of the elevated lead concentrations in paint on children\u2019s toys, the Ministry of Health in South Africa acted to initiate a process, still ongoing, of drafting legislation to limit the use of lead in paint in the country.Although on a small scale, the series of surveys and investigations outlined here made apparent the ongoing use of lead in paint in South Africa, and highlighted the gap in public health legislation required to protect children against this serious, yet preventable, environmental health hazard. Given that warnings of the risk to children from lead in paint were first published more than a century ago  and thatThe legislation now being drafted in South Africa to restrict the use of lead in paint is laudable, but regrettably, comes too late for the many children who have, and will in the future be, unnecessarily exposed to lead in their homes and schools. The possibility exists that paint manufacturers in other African countries may similarly be continuing the hazardous and unethical practice of producing lead-based paint, and/or exporting or importing these products, and in so doing placing large numbers of children in Africa at risk of lead exposure and poisoning. In this regard, efforts by the authors have failed to identify the widespread existence and enforcement in African countries of legislation to control the use of lead in paint. Given the preventable nature of the use of lead and the serious consequences for children\u2019s health and educational attainment, there is a need for greater vigilance and a more proactive approach to lead hazard prevention within the African public health community, including improved surveillance and research to identify the full extent of sources and risk factors, as well as implementation of the most appropriate lead poisoning prevention mechanisms."}
+{"text": "We review empirical evidence for the relations of recent and cumulative lead dose with cognitive function in adults.A systematic search of electronic databases resulted in 21 environmental and occupational studies from 1996 to 2006 that examined and compared associations of recent (in blood) and cumulative (in bone) lead doses with neurobehavioral outcomes.Data were abstracted after consideration of exclusion criteria and quality assessment, and then compiled into summary tables.At exposure levels encountered after environmental exposure, associations with bio-markers of cumulative dose (mainly lead in tibia) were stronger and more consistent than associations with blood lead levels. Similarly, in studies of former workers with past occupational lead exposure, associations were also stronger and more consistent with cumulative dose than with recent dose (in blood). In contrast, studies of currently exposed workers generally found associations that were more apparent with blood lead levels; we speculate that the acute effects of high, recent dose may mask the chronic effects of cumulative dose. There is moderate evidence for an association between psychiatric symptoms and lead dose but only at high levels of current occupational lead exposure or with cumulative dose in environmentally exposed adults. In the development of the adult lead management guidelines see , a numbein vivo K-shell X-ray fluorescence (KXRF) instruments].In reviewing studies of the health effects of lead, it is critical to understand the available lead biomarkers in terms of how they represent external exposure ; how they are influenced by metabolic factors ; and how the combination of these considerations affects inferences regarding the health effects of lead . We concin vivo KXRF were begun in some research laboratories in the 1980s, but it was not until the mid-1990s that reports began to emerge of KXRF-measured bone lead levels in relation to potential health indicators from epidemiologic studies with sufficient sample sizes  to have substantial statistical power. Thus, in this review we summarize all studies to date that measure cognitive function and both blood and bone lead levels (or acceptable surrogate for cumulative lead dose).Blood lead levels measured in epidemiologic studies with valid instruments and standardized calibration and quality control procedures have been reported in the literature for > 35 years. Bone lead levels measured by We begin our review with a discussion of three other reviews on the topic of lead dose and cognitive function . Balbus-Many methodologic issues of relevance to the epidemiologic investigation of lead and cognitive function have been addressed elsewhere in this minimonograph . When eva) contained no original research, b) were conducted on nonhuman subjects, c) were case reports, d) contained no standardized neurocognitive assessment outcomes, or e) lacked measures of both recent and cumulative lead dose.We conducted a systematic literature review of the association between blood and bone lead biomarkers and cognitive functioning in adults. Our aim was to select studies that compared markers of both recent and cumulative lead dose in their relations with cognitive function. Both occupationally and environmentally exposed adult populations were included. We searched the PubMed  and Psyca) exposure was assessed at an individual level; b) exposure was assessed with a biomarker; c) cognitive outcomes were objective, standardized tests; d) statistical adjustment for potential confounders including age, sex (in studies with both men and women), and education; e) data collection was similar in exposed and nonexposed participants; f ) time period of study was the same in exposed and nonexposed participants; and g) there was a detailed description of the approach to data analysis. We decided not to try to derive a pooled estimate across studies of the associations of lead dose biomarkers with cognitive function because of differences in methods for subject selection, blood and bone lead measurements, neurobehavioral outcomes, approach to regression modeling, and presentation of results across studies. Pooled estimates from metaanalysis also can be highly influenced by decisions regarding how and whether to pool certain results. We thus decided to present details for each study and discuss them in turn.We abstracted data from articles meeting the selection criteria. Study quality was assessed with the following criteria: a) environmentally exposed individuals in the general population, b) workers with current occupational exposure, and c) former lead workers without current occupational exposure to lead. We have summarized these studies in We identified three main types of studies that reported cross-sectional or longitudinal associations of blood and bone lead levels with cognitive function. These were of We identified six articles from three studies  that evaluated subjects with mainly environmental exposure to lead  and 2. On = 141) of NAS participants. This was subsequently followed up with a report on a much larger number of NAS participants  . Cross-sectional analyses in the original report found that increased blood lead levels across a relatively low range of levels [mean \u00b1 SD = 5.5 \u00b1 3.5 \u03bcg/dL) were a stronger predictor, compared with tibia or patella lead levels, of poorer performance on tests of speed, verbal memory, vocabulary, and spatial copying skills. However, this was not confirmed in the larger, cross-sectional analysis, except possibly for scores on a vocabulary test (Four articles from the NAS reported associations of blood and bone lead levels in a cohort of older men. One of these articles  was a fis apart) . Cross-sary test . Conversary test  score ovary test .In a study of almost 1,000 persons 50\u201370 years of age randomly selected from the general population in the Baltimore Memory Study (BMS), a cross-sectional analysis showed that relatively low current blood lead levels were not associated with cognitive domain scores. However, moderate tibia lead levels (mean ~ 19 \u03bcg/g) were significantly associated with worse performance in all seven cognitive domains . Thus, iFifteen articles were identified of workers with current or past occupational exposure to lead. Eight of these studies used a surrogate measure of cumulative lead dose  rather than a direct measure of lead in bone. Among these studies, which compared blood and IBL lead dose, when the lead exposure was primarily current , most studies found an association between increasing blood lead values and worse cognitive function . Howevern = 803) found strong and consistent associations of blood lead levels with worse cognitive function after adjustment for covariates, but tibia lead levels were not as consistently associated (n = 57) in whom finger bone  lead levels were measured (One study of currently exposed lead workers in South Korea (sociated . The sammeasured . The secmeasured . This isa) tibia and blood lead levels are biologically related and blood lead is in equilibrium with bone lead stores; b) the error in measurement of tibia lead levels is larger than that for blood lead; c) controlling for cross-sectional associations could obscure longitudinal ones; and d) lead in blood reflects recent external exposure, and is in equilibrium with bone lead stores, possibly taking away explained variance from bone lead associations via this correlation in cross-sectional analyses.In the South Korean lead workers with current occupational exposure, a longitudinal analysis was performed to separate recent lead dose (measured as blood lead levels) from cumulative lead dose (measured as tibia lead levels), and acute effects from chronic effects in 575 subjects with complete data across the three study visits . The autResults of a cross-sectional analysis of former organolead workers showed that higher peak tibia lead levels  were related to poorer functioning on a number of cognitive tests, including those assessing manual dexterity, executive ability, verbal intelligence, and verbal memory . In a loSeveral lines of evidence suggest that increased blood lead levels are associated with psychiatric symptoms in adults, such as depression, anxiety, irritability, and anger. For example, a cross-sectional analysis of 107 occupationally exposed individuals showed increased rates of depression, confusion, anger, fatigue, and tension as measured by the Profile of Mood States POMS;  among thp < 0.05), as well as for the combined measure of all three BSI subscales .In occupationally exposed South Korean lead workers, tibia lead levels were significantly associated with more depressive symptoms measured by the Center for Epidemiologic Studies Depression scale CES-D;  after ada) may be a risk factor for cognitive decline, b) has risk factors in common with dementia, c) is an early reaction to declining cognition, and d) influences the threshold at which dementia emerges [for review see Psychiatric symptoms, specifically symptoms of depression, potentially share the same neural substrates with components of cognition, and thus may be important to late-life cognitive functioning. Compared with nondepressed elderly individuals, depressed elderly perform more poorly on tests involving attention, memory encoding, and retrieval. However, intelligence tests are more resistant to these effects of depression . DepressAPOE) \u025b 4 allele magnified the negative cross-sectional association of tibia lead levels with performance on the cognitive domains of executive ability, manual dexterity, and psychomotor skills . Other studies have found that APOE \u025b 4 modifies dementia outcome in individuals with previous traumatic head injury, suggesting that APOE \u025b 4 plays a role in recovery from brain insults . Last, studies of environmentally exposed adults who had notably higher exposures in the past suggest that bone lead level is more consistently associated with performance on cognitive tests than is blood lead level. The domains associated with lead dose do not differ in general by lead biomarker . The cognitive domains consistently associated with each biomarker in both environmental and occupational studies on adults include verbal and visual memory, visuospatial ability, motor and psychomotor speed, manual dexterity, attention, executive functioning, and peripheral motor strength. Comparisons of lead and psychiatric symptom associations in previously and currently exposed samples lend credence, although perhaps at higher thresholds than for cognitive outcomes, that neurobehavioral functioning is consistently associated with blood lead when exposure is currently high  and bone lead when exposure is primarily from past chronic exposure.Following is a summary of the findings from each of the three types of populations. First, cross-sectional studies of currently exposed lead workers showed that associations of blood lead levels and cognitive function were clearer than the associations for tibia, patella, or calcaneus lead levels, perhaps because the acute effects of recent dose in an occupational setting masked the chronic effects of cumulative lead dose. Second, previously exposed occupational populations demonstrated a stronger association between cumulative lead dose measured in tibia bone with cognitive deficits compared with blood lead levels. The two studies that deviated from these otherwise consistent findings may not have had sufficient power to detect any associations (These associations exist in multiple settings, including both occupational and non-occupational, in men and women, and in populations with diversity by socioeconomic status and race/ethnicity. This reduces the likelihood of associations by statistical chance or due to unmeasured confounding. However, this consistency cannot completely rule out the possibility of uncontrolled confounding or effect modification . In addiThe strength of associations between lead and cognitive function is strong and can be compared to the influence of age on cognitive function. The comparative magnitude of these effects has been reported in several studies. In currently exposed lead workers, cross-sectional associations showed that a 5-\u03bcg/dL increase in blood lead was equivalent to an increase of 1.05 years in age . The magLongitudinal analyses in the NAS observed that an interquartile range higher patella lead level was approximately equivalent to that of aging 5 years in relation to the baseline MMSE score  and an iLead has adverse effects on many other health outcomes in addition to cognitive function. This is not surprising given lead\u2019s numerous biologic effects, including calcium agnonism and antagonism , bindingAssociations between lead biomarkers and cognitive outcomes have been demonstrated in both cross-sectional and longitudinal studies. In several of the longitudinal studies, change in cognitive function was explicitly modeled in relation to preceding lead dose or in relation to change in lead dose. In either case, the temporality condition is met. In addition, as bone lead is a measure that ascertains prior dose, even in cross-sectional analyses, analysis of bone lead with cognitive test scores evaluates lead dose that preceded current cognitive performance; thus, while cognitive assessment is cross-sectional, dose assessment is retrospective and cumulative. This again would minimize concerns about incorrect temporal relations.Nearly all reviewed studies found a dose\u2013effect relation for blood lead, bone lead, or both. Existing studies do not allow determination of a threshold dose for either blood lead or bone lead or the shape of the dose\u2013effect relationship at low dose levels. Associations have been observed in populations with mean blood lead levels as low as 4.5 \u03bcg/dL  and meanLead adversely affects the brain in a variety of ways. Lead is thought to increase oxidative stress, induce neural apoptosis, influence neurotransmitter storage and release, and damage mitochondria. The ability of lead to substitute for calcium allows it to affect calcium-mediated processes and pass through the blood\u2013brain barrier. It may also interfere with zinc-dependent transcription factors, altering the regulation of genetic transcription . Animal Blood lead level is a measure of current biologically active lead burden and is therefore a better marker of the acute effects of recent lead dose. These are likely to be effects on neurotransmission and calcium enzyme-dependent processes such as synaptic plasticity. This could lead to circulating blood lead impairing, for example, information storage and retrieval mechanisms or processing speed, which have been suggested to impair performance on cognitive tests , 1996b. Lead may also influence cognitive function indirectly through its effects on blood pressure, hypertension, or homocysteine levels. Increased homocysteine levels, a well-known risk factor for cardiovascular disease, have also been associated with risk for poorer cognitive functioning  and riskAPOE genotype offers strong biologic plausibility to the inference that lead causes cognitive dysfunction (APOE \u025b 4 allele is a risk factor for lateonset Alzheimier disease (APOE \u025b 4 allele lowers the age of onset of the disease and accelerates age-related cognitive decline (APOE \u025b 4 is involved in the recovery response of injured nerve tissue (APOE \u025b 4 allele having reduced ability to promote growth and reduced antioxidant properties (APOE genotype with tibia lead level may be related to an impaired ability to counteract injury from lead exposure among APOE \u025b 4 carriers.We believe the effect modification by function . The APO disease , hippoca disease , and sen disease . It appe decline . Mechanie tissue , with thoperties . The intAnother recent study also offers biologic plausibility. In the former organolead workers, tibia lead level was associated with the prevalence and severity of white matter lesions on brain MRI, using the Cardiovascular Health Study white matter grading system . Tibia lThe removal of lead from gasoline, paint, and most other commercial products has succeeded in dramatically reducing environmental sources of lead exposure, and this has been reflected by the parallel declines in mean blood lead levels in Americans over the same time frame. However, lead has accumulated in the bones of older individuals, and especially those of lead workers exposed at the continued higher levels encountered in lead-using workplaces. Thus, past use of lead will continue to cause adverse health effects even when current exposures to lead are much lower than in the past. Lead in bone is not directly harmful to the central nervous system, and most of the structural and neurochemical damage is likely to have occurred decades ago. Nevertheless, lead in bone might serve as a source from which lead can be mobilized into blood, and potentially cross the blood\u2013brain barrier. The chronic effects of lead may account for a proportion of cognitive aging; future research will be able to determine whether the chronic effects of cumulative lead dose alter the trajectory of normal cognitive aging. Research efforts should be directed to development of preventive interventions for both lead-associated cognitive decline with aging from past exposures, as well as the mobilization of current bone lead stores into the circulatory system leading to new health effects.Cognitive aging occurs in conjunction with the normal biological aging process. It remains to be determined whether lead affects cognitive aging in adults by permanently reducing brain circuitry capacity thereby lowering baseline cognitive functioning, or by inducing steeper declines in cognitive functioning, leading to abnormal cognitive aging. It may be that lead influences cognitive health through its relationship with depressive symptoms, hypertension, or homocysteine levels, all of which influence cognitive impairment and risk of dementia. Future investigations should explicitly account for these complex causal pathways, and also determine whether chronic effects of cumulative lead dose increases the risk for such clinically relevant syndromes as mild cognitive impairment ."}
+{"text": "Studies in children suggest a weak association between blood lead concentration and blood pressure. To understand this better, we tested the strength of the association in children with elevated blood lead concentrations and whether succimer chelation changed blood pressure as it did blood lead. In a randomized clinical trial of 780 children with blood lead concentrations of 20\u201344 \u03bcg/dL at 12\u201333 months of age, we compared the systolic and diastolic blood pressure in the succimer-treated group and placebo group for up to 5 years of follow-up. We also analyzed the relation of blood lead to blood pressure. Children in the succimer group had lower blood lead concentrations for 9\u201310 months during and after treatment, but their blood pressure did not differ from those in the placebo group during this period. During 1\u20135 years of follow-up, children in the succimer group had systolic blood pressure 1.09  mmHg higher than did untreated children in a model with repeated measurements, but the difference in diastolic blood pressure was not statistically significant. No association between blood lead and blood pressure was found. Overall, there is no association between blood lead and blood pressure in these children with moderately high lead exposure, nor does chelation with succimer change blood pressure. Although the causal nature of the relation between lead exposure and elevated blood pressure in adults is still debated , a meta-One 1970s study showed that children with blood lead concentrations > 40 \u03bcg/dL had higher systolic (but not diastolic) blood pressure , but othBlood lead concentration peaks at about 2 years of age and then declines, whereas blood pressure increases with age. It is plausible that the relation between blood lead and blood pressure differs in childhood and adulthood, or that it is unstable in childhood, and thus difficult to characterize with one measurement. Repeated measurements of blood lead and blood pressure in the same child might then be informative. In addition, if lead does increase blood pressure and the effect is acute or subacute and reversible, then the relation will be more apparent when body lead burden changes, such as during chelation.We used data from a large, randomized study of chelation therapy for lead exposure to answer three questions: Does a sudden and substantial decrease in blood lead induced by chelation have any effect on blood pressure? Is a sustained but modest lowering of blood lead over a 6\u20139 month period associated with a change in blood pressure? And is there any association between concurrent blood lead and blood pressure over 5 years of follow-up in young children with significant, but variable, lead exposures?The Treatment of Lead-Exposed Children (TLC) trial is a randomized, placebo-controlled, double-blind clinical trial of 780 children 12\u201333 months of age  with moderately high blood lead concentrations (20\u201344 \u03bcg/dL) to test the effect of chelation on cognitive function and behavior . Four clBlood lead concentrations were measured at baseline and days 7, 28, and 42 after the beginning of each round of treatment. Blood lead concentrations were also measured at 3- to 4-month intervals for 5 years of follow-up. The Nutritional Biochemistry Branch at the Centers for Disease Control and Prevention in Atlanta did the blood lead analyses by atomic absorption spectrometry based on the methods described by At each visit for blood lead measurement, study nurses also measured systolic and diastolic blood pressures. A Dinamap Vital Signs Monitor  was used for all blood pressure measurements. Blood pressure was measured when children were seated. The average of up to three measurements per visit (without a notation that the child was crying or not staying still) was used for statistical analysis. The overall average number of blood pressure measurements per visit was 2.2. At 36- and 60-month follow-ups, three blood pressure measurements were acquired from all subjects. Study nurses were blinded to treatment status of children.We first tested the hypothesis that succimer lowered blood pressure by comparing the succimer and placebo groups immediately after initiation of treatment and at the subsequent follow-ups. We used multiple regression models of blood pressure by treatment groups to obtain the adjusted difference in blood pressures between treatment and placebo groups at each visit . Covariates adjusted for included clinical center, baseline blood lead concentration, race , sex, parents\u2019 education , single parent , age at blood pressure measurement (in years), height, and body mass index (BMI) at measurements . Mixed mThe trial data set is also a large observational cohort data set, so we also wanted to examine the relation between blood lead concentration and blood pressure in these data. To do this, we tested whether concurrent blood lead concentration was associated with blood pressure at various time points adjusted for treatment group and other covariates . Scatter plots of blood pressure by blood lead concentration and plots of residual versus predicted values of regression models supported a linear relation between blood lead concentration and blood pressure, so linear regression models were used. We also did mixed models with repeated blood lead and blood pressure measurements to test their association for two above-mentioned intervals separately.We used software R , their height was 85.7 \u00b1 5.8 cm, BMI was 16.7 \u00b1 1.8 kg/mAt baseline, the mean blood lead concentration of 780 children was 26 \u00b1 5 \u03bcg/dL; there was no difference between the succimer and placebo groups in blood lead concentration at baseline. After initiation of treatment, children in the succimer group had lower blood leads than did those in the placebo group for about 9\u201310 months. The two groups then had similar blood lead concentrations until the end of study at 60-month follow-up.p > 0.05). Adjusted mixed models for the interval from 12-month to 60-month follow-up indicated a higher systolic blood pressure for the succimer group, with an estimated difference of 1.09 mmHg ; the estimated difference in diastolic blood pressure is 0.15 mmHg .Over the 5 years starting from randomization, the children\u2019s blood lead concentrations declined by 70%  who had blood pressure measurement at baseline, the mean systolic blood pressure was 100.7 \u00b1 13.5 mmHg and the mean diastolic blood pressure was 60.3 \u00b1 11.3 mmHg. No difference of blood pressure between succimer and placebo groups at baseline was observed. p > 0.05).The cross-sectional association of blood lead levels and blood pressure were first plotted with data from baseline and 36- and 60-month follow-ups . Spline Using data from a large clinical trial of children with moderately high lead exposure, we found that succimer treatment did not change blood pressure from initiation of treatment through 9 months after treatment, although it decreased blood lead. In the interval from 1 year after treatment to 5 years after treatment, however, children in the succimer group had a 1-mmHg increase in systolic blood pressure compared with children given placebo; there was no difference in diastolic blood pressure. Analysis of most visits and mixed models considering repeated measurements did not show any consistent association between concurrent blood lead levels and blood pressures in children 2\u20137 years of age. Overall, the results suggest no association between blood lead and blood pressure in young children.in utero and postnatal exposure to 100 ppm lead in drinking water increased blood pressure, but exposure to 5 or 25 ppm did not, although renin activity was increased to 25 ppm (Lead exposure in experimental animals induces hypertension . The poso 25 ppm , 1982b. o 25 ppm . Anothero 25 ppm .It is also possible that we failed to detect an existing relation between blood lead and blood pressure. Although we have the largest sample size so far in published studies of blood lead and blood pressure in children , we onlyThe TLC trial was designed to test the hypothesis that children with moderate blood lead levels receiving succimer treatment would have better scores on tests of cognition and behavior than children on placebo. Because no difference in cognitive and behavioral scores was observed between succimer and placebo groups , we examDespite the limitations, this study had larger sample size and repeated measurements and thus more power and precision than previous studies in children. Common confounders such as age, height, and BMI were adjusted for in the analysis. The proportion of children retained in the TLC study is high, and those who remained in the follow-up did not differ in treatment group, race, sex, and socioeconomic status from those lost to follow-up.The TLC trial children had much higher blood lead levels than the mean of 2 \u03bcg/dL in general U.S. children . It is u"}
+{"text": "Lead exposure has been associated with higher blood pressure, hypertension, electrocardiogram abnormalities, and increased mortality from circulatory causes.We assessed the association between bone lead\u2014a more accurate biomarker of chronic lead exposure than blood lead\u2014and risk for future ischemic heart disease (IHD).In a prospective cohort study (VA Normative Aging Study), 837 men who underwent blood or bone lead measurements at baseline were followed-up for an ischemic heart disease event between 1 September 1991 and 31 December 2001. IHD was defined as either a diagnosis of myocardial infarction or angina pectoris that was confirmed by a cardiologist. Events of fatal myocardial infarction were assessed from death certificates.An IHD event occurred in 83 cases . The mean blood, tibia, and patella lead levels were higher in IHD cases than in noncases. In multivariate Cox-proportional hazards models, one standard deviation increase in blood lead level was associated with a 1.27  fold greater risk for ischemic heart disease. Similarly, a one standard deviation increase in patella and tibia lead levels was associated with greater risk for IHD .Men with increased blood and bone lead levels were at increased risk for future IHD. Although the pathogenesis of IHD is multifactorial, lead exposure may be one of the risk factors. Although blood lead levels in the United States and other industrialized nations have declined over the past decades, pockets of high lead exposure and widespread low-level lead exposures still persist . Moreovein vivo K X-ray fluorescence (KXRF), it is now possible to safely and rapidly measure bone lead in large-scale epidemiologic studies  in a longitudinal cohort of aging men.Participants in our study were from the Normative Aging Study (NAS), a longitudinal study of aging established by the Veterans Administration (now Department of Veterans Affairs) in 1961 . The stun = 1,019). The major reason given for nonparticipation in the bone lead study was the inconvenience involved in making a separate visit to our bone lead test facility. After excluding participants with a history of IHD  before their year of baseline lead measurement visit, the final data set for analysis included 837 participants. These 837 participants had their baseline lead measurement done during their first scheduled visit after September 1991. Approval for this study was obtained from the Human Research Committees of Brigham and Women\u2019s Hospital and the Department of Veterans Affairs Outpatient Clinic. This study complied with all applicable requirements of the United States , and all participants gave written informed consent before the study.Measurement of blood lead began in 1988 during each continuing regularly scheduled visit of the participant. Beginning in September 1991, permission was sought from each participant to obtain KXRF bone lead measurements. Consenting individuals reported to the Ambulatory Clinical Research Center of the Brigham and Women\u2019s Hospital in Boston. Of the 1,278 participants seen for their regularly scheduled NAS visits from 1 September 1991 through 31 December 2001, our study included participants who had information on either blood or bone lead level and had at least one follow-up visit in this time frame , for analysis. After room temperature digestion with nitric acid, the sample solution was centrifuged and the supernatant was poured into a sample cup. It was then analyzed by Zeeman background-correlated flameless atomic absorption (graphite furnace). The instrument was calibrated after every 21 samples with National Bureau of Standard Blood Lead Standards materials . Ten percent of the samples were run in duplicate; at least 10% of the analyses were controls and 10% were blanks. A complete calibration check was made after the last specimen was analyzed. In tests on reference samples from the Centers for Disease Control and Prevention , the coefficient of variation ranged from 8% for concentrations < 10 to 30 \u03bcg/dL, to 1% for higher concentrations. In comparison to a National Bureau of Standards  target with a known blood lead concentration of 5.7 \u03bcg/dL, 24 repeated measurements conducted by ESA Labs using this method gave a mean \u00b1 SD of 5.3 \u00b1 1.23 \u03bcg/dL.Bone lead measurements were performed from each participant\u2019s mid-tibial shaft and patella with a KXRF instrument . The physical principles, technical specifications, validation, and quality control procedures of this , 1994 ant-tests to assess the difference across cases and noncases. Blood and bone lead levels were log-transformed because their distributions were skewed. A value of 35 was added to tibia and patella lead levels before log-transformation  and lasted until the time of first IHD event or death from myocardial infarction, whichever occurred first. If the participant did not have an IHD event, the follow-up period ended on the date of last visit (before 31 December 2001) or 31 December 2001 (if the participant had a visit after 31 December 2001). Because only the year of IHD event was available, 31 December of the year in which the event occurred was used to calculate person-years for all incident cases.We selected possible confounders on the basis of their biologic significance and information from previous studies. These covariates included age, body mass index, education, race, current smoking status, pack-years smoked, alcohol intake (grams per day) , historyStatistical analysis was performed using SAS for UNIX . The authors had full access to the data and take responsibility for its integrity. All authors have read and agree to the manuscript as written.A comparison of participants included in our study with nonparticipants in the KXRF bone lead study, within the same time frame, revealed no significant differences with respect to age, race, body mass index, alcohol intake, smoking, a family history of hypertension, systolic and diastolic blood pressure, and a history of diabetes mellitus or hypertension (data not shown). A similar comparison of participants included in our study with those who did not return for a follow-up visit during our study time frame also yielded no significant differences between the two groups.Of the 837 participants in our study, an IHD event occurred in 83 cases . The mean age of noncases (65.9 \u00b1 7.3 years) was similar to that of cases (67.5 \u00b1 6.5 years). The distribution of other covariates\u2014including known risk factors for IHD such as smoking, alcohol intake, systolic and diastolic blood pressures, a history of diabetes mellitus or hypertension, serum triglycerides, and total serum cholesterol\u2014was also similar among cases and noncases . HoweverThe mean blood, tibia, and patella lead levels were higher in IHD cases than in non-cases. When blood lead level was examined as a categorical variable, the proportion of cases with a blood lead level \u2265 5 \u03bcg/dL was significantly higher than noncases. When bone lead was examined in tertiles, a higher proportion of cases were in the highest tertile of tibia and patella lead level compared with noncases  (data not shown).Age and serum high-density lipids were associated with IHD in multivariate Cox proportional hazards regression models such that the risk for IHD increased with increasing age and decreased with increasing serum high-density lipids . When asThe inclusion of other covariates known to be risk factors for coronary disease\u2014such as body mass index, alcohol consumption, current smoking, pack-years, a diagnosis of diabetes, a diagnosis of hypertension, blood pressure, family history of hypertension, total serum cholesterol, and total serum triglycerides\u2014in the final regression models did not alter our findings on the association between lead and IHD (data not shown). Our results were also similar when participants with diabetes were excluded from the analysis (data not shown).The correlation between blood and bone lead levels was modest . As expected, tibia and patella lead levels were strongly correlated with each other (correlation coefficient = 0.78). When blood lead and one of the bone lead variables were assessed in regression models simultaneously, the individual effect estimates of blood and bone lead were only moderately attenuated. The hazard ratio for log blood lead was 1.24  and for log patella lead was 2.62  when these variables were assessed together in a multivariate model. Similarly, the hazards ratio for blood lead was 1.38  and that for tibia lead was 1.55  when these variables were included together in the model.The relationship between biomarkers of long-term lead exposure and IHD has not been previously assessed. In a longitudinal study of 837 middle-aged and elderly men followed from 1 September 1991 through 31 December 2001, we found that the risk of future IHD increases significantly with increasing bone and blood lead levels, after adjusting for potential confounders.p = 0.003) and cardiovascular disease  in an unadjusted analysis; but the association disappeared when confounders were adjusted for. Another smaller study (n = 141) by The relationship of lead exposure with hypertension and increased blood pressure has been established in previous studies , 1995. FIt is likely that previous studies , althougBlood and bone lead were associated with increased risk for IHD in our study. Furthermore, the effect estimates of blood and bone lead were not attenuated when assessed simultaneously, suggesting that both contribute independently to IHD. It is unclear why tibia lead was not significantly associated with IHD, although the direction of association was consistent with our overall findings. The stronger association of patella lead with IHD is noteworthy in that the patella is composed of trabecular bone and is known to have higher turnover rates and contribute more to blood lead than the cortical bone represented by tibia lead . BecauseThe pathogenesis of the association between lead exposure and IHD can be explained by two mechanisms: One is mediation through increase in blood pressure, which has been previously associated with an increase in risk for ischemic and coronary heart disease ; and theAlthough lead levels have declined in the United States and other industrialized nations, low-level lead exposures still persist, and exposure from higher lead levels in the past is likely. Because the pathogenesis of IHD is chronic and takes years to develop, the public health implications of cumulative lifetime lead exposure in the general population are likely being currently realized and will continue in the near future.Our study was limited by the unavailability of exact date of onset for the IHD event. Therefore, 31 December of the year of IHD diagnosis was used in person-time calculations. However, it is unlikely that this would lead to a differential bias by IHD status. Because our study population included only men and had very few minority participants, our results may not be generalized to races other than white or to women. Our study also had a limited number of IHD events. Therefore, residual confounding unaccounted for in our analysis is a possibility. This includes factors such as measures of socioeconomic status that are related to lead levels. A lower socioeconomic status may lead to inadequate health maintenance, thereby increasing the risk for IHD.In summary, we found that men with increased blood and bone lead levels were at an increased risk for future IHD. Low-level lead exposures in the recent past and higher past exposures may contribute to the increased risk for IHD. Although, the pathogenesis of IHD is multifactorial, lead exposure may be one of the risk factors for development of IHD."}
+{"text": "Lead toxicity is not a problem of the past, nor is it the exclusive domain of children. In fact, lead continues today to pose a serious threat to the health of many U.S. adults.It\u2019s true that in the United States, environmental lead levels are much lower than before the toxic metal was removed from gasoline, food cans, and other products in the 1970s and early 1980s. The National Health and Nutrition Examination Surveys have shown that average adult blood lead levels have declined from about 15 \u03bcg/dL in the 1970s to today\u2019s 1\u20132 \u03bcg/dL. But there are still pockets of high exposures, such as among workers in certain industries.Despite reductions in exposure following OSHA\u2019s 1978 publication of lead standards for general industry, more than 80% of elevated lead levels in adults come from workplace exposures. Industries most affected include lead mining, refining, and smelting; construction work involving paint removal, demolition, and maintenance of outdoor metal structures such as bridges and water towers; auto repair; and battery manufacturing and recycling.When workplaces adhere to the OSHA standard, occupational exposures are usually reduced below levels that cause symptomatic lead poisoning. But as far back as 1990, studies have suggested that significant health effects happen at levels below those allowed by OSHA. \u201cHistorically people had huge lead exposures, so the OSHA standard, when it was originally established, was protective. But right now nobody thinks that that\u2019s a protective standard,\u201d says Rosemary Sokas, director of the Division of Environmental and Occupational Health Sciences at the University of Illinois at Chicago School of Public Health.Now scientists say the evidence is overwhelming that action needs to be taken to further reduce lead exposures in both the workplace and the general environment. \u201cWhat\u2019s driving concern over the need to reduce permissible levels of exposure in the workplace are . . . more subtle or chronic problems such as hypertension, and contributions to cognitive dysfunction,\u201d says Michael Kosnett, an associate clinical professor of clinical pharmacology and toxicology at the University of Colorado Health Sciences Center.With the lower levels of lead found in the general population in the United States, much of the worry is about lead\u2019s health effects over the long haul. The most recent evidence from epidemiological and toxicological studies suggests that low levels of exposure can, over time, damage the heart, kidneys, and brain. Some of these health effects, such as a 1-mm rise in blood pressure or a slight cognitive decline, seem small when expressed as the average impact to the entire population. In one individual, they may not even be noticed. But the overall impact on public health nevertheless worries scientists.Tests to measure lead exposure itself and its health effects have become more sophisticated. The blood lead level, long the gold standard for assessing risk, reflects the amount of lead circulating in the body at the time of the test but may not offer a reliable indication of an individual\u2019s past or cumulative exposure. For example, similar blood lead concentrations in two individuals (or populations) do not necessarily translate to similar exposure histories. One reason is that the body stores lead in the bone, and it\u2019s released from the bone into the blood at differing rates, depending on age, gender, and other factors. For instance, lead will mobilize from bone more quickly in people with conditions in which the body is resorbing bone, such as pregnancy or osteoporosis.Stores of lead in bone are a more reliable marker of cumulative lead exposure. In the late 1980s a noninvasive way of measuring bone lead emerged, using X-ray fluorescence technology. Scientists began applying the technique in epidemiological studies in the 1990s. But since the technology is available at only a handful of institutions in the United States, it isn\u2019t currently feasible for routine medical management.Measurement of lead\u2019s health effects have improved as well. Studies of cognitive function, for example, now have the benefit of more sensitive markers, including tests of memory, visuospatial function, and the ability to communicate or understand communication. In addition, studies with larger sample sizes and those that look at community-based populations, not just occupationally exposed workers, have sharpened the picture of the effects. \u201cIndustry studies of workers suffer from a number of methodological limitations, such as the inability to follow workers who leave the industry,\u201d says Howard Hu, chairman of the Department of Environmental Health Sciences at the University of Michigan School of Public Health.Much of the evidence in humans comes from epidemiological studies, which show associations between lead and health effects, although alone they don\u2019t definitively prove causation. But animal studies support many of these findings and suggest mechanisms for some of these health effects.According to Stephen Rothenberg, a senior researcher at Centro de Investigaci\u00f3n y de Estudios Avanzados-M\u00e9rida in Yucat\u00e1n, Mexico, the cardiovascular system is the most thoroughly studied system in adults in terms of lead\u2019s effects. A large number of these studies have investigated the effects of lead on blood pressure. Increases in both blood lead and bone lead appear to be associated with blood pressure increases.Many epidemiological studies in humans suggest that rising blood lead correlates with rising blood pressure. Overall, most epidemiological studies of the general population have shown a 1-mm increase in systolic pressure for every doubling of blood lead, and this increase has been seen at a range of concentrations, from 1 to 40 \u03bcg/dL. \u201cWhen applied to large numbers of people,\u201d Rothenberg says, \u201cthose increments shift the blood pressure curve to the right, to higher values, meaning that anywhere from tens or hundreds of thousands more people . . . to tens to hundreds of millions more are going to have blood pressures that are higher than most physicians currently think is safe.\u201dAmerican Journal of Epidemiology, Yawen Cheng of Harvard Medical School and colleagues found that in men who began the study without hypertension, baseline bone lead level predicted development of the condition six years later.In the last 15 years, about a dozen studies have also tied bone lead to blood pressure increases. For example, in a longitudinal study published in the 15 January 2001 Rothenberg points out that although blood lead primarily reflects recent exposures, it can also in part reflect the leaching of bone lead stores back into the bloodstream. \u201cThe combination of these two results\u2014significant blood lead effects on blood pressure, and significant bone lead effects on blood pressure\u2014makes researchers feel that past exposures, especially when current exposure is low, may be the dominant factor in determining lead effects on blood pressure,\u201d he says.Circulation, Andy Menke of Tulane University and colleagues found an increased risk of death from all causes as well as from cardiovascular disease and stroke in association with blood lead concentrations as low as 2 \u03bcg/dL. The study analyzed data from more than 13,000 participants in the Third National Health and Nutrition Examination Survey Mortality Study.Lead is also associated with increased mortality from diseases of the heart. In a study published 26 September 2006 in Circulation article points out some of its limitations, including the fact that participants\u2019 mortality could have resulted in part from higher lead exposures that occurred prior to the study period. But the editorial also states that the report \u201cbreaks new ground by extending the dose\u2013effect relation to considerably lower blood lead concentrations than reported in previous studies.\u201dAn editorial accompanying the Study coauthor Paul Muntner, an associate professor of epidemiology at Tulane University, says these associations stayed \u201cremarkably consistent\u201d across subgroups, including smokers, diabetics, males, and females. The consistent results suggest the associations aren\u2019t likely due to chance or other artifacts, he says.So, how does lead actually cause cardiovascular effects? Animal studies show that lead can promote the growth of vascular smooth cells, which play a role in the formation of atherosclerotic plaques. Lead\u2019s promotion of oxidative stress is thought to play a role in its cardiovascular effects . Oxidative stress happens when chemically reactive oxygen and nitrogen damage cells in a process similar to how oxygen rusts metal.Damage from lead-induced oxidative stress has been demonstrated in studies of rats as well as in studies of human cells in culture, says N.D. Vaziri, chief of the Division of Nephrology and Hypertension at the University of California, Irvine, Medical Center. In Vaziri\u2019s studies of human endothelial cells, for instance, development of oxidative stress has been seen immediately after lead exposure.But in animals it takes 10 to 12 weeks for lead exposure to result in hypertension, and in humans it likely takes years to decades, Vaziri says. One possible reason is that the body launches a variety of defense mechanisms that prevent or minimize rapid rise in blood pressure and gross tissue damage. However, over time, these defense mechanisms gradually fail, blood pressure begins to rise, and detectable tissue damage appears.American Journal of Hypertension. Immediately after lead exposure, the levels of a free radical called superoxide rose, \u201cbut then the cells are able to defend themselves,\u201d Vaziri says. \u201cA day later, the superoxide went down, but an enzyme that is made to capture the free radicals and temporarily prevent them from causing damage\u2014the enzyme called superoxide dismutase\u2014went up. So we had a reduction in superoxide at an interim period. But the defending enzyme converts superoxide to hydrogen peroxide, which is less toxic than the original free radical but still toxic, and capable of causing injury and dysfunction upon prolonged exposure.\u201d Thus, Vaziri explains, the organism mounts a defense that is able to, at least for the time being, prevent the expression of disease and injury as such. Ultimately, however, lead exhausts the system.Vaziri demonstrated this progression in cell culture studies published in the May 2000 issue of the Kidney International, E.B. Ekong and colleagues at The Johns Hopkins University wrote that lead contributed to kidney damage at concentrations below 5 \u03bcg/dL. \u201cMany different studies\u2014in Europe, Asia, and the United States\u2014have shown that higher blood lead levels are associated with lower creatinine clearance, indicating worse kidney function,\u201d says Virginia Weaver, an associate professor of environmental health sciences at Johns Hopkins and one of the authors of the review.Epidemiological studies of the general population suggest that kidney function may be altered at the lowest levels of blood lead studied to date in relation to renal effects. In a review published in the December (2) 2006 issue of Some of these studies have been longitudinal, which helps address a chicken-and-egg question: is kidney damage associated with higher blood lead levels because lead causes the damage, or because damaged kidneys can\u2019t excrete lead? \u201cIf you look at the longitudinal data, initial lead level predicts subsequent decline in renal function,\u201d Weaver says.In addition, lead\u2019s effects on the kidneys are thought to play a major role in its effect on blood pressure. This is because the kidneys help regulate blood volume and vascular tone, which are the principal determinants of blood pressure. \u201cThe kidney is the pathway through which we get rid of the excess salt and fluids. Consequently, impairment of the kidney\u2019s ability to efficiently excrete salt and fluids can result in the rise in blood volume and, hence, blood pressure,\u201d Vaziri says. \u201cAlso, the kidney produces hormones that regulate the tone of blood vessels. Thus, alterations of kidney function or structure can cause the blood vessels to constrict throughout the body, thereby raising blood pressure.\u201dSome studies of lead workers have shown associations between blood lead concentrations of 20 to 40 \u03bcg/dL and subclinical cognitive decline, including changes in memory or mental processing speed that are measurable but don\u2019t put an individual outside the normal range of function. \u201cEffects of lead at these levels may be such that in any one person they wouldn\u2019t be able to notice a difference,\u201d says Kosnett. But as with cardiovascular effects, when averaged across the whole population, there\u2019s a measurable effect.Declines in cognitive function are more likely to be associated with lower-level environmental exposures over time, rather than recent acute exposures. \u201cSome of the literature suggests that lead may contribute to or accelerate an age-related decline in cognitive function,\u201d Kosnett says. \u201cThat may be a consequence of cumulative lead exposure.\u201dEHP, Lourdes Schnaas of the Mexican National Institute of Perinatology and colleagues published one of the few studies of this relationship to pinpoint prenatal lead exposure as a greater risk to offspring IQ than childhood exposure. Previous studies had shown the strongest effects with postnatal exposure. In the EHP study, though, prenatal exposure had a more significant effect than postnatal exposure, and the strongest effects were seen at the lowest levels of exposure, says Rothenberg, a coauthor on the study. The pregnant women\u2019s blood lead concentrations ranged from 1 to 33 \u03bcg/dL, with a mean level of 8 \u03bcg/dL.One subgroup especially vulnerable to the effects of low-level lead exposure are pregnant women, whose exposure may affect their offspring\u2019s cognitive function. In the May 2006 issue of International Journal of Cancer by Edwin van Wijngaarden, an assistant professor of community and preventive medicine at the University of Rochester, showed that workers in jobs with high lead exposure were more likely than unexposed subjects to die from brain cancer. The study\u2019s value lies in its large sample size; it analyzed the lead\u2013brain cancer death association among more than 300,000 subjects in the National Longitudinal Mortality Study, a prospective census-based study of the U.S. population. But the study did not measure actual lead exposure; instead, Wijngaarden used participants\u2019 self-reported occupations and the job exposure matrix developed by the National Cancer Institute (NCI) to estimate lead exposure. \u201cThis data set and the occupational job exposure matrix that NCI has come up with certainly gave me a lot more statistical power than any of the studies [regarding lead exposure and brain cancer] that have been published so far,\u201d Wijngaarden says.In other neurotoxic effects, animal studies have suggested that lead exposure increases the risk of brain cancer. Some association studies in humans also have suggested a link. For instance, a 1 September 2006 report in the Wijngaarden is now recruiting participants for a pilot study in which he will measure bone lead in patients with brain tumors. \u201cThe main goal is to get a system ready for a larger study and to get preliminary data,\u201d he says. No studies to date have measured bone lead in cancer patients.Despite these findings, however, studies of brain cancer and lead have been inconsistent\u2014some studies have found elevated rates of brain cancer associated with lead exposure, and some have not. For cancer in general, most studies show a positive association between low levels of lead exposure and cancer, but with relatively few cancer deaths, says Kyle Steenland, a professor of environmental and occupational health at Emory University.Current research hasn\u2019t been able to determine a threshold for many of lead\u2019s effects. That is, scientists haven\u2019t yet found a concentration of lead below which no effect occurs. Some scientists say that determining a threshold would require long-term prospective studies of adults with blood lead levels commonly found in the current population. \u201cWe need to be able to characterize the dose\u2013response curve at very low levels of exposure if these data are going to be used to intelligently plan regulation,\u201d Rothenberg says.Scientists disagree on just how low measurements need to go. \u201cIs it going to do us much good to reduce the standard for intervention for kids or pregnant women from ten to five [\u03bcg/dL], or do we really have to get down to one or below in order to prevent measurable damage?\u201d says Rothenberg. Further, policy makers will want to know if there is a level of blood lead below which the resulting improvement in public health no longer outweighs the cost of further exposure reduction. \u201cWe won\u2019t know where that turnover point in the cost\u2013benefit function is until we include studies that reliably measure blood lead in many subjects below point-one micrograms per deciliter,\u201d he says.Rothenberg suggests that scientists should take advantage of advanced technologies such as inductively coupled plasma\u2013mass spectrometry to measure ultralow levels of blood lead\u2014below 1 \u03bcg/dL. That technology isn\u2019t widely available, and it\u2019s at least five times more expensive than current methods used to measure blood lead.Hu agrees that to better define risk, prospective studies are needed of adults with low to modest lead exposure (in the blood lead range of 1 to 10 \u03bcg/dL). But he believes that studying levels below 1 \u03bcg/dL would be \u201coverkill.\u201dWeaver cautions that though population studies clearly show health effects at blood lead levels below 5 \u03bcg/dL, it\u2019s hard to rule out the possibility that those health effects were caused by past higher exposures. \u201cWe don\u2019t know if this is a cohort effect and how much of these health effects will further decrease as lead exposure continues to decline,\u201d she says., showed lasting renal effects in a group that was known to have maintained blood lead levels below 10 \u03bcg/dL since 1979. \u201cThey found some of the strongest associations in that group,\u201d Weaver says. Still, the group could have had higher exposures before 1979.At least one longitudinal study supports the idea that health effects seen at low blood lead levels aren\u2019t artifacts of higher past exposures. The Normative Aging Study, conducted among more than 2,000 men in Boston\u201cThat\u2019s always the trick with a cumulative toxicant,\u201d Weaver says. \u201cThe blood levels you see today could have been much higher in the past. You don\u2019t have any way of telling unless you do bone lead measurements in everyone.\u201dPhysicians can get some idea of cumulative exposure by measuring blood lead regularly. \u201cFor any employer or employee who is facing a job in which there\u2019s lead exposure, taking regular blood leads, keeping those records, and periodically calculating a cumulative exposure index is inexpensive and reliable,\u201d Hu says.What\u2019s a reasonable blood lead level in someone who\u2019s exposed to lead on the job? Hu says that at levels at or below 20 \u03bcg/dL, a worker is assuming some increased risk but an amount that may be acceptable. \u201cIf you have a blood lead of twenty for a working lifetime\u2014let\u2019s say forty-five years\u2014you will get a cumulative blood lead index that we calculated would be equivalent to a bone lead of a certain level,\u201d Hu says. \u201cThat bone lead level in our epidemiology studies still corresponds to a certain excessive risk of developing hypertension and declined cognition. But it\u2019s not greatly above what the general population sees.\u201dKosnett recommends that at occupational exposures as low as 10 \u03bcg/dL, physicians should increase monitoring and reduce lead exposures. He recommends removing people from all lead exposure when blood lead levels are at 20 \u03bcg/dL and remain there when a second measurement is taken four weeks later, or if a single check registers a level of more than 30 \u03bcg/dL.By contrast, OSHA\u2019s current lead standard doesn\u2019t require full removal from exposure until blood lead concentrations exceed an average of 50 \u03bcg/dL over three successive tests or two back-to-back measurements of 60 \u03bcg/dL. Scientists have been calling for reductions in these cutoffs as far back as 1991. But OSHA has long been reluctant to revise standards proactively, says Sokas, who once served as chief medical officer at OSHA.\u201cThe lead standard is very strong in terms of wage replacement if blood lead is above a certain cut line,\u201d says Kenneth Rosenman, chief of the Division of Occupational and Environmental Medicine at Michigan State University. And the standard does include a provision that, even at blood lead levels below the mandatory cutoffs, physicians can recommend medical removal when workers have a specific medical condition, with these workers entitled to the same job and salary protection as those whose blood lead levels rise above the 50/60 \u03bcg/dL cutoff.Automobile Workers v. Johnson Controls held that precluding such women from exposure would be unlawfully discriminatory. \u201cSo on the books now, it\u2019s still acceptable for a pregnant woman to be highly exposed to lead to the same degree as men, even though the evidence is overwhelming that fetuses are exquisitely vulnerable to lead,\u201d Hu says.Still, although that provision protects against overt lead poisoning, it does nothing to promote preventative removal at lower levels\u2014such as 20 \u03bcg/dL\u2014that may pose long-term health risks. By the same token, there\u2019s nothing in the law that prohibits a pregnant woman from working with lead until her blood level reaches 60 \u03bcg/dL. Indeed, a 1991 Supreme Court decision in the case of In the past, OSHA has touted its emphasis on voluntary medical surveillance programs and other measures to reduce exposure. Industry tends to favor voluntary exposure reduction as well. \u201cThe science has developed since the last time the OSHA standard was visited, and we\u2019re aware of that,\u201d says David Weinberg, counsel for the Battery Council International. \u201cI\u2019m not sure it\u2019s necessary that OSHA reopen the lead standard. The battery industry and the secondary smelter industry have worked pretty hard on these issues, and have worked with and expect to continue to work with OSHA and others in voluntary programs to make sure that the progress that\u2019s been made continues.\u201dOther subgroups that are very susceptible to lead exposure are emerging, and scientists say these groups pose another reason that regulations should be strengthened. People with certain genetic susceptibilities might constitute one such group. \u201cIt\u2019s been recognized for a long time that there can be considerable interindividual variability in people\u2019s susceptibility to the development of symptomatic lead poisoning,\u201d Kosnett says.\u201cFurther research is needed to explore and understand this aspect of gene\u2013environment interaction,\u201d Kosnett says.Even at a blood lead level as high as 60 \u03bcg/dL, for instance, some people will show symptoms and others won\u2019t. Now, scientists are finding that the same is true of the emergence of health effects at very low levels of lead exposure, and recent research suggests that genetic variations may play a role. EHP, Hu and colleagues showed that lead exposure was associated with increased heart rate variability , especially in people with metabolic syndrome, a cluster of conditions including obesity, high blood sugar, and high blood pressure. People with any or all of these conditions are also known to be at increased risk for kidney damage and so may be more susceptible to lead\u2019s effects. \u201cWith the obesity epidemic in so many countries, diabetes and hypertension are increasing, so we do have more groups at risk,\u201d Weaver says.People who already have medical conditions are also at increased risk. In the November 2006 issue of Such studies point to another reason why lead exposure is very much a problem of the present. \u201cAs a nation, the work force is aging, and we\u2019re expecting ourselves and our workers to keep working when they\u2019re older,\u201d Hu says. \u201cBut that means that a lot of them will have medical conditions, and we have to anticipate their vulnerability to environmental risk factors like lead.\u201dMuntner says that more work is needed to find effective and safe interventions for lowering lead exposure at the population level for people whose blood lead concentrations are already below 10 \u03bcg/dL. He points out that although blood lead levels have decreased substantially in the last 30 years, they are still much higher than they were in preindustrial times, before humans began spreading lead into the air, water, and soil.\u201cSo we need to not be complacent and say, \u2018We\u2019ve lowered lead,\u2019 but rather we need to think about it in terms of how can we reduce lead more, such that we eliminate this environmental toxicant,\u201d Muntner says. \u201cThere\u2019s really no biological function of lead, and there\u2019s really no reason why we should be exposed to it.\u201d"}
+{"text": "We have assembled this mini-monograph on adult lead exposure to provide guidance to clinicians and public health professionals, to summarize recent thinking on lead biomarkers and their relevance to epidemiologic research, and to review two key lead-related outcomes, namely, cardiovascular and cognitive. The lead standards of the U.S. Occupational Safety and Health Administration are woefully out of date given the growing evidence of the health effects of lead at levels of exposure previously thought to be safe, particularly newly recognized persistent or progressive effects of cumulative dose. The growing body of scientific evidence suggests that occupational standards should limit recent dose to prevent the acute effects of lead and separately limit cumulative dose to prevent the chronic effects of lead. We hope this mini-monograph will motivate renewed discussion of ways to protect lead-exposed adults in the United States and around the world. Public health and regulatory efforts in the United States have achieved great successes over the last 40 years regarding environmental lead exposure. Chronological trend data from the National Health and Nutrition Examination Surveys have documented a decline in average adult blood lead levels from approximately 15 \u03bcg/dL in the 1970s to the current 1\u20132 \u03bcg/dL . SimilarIn contrast, despite a growing body of research that demonstrates adverse effects in adults at progressively lower levels of exposure, the lead standards of the U.S. Occupational Safety and Health Administration (OSHA), promulgated in final form for general industry  Program, a National Institute for Occupational Safety and Health (NIOSH) endeavor currently operating in 38 states. In 2000, ABLES formed an ad hoc Committee for the Development of Adult Blood Lead Level Medical Management Guidelines and a draft document was produced (unpublished). The Association for Occupational and Environmental Clinics (AOEC) agreed to sponsor the next steps in the review and revision of the draft document, and obtained federal funding in support of this activity. AOEC next assembled a panel of 13 experts with training and experience in the areas of lead toxicology, epidemiology, occupational medicine, occupational health nursing, industrial hygiene, and public health policy and practice, from academic institutions, government, labor organizations, and industry to review the document. Panel members included  Rose Goldman, Dana Headapohl, Karen Hipkins, Howard Hu, Michael Kosnett, Barbara Materna, Pamela Reich, Stephen Rothenberg, Brian Schwartz, Eugene Shippen, Richard Wedeen (Panel Chair), Laura Welch, and Alan Woolf. Kathy Kirkland (Executive Director of the AOEC), coordinated the activities of the panel.The panel met in March 2003 in Washington, DC, and then held a series of conference calls through 2005 to make revisions to the document. At the onset, the panel chose to focus on health-based recommendations and not to explicitly consider feasibility of implementing these guidelines. The panel also generally decided not to explicitly consider socioeconomic considerations for lead workers, for example, if a cumulative lead dose limit required workers currently in the lead-using industries to discontinue all further work in lead and thus had to leave their jobs. Measures designed to protect health may incur unacceptable costs to individual workers and industry, but the considerations of panel members and authors of the articles in the mini-monograph were solely motivated by scientific evidence regarding health. Conclusions stated in all articles in the mini-monograph are not intended to be enforceable standards, which by law must reflect feasibility and experience gained under OSHA and other health and safety laws. The third article  in the mOverall, there was a remarkable degree of consensus among panel members. The two industry representatives on the panel voiced a number of concerns during the process, but other panel members generally agreed on all but a few points. Although the panel made considerable progress in reaching consensus, a number of challenges to its process must be acknowledged. Funding was available only for one face-to-face meeting. This meeting highlighted many difficult issues that needed continued analysis and discussion, but all further discussion was only available by conference call. In contrast to typical Institute of Medicine (IOM) committees charged with reviewing scientific evidence and making recommendations for public health or clinical medicine , our comA review of the OSHA lead standards and their preambles allows several conclusions. First, the standards emphasize prevention of acute symptoms in several organ systems and prioritize other measurable health effects in a way that is likely to be considered differently today. Most health effects that are considered are of relatively short latency and are more likely to occur after high-level, short-term exposures. For example, there is extensive discussion of the hematopoietic system in which measurable health effects occur with short latency after moderate to high lead exposures and very little consideration of long-latency, chronic health effects. Such chronic health outcomes as cognitive dysfunction, hypertension risk, and renal dysfunction after long-term, low-level exposures were not considered in any substantive detail. So, while the OSHA standards mainly focused on prevention of symptoms, hematopoietic outcomes, and renal dysfunction associated with high-level exposures, the highest priority concerns of today would be cognitive decline, hypertension and other cardiovascular outcomes, long-latency renal disease, and reproductive outcomes.Second, the standards considered the level of lead in whole blood to be the key lead bio-marker and, although not explicitly discussed, blood lead was generally used only as a measure of relatively recent dose. There was no consideration of cumulative dose or long-term lower-level exposures despite the fact that many health outcomes associated with environmental exposures are due to cumulative dose  and the fact that lead was known to accumulate in bone and thus has long residence times in the body. Health physicists were developing and validating X-ray fluorescence (XRF) systems for measurement of lead in bone at that time, but certainly by the late 1980s or early 1990s, there was extensive experience with measurement of lead in bone by cadmium-109\u2013induced K-shell XRF, if not widespread availability. Third, there was no consideration about whether health effects could progress after cessation of occupational exposure. Finally, there was little consideration of susceptible subgroups such as older individuals or those with certain genetic polymorphisms. In fairness, little was known about genetic susceptibility to lead poisoning in the 1970s, but a large number of studies have been published on the topic since that time. Any new recommendations for occupational lead exposure standards should recognize that there are susceptible subgroups and limits should protect the most susceptible workers.3 (8-hr time-weighted average) or higher for > 30 days/year. Although slight differences exist in the two OSHA lead standards, OSHA requires that workers in general industry be removed from further lead exposure if a single blood lead level is \u2265 60 \u03bcg/dL, or if three determinations over 6 months average \u2265 50 \u03bcg/dL, until levels decline to < 40 \u03bcg/dL. An important implication of these limits is that, because OSHA accepts a blood lead level of 40 \u03bcg/dL for a working lifetime (40 years), a cumulative blood lead index of 1,600 \u03bcg-years/dL  is an acceptable cumulative dose. As discussed in greater detail in the second article . Unfortunately, other scientists and public health professionals made similar recommendations more than 15 years ago , and lit3 was based on industry claims of feasibility for engineering and ventilation controls, but current technologies are better than those that were available in the 1970s. However, the lower limits may require greater reliance on respirators, which will have implications for both workers and employers.These recommendations require more stringent exposure limits than currently exist in the OSHA standards and a tighter link between exposure and dose in surveillance programs. The OSHA permissible exposure limit of 50 \u03bcg/mThe mini-monograph consists of four other articles:The article by The review by Other outcomes were also considered by the panel but additional manuscripts were not solicited for the mini-monograph for several reasons. First, at the time of preparation of the mini-monograph, the U.S. Environmental Protection Agency (U.S. EPA) was in the process of updating its Air Criteria Document for Lead  and syst"}
+{"text": "Analyses of smoothing curves and regression lines for tibia and patella lead suggested an inflection point at 55 years of age, with slopes for subjects \u2265 55 years of age that were not only steeper than those of younger subjects but also substantially steeper than those observed for individuals > 55 years of age in studies of predominantly white participants. This apparent racial disparity at older ages may be related to differences in historic occupational and/or environmental exposures, or possibly the lower rates of bone turnover that are known to occur in postmenopausal black women. The higher levels of lead accumulation seen in this age group are of concern because such levels have been shown in other studies to predict elevated risks of chronic disease such as hypertension and cognitive dysfunction. Additional research on bone lead levels in minorities and their socioeconomic and racial determinants is needed.We measured blood and bone lead levels among minority individuals who live in some of Boston\u2019s neighborhoods with high minority representation. Compared with samples of predominantly white subjects we had studied before, the 84 volunteers in this study  had similar educational, occupational, and smoking profiles and mean blood, tibia, and patella lead levels  that were also similar. The slopes of the univariate regressions of blood, tibia, and patella lead versus age were 0.10 \u03bcg/dL/year ( Research has suggested that lead toxicity may disproportionately affect minority groups. . DespiteMost studies analyzing racial differences in lead toxicity have focused on blood lead as a biomarker. Although blood lead mostly provides an accurate measure of recent lead exposure, evidence has been growing to indicate that this biomarker does not adequately reflect an individual\u2019s health risk due to cumulative lead exposure . In adulSociodemographic rather than genetic factors, including low income and residence in older housing, have been attributed to the higher blood lead levels seen in black children . AlthougSubjects were recruited from the pool of subjects who participated in a study funded by the National Institutes of Health  that had significant minority and female involvement. These subjects had been initially recruited via solicitation letters sent to residents in Boston, Massachusetts, census tracts in the Jamaica Plain neighborhood with high minority representation. Additional subjects for our study were drawn from the Roxbury, Dorchester, and Jamaica Plain neighborhoods\u2014which also have high minority representation\u2014through participant referrals to family members and friends.Letters introducing the study and demographic and consent forms were sent to potential subjects. Only minority subjects \u2265 35 years of age were accepted. Willing and eligible participants were invited to the Brigham and Women\u2019s Hospital outpatient clinic in Boston, where a fresh whole blood specimen was collected for lead measurement and where K X-ray fluorescence (KXRF) bone lead measurements were taken. Blood and bone lead measurements were taken between 1999 and 2000 for participating subjects. Participants who completed the study were reimbursed for their time and effort.The human research committees of the Brigham and Women\u2019s Hospital and the Department of Veterans Affairs Medical Center in Boston approved the research project. Written informed consent was obtained from all participants.Blood for lead measurements was collected in 7-mL trace-metal\u2013free tubes  containing EDTA and sent for analysis to ESA Laboratories, Inc. . The ESA Laboratories blood lead analysis protocol and quality control and quality assurance specifications are described elsewhere .An ABIOMED KXRF instrument  was used to take bone lead measurements of each subject\u2019s midtibial shaft and patella. The physical principles, technical specifications, validation, and quality control procedures of this , 1994 an109Cd gamma-ray source to induce fluorescence from the target tissue. The emitted photons are then detected, counted, and arrayed on a spectrum  and S-Plus version 6.1  for database management and statistical analysis. The quality of the KXRF measurements was preserved by discarding tibia and patella lead values with associated measurement-uncertainty estimates of > 10 \u03bcg/g and > 15 \u03bcg/g, respectively. Negative tibia and patella measurements were retained to minimize bias and increase efficiency of comparing bone lead levels among different populations .We created final education categories after collapsing comparable educational levels that had similar blood and bone lead data. Subjects with technical school training and college education were pooled together, as were students with graduate and professional schooling. For race, the 69 black participants comprised one category and the 15 other subjects, who were Hispanic, Asian, and American Indian, were classified as \u201cother.\u201d For job type, we classified retired subjects as white collar or blue collar based on their previous occupation. For example, doctors, lawyers, engineers, and so on, were categorized as white collar, whereas technicians, repairmen, carpenters, and so forth, were categorized as blue collar. We adopted a complete classification list of professions which has been published elsewhere by We examined blood, patella, and tibia lead levels across categories of age, race, education, smoking status, alcohol consumption, and job type. Simple linear regression of blood, tibia, and patella lead level versus age was performed over the entire age range. We performed graphic evaluation by locally weighted scatter plot smoothing (Lowess) to verify and select an inflection point for both biomarkers . SeparatMultiple linear regression models were constructed to predict blood, tibia, and patella lead. Age, sex, race, educational level, alcohol consumption, cumulative smoking, and job type\u2014variables known to be associated with these biomarkers\u2014were forced into all models. Interaction terms of black race with blue-collar work, black race with male sex, and male sex with blue-collar work were tested for significance.n = 13) and patella (n = 1) lead values associated with measurement uncertainty estimates of > 10 \u03bcg/g and > 15 \u03bcg/g, respectively, and 10 subjects who were missing covariate values for education (n = 6) and/or job type (n = 4). Comparisons between the 84 included subjects and 24 excluded subjects revealed no meaningful differences with regard to blood, tibia, or patella lead or age, race, education, pack-years of smoking, alcohol consumption, or job type.A total of 108 subjects participated in this study, coming from the Jamaica Plain, Roxbury, and Dorchester neighborhoods in Boston: 86 black, 7 Hispanic, 3 American Indian, 2 Asian, and 10 other or unknown. Response rates to mailings in the parent study (< 10%) and the present study (< 10%) made our sample largely one of convenience. A final population of 84 subjects were included in the present analyses after we excluded 14 subjects for tibia , and 56 (67%) subjects were female . The prop < 0.001), 0.45 \u03bcg/g/year (p < 0.001), and 0.73 \u03bcg/g/year (p < 0.001), respectively. Further analysis with smoothing plots indicated that the associations between age and bone lead biomarkers were nonlinear. In general, the univariate regression slopes of tibia and patella lead versus age were greater among subjects \u2265 55 years of age than among those < 55 years of age . Having a blue-collar occupation significantly predicted an 8.02 \u03bcg/g increase in patella lead (p < 0.05). When interaction terms between black race and blue-collar work, black race and male sex, and male sex and blue-collar occupation were tested as predictors of lead biomarkers, they were insignificant (data not shown).In multiple regression models with independent variables that included age, sex, race, pack-years of smoking, drinking, educational levels, and occupation, age was the most significant predictor for blood, tibia, and patella lead . A histoThe blood and bone lead levels we observed in this study indicate that this minority sample had lead exposure similar to that of the general population. The relatively low levels of blood lead  parallel those reported for individuals 20\u201374 years of age in the 1988\u20131991 NHANES III  . StudiesAs seen in other studies of general population samples, age was the predominate correlate of tibia lead  and pateCompared with age-related increases in bone lead of \u03b2 = 0.31 \u03bcg/g/year observed by In contrast, among subjects \u2265 55 years of age, tibia lead increased at a greater rate (\u03b2 = 0.69 \u03bcg/g/year) than that measured in previous Normative Aging Study research . In previous research of a sample of white men who were not employed in lead-related industries, we found that tibia and patella lead levels were higher in those employed in blue-collar jobs (Although participants were not asked if they had occupational lead exposure, in multivariate analyses blue-collar work by itself was a significant determinant of patella lead (lar jobs . Becauselar jobs , low eduThe main limitations of this study stem from our relatively limited sample size as well as potential biases related to our subject recruitment. Although our subjects came from some of Boston\u2019s high-minority-representation communities, they were volunteers who had participated in previous research and who essentially comprised a convenience sample. In addition, our models of bone lead were only able to explain up to 24% of their variance\u2014a figure that is similar to those found in other studies such as the Normative Aging Study ; thus, t"}
+{"text": "Increases in peak blood lead concentrations, which occur at 18\u201330 months of age in the United States, are thought to result in lower IQ scores at 4\u20136 years of age, when IQ becomes stable and measurable. Data from a prospective study conducted in Boston suggested that blood lead concentrations at 2 years of age were more predictive of cognitive deficits in older children than were later blood lead concentrations or blood lead concentrations measured concurrently with IQ. Therefore, cross-sectional associations between blood lead and IQ in school-age children have been widely interpreted as the residual effects of higher blood lead concentrations at an earlier age or the tendency of less intelligent children to ingest more leaded dust or paint chips, rather than as a causal relationship in older children. Here we analyze data from a clinical trial in which children were treated for elevated blood lead concentrations (20\u201344 \u03bcg/dL) at about 2 years of age and followed until 7 years of age with serial IQ tests and measurements of blood lead. We found that cross-sectional associations increased in strength as the children became older, whereas the relation between baseline blood lead and IQ attenuated. Peak blood lead level thus does not fully account for the observed association in older children between their lower blood lead concentrations and IQ. The effect of concurrent blood level on IQ may therefore be greater than currently believed. In 1994, two meta-analyses of the relationships between childhood lead exposure and IQ appeared . Both deOne meta-analysis  includedThese meta-analyses as well as the findings from the individual prospective studies, especially Boston , have haIt is not clear that only the peak blood lead concentration matters. In the prospective Boston study that examined children with very low lead exposure, blood lead concentration at 2 years of age, but not at 57 months or 10 years of age, was significantly associated with IQ at 10 years of age . Other pOther analyses have asked whether greater declines in blood lead concentration from the 2-year peak are associated with higher IQ later. Two studies with analyses that adjusted for 2-year cognitive test score found that children whose blood lead concentrations fell more after 2 years of age had increased IQ . HoweverHere we examine a large prospective data set from a clinical trial of lead poisoning treatment. This data set includes blood lead concentrations measured frequently between entry at about 24 months of age and the last follow-up at 90 months, as well as the results of IQ testing at multiple times. We sought to clarify the strength of the association between IQ and blood lead at the various time points, to examine whether the cross-sectional associations seen in the 84- to 90-month-old children represent residual effects from 2 years of age or new effects emerging among these school-age children, and how the change in blood lead over time is related to IQ at follow-up.The Treatment of Lead-exposed Children (TLC) study was a multicenter, randomized, placebo-controlled clinical trial of 780 children 12\u201333 months of age with blood lead concentrations of 20\u201344 \u03bcg/dL. The study tested whether succimer treatment of toddlers resulted in better scores on IQ tests and other measures of behavioral and psychological function . AlthougVenous blood was collected with lead-free containers twice before randomization and on days 7, 28, and 42 after the beginning of each course of treatment. After the termination of treatment, blood lead concentrations were measured every 3\u20134 months. From up to 24 measurements of blood lead concentrations, we used the second blood sample before randomization at baseline (about 2 years of age), the blood sample at 36-month follow-up (about 5 years of age), and the last blood sample at 60-month follow-up (about 7 years of age) . The peaAt baseline, children were given the Bayley Scales of Infant Development\u2013II (BSID-II) , the mosWe used multiple linear regression models to analyze the association of blood lead concentration and cognitive scores at various ages. Both log-transformed and untransformed blood lead concentrations were tested in the statistical models, and the findings were similar. In this article, only results of untransformed blood lead concentrations were used. Covariates include clinical center , race (black or white/others), sex , language (English or Spanish), parent\u2019s education , parent\u2019s employment , single parent (yes or no), age at blood lead concentration test, and caregiver\u2019s IQ.First, one blood lead concentration  was included as an independent variable to model IQ score , with adjustment for covariates.Then, to evaluate whether the cross-sectional association was a residue of the effect from an earlier blood lead concentration, both prior and concurrent blood lead concentration were included in the models . The model thus includes later IQ as the dependent variable, and earlier blood lead concentration, later blood lead concentration, and covariates as the independent variables. We also tried additional adjustment for earlier IQ, which theoretically tests for change in IQ by change in blood lead concentration. This allows us to compare results with previous studies using a similar approach .Quantitative analysis of both prior and concurrent blood lead concentration in the same model, even without adjustment for prior IQ, still faces the problem of collinearity between the two blood lead measurements. A qualitative alternative may reduce the precision in estimation but should show the effect on school-age IQ by blood lead concentration with less distortion. Therefore, we used the median of earlier blood lead concentration and the median of later blood lead concentration as cutoff points to reduce earlier and later blood lead concentrations to binary variables. This does not eliminate the inherent correlation between earlier and later blood lead concentrations (children with lower earlier blood lead concentrations tend to have lower later blood lead concentrations), but it reduces the impact of collinearity on the stability of the estimated regression coefficients and produces a model that is easy to interpret.To see whether the association between blood lead concentration and IQ score varied by treatment group (succimer or placebo), we repeated these regression models by treatment group.We used SAS  for statistical analysis. All tests are two sided. Because of the difference in the number of children tested for each follow-up measurement, the sample sizes of the different regression models vary slightly.Four centers were involved in the recruitment, treatment, and follow-up of a total of 780 children in the TLC study: Baltimore had 213, Cincinnati had 194, Newark had 208, and Philadelphia had 165. Three hundred ninety-six children were randomly assigned to the succimer group, and 384 to the placebo group. There were no differences between groups in age, sex, race, socioeconomic status, and blood lead concentration of children at recruitment. The children were mainly African American (77%), from households speaking English (95%), with a single parent (72%), and receiving public assistance (97%).p-values < 0.001). Although mean blood lead concentration declined over time, the standard deviations remained similar. As shown in The blood lead concentrations and IQ scores of TLC children at baseline and at 5 and 7 years of age are shown in p-values > 0.10). The association between blood lead concentration and IQ score was homogeneous between treatment groups except for baseline blood lead concentration and baseline MDI: 10-\u03bcg/dL increment at baseline had a coefficient of \u20131.6  MDI points in the succimer group and \u20134.6  MDI points in the placebo group. In the regression models including both prior and concurrent blood lead concentrations without additional adjustment for prior IQ, the results were similar in the succimer and placebo groups.There were no statistical differences between succimer and placebo groups in either blood lead concentrations or cognitive scores at the time points under consideration , despite lower blood lead concentrations in older children. This analysis supports the idea that lead exposure continues to be toxic to children as they reach school age, and does not support the interpretation that all the damage is done by the time the child is 2 or 3 years of age.We found previously that children with relatively greater declines in blood lead have improved IQ, but that finding was limited to children given placebo . The anaIt is prudent to ponder whether greater association between concurrent blood lead and IQ score at school age was due to reverse causality. This could happen if the lower IQ preceded higher lead concentrations. In this data set, baseline MDI was not associated with blood lead concentration at 7 years, with or without adjustment of baseline blood lead. This supports the findings of the longitudinal Port Pirie study  and suppThis finding implies that cross-sectional associations seen in older children, such as the school-age children in the National Health and Nutrition Examination Survey data, should not be dismissed as representing a residual from early high lead exposure. The strengths of this analysis include the relatively large size of the data set and the degree of testing and quality control that went into the measurement of both blood lead and IQ. The longitudinal nature of these data is a requirement for this kind of analysis, and the TLC study enjoyed remarkably high retention rates for a longitudinal study among relatively disadvantaged families.Children in the TLC study had blood lead concentrations high enough to be eligible for a clinical trial of drug therapy. These blood lead concentrations are considerably higher than those of most children in the United States today, even children in poverty . Althoug"}
+{"text": "EHP 113:894\u2013899][.The maximum blood lead concentration deemed acceptable for children has declined over the years, from 60 micrograms per deciliter (\u03bcg/dL) in 1970 to the present-day level of 10 \u03bcg/dL, first established in 1991. In the last several years, however, researchers have begun to suspect that even lower concentrations may impair cognition. Now a reevaluation of data from seven international longitudinal studies involving 1,333 children confirms this suspicion The studies\u2014conducted in Boston, Cincinnati, Cleveland, Rochester (New York), Port Pirie , Mexico City, and Yugoslavia\u2014originally looked at children known to be at risk for lead poisoning, such as those living near lead smelters or in deprived urban settings. Therefore, the majority of the participants had blood lead levels far higher than the averages currently being reported in the developed world. The mean blood lead concentration for the entire group peaked at 17.8 \u03bcg/dL at age 2.5 years, and declined to 9.4 \u03bcg/dL between ages 5 and 7. Only 18% of the children had maximal blood lead levels of less than 10 \u03bcg/dL, and 8% had maximal blood lead levels of less than 7.5 \u03bcg/dL.Most of the children took IQ tests when they were between almost 5 and 7 years of age; the Boston children were tested at age 10. The current team calculated, across the seven studies, how much of the difference in IQ scores was related to lead alone by controlling for other factors that influence IQ scores, including child birth weight, birth order, prenatal exposure to tobacco smoke and alcohol, and mother\u2019s IQ.On a population basis, an increase in blood lead level from 2.4 to 10 \u03bcg/dL at the time of testing was associated with a decrease of 3.9 IQ points. At lower blood lead levels, a small increase in blood lead made a bigger difference in IQ than the same size increase did at higher concentrations. A blood lead level of 20 \u03bcg/dL was associated with scoring about 1.9 points lower on tests of IQ compared with a blood lead level of 10 \u03bcg/dL. The difference in IQ shrank to 1.1 points when comparing a blood lead level of 20 \u03bcg/dL with a concentration of 30 \u03bcg/dL.To determine if the data from one particular study drove the final results, the team removed the findings for one site at a time and recalculated the results. It became clear that no single study was driving the results of the pooled analysis.EHP, blood lead level at the time of IQ testing was generally a stronger predictor of effects on IQ than was\u2014as previously believed\u2014blood lead level at age 2. The individual-level effect on IQ is difficult to determine, however, and may depend in part on the child\u2019s social environment.Consistent with a study published in the May 2005 issue of In the United States, about 2\u20133% of children have a blood lead concentration above 10 \u03bcg/dL, but in some cities, such as Rochester, 1 in 5 children have elevated blood lead. These new findings, along with those from previous human and animal studies, point to the importance of eliminating nonessential uses of lead and lowering allowable levels of lead in air emissions, house dust, soil, water, and consumer products."}
+{"text": "EHP 114:579\u2013583; Chen et al.][.For two decades, scientists have known that lead exposure can induce hypertension in lab animals. More recent studies suggest it might also promote hypertension in adults. But little was known about the metal\u2019s effects on blood pressure in children. Now researchers who studied 780 lead-exposed children for five years report seeing no indication that lead raises blood pressure in young children Lead\u2019s most widely documented effects are neurological. Exposure diminishes intelligence and alters behavior. Young children are particularly vulnerable to these effects because their nervous systems are still developing. Children are exposed primarily through paint particles in household dust and outdoor soil contaminated with lead from paint and industrial and motor vehicle emissions. Lead exposure in the United States plummeted after the 1978 ban on lead paint, when the CDC reported that 88% of children aged 1 through 5 had blood lead levels above the level of concern of 10 micrograms per deciliter (\u03bcg/dL). By 2000, that rate had dropped to 2.2%.The researchers originally set out to determine whether treatment with the oral chelating agent succimer would improve lead-exposed children\u2019s scores on behavioral and cognitive tests. They recruited 780 children at clinics in Baltimore, Cincinnati, Philadelphia, and Newark. All were between 12 and 33 months of age and had moderately high blood lead levels of 20\u201344 \u03bcg/dL. Succimer was given to 396 children in the randomized, double-blind study. The remaining 384 children were given a placebo.Succimer lowered blood lead levels dramatically, but there was no change in test scores. So the researchers opted to examine the data for blood pressure changes.Clinicians had measured the children\u2019s blood pressure every time they tested blood lead\u2014immediately before the study and 7, 28, and 42 days after the start of each of three 26-day rounds of treatment. Measurements also were taken every three to four months for five years following treatment.The only difference noted was a 1-mmHg increase in systolic blood pressure between one and five years after treatment\u2014but only in the succimer group. The researchers considered this change insignificant. Diastolic pressure remained unchanged for both the succimer and placebo groups.The team acknowledges that lead exposure might still cause hypertension years or even decades after exposure. This, combined with lead\u2019s known neurological effects, renders the metal an important contributor to the global burden of disease."}
+{"text": "We review several issues of broad relevance to the interpretation of epidemiologic evidence concerning the toxicity of lead in adults, particularly regarding cognitive function and the cardiovascular system, which are the subjects of two systematic reviews that are also part of this mini-monograph. Chief among the recent developments in methodologic advances has been the refinement of concepts and methods for measuring individual lead dose in terms of appreciating distinctions between recent versus cumulative doses and the use of biological markers to measure these parameters in epidemiologic studies of chronic disease. Attention is focused particularly on bone lead levels measured by K-shell X-ray fluorescence as a relatively new biological marker of cumulative dose that has been used in many recent epidemiologic studies to generate insights into lead\u2019s impact on cognition and risk of hypertension, as well as the alternative method of estimating cumulative dose using available repeated measures of blood lead to calculate an individual\u2019s cumulative blood lead index. We review the relevance and interpretation of these lead biomarkers in the context of the toxico-kinetics of lead. In addition, we also discuss methodologic challenges that arise in studies of occupationally and environmentally exposed subjects and those concerning race/ethnicity and socioeconomic status and other important covariates. In the worlds of environmental health and environmental medicine, lead exposure remains one of the most important problems in terms of prevalence of exposure and public health impact. Despite decades of intensive research, lead toxicity also remains one of the most, if not the most, studied subjects of all within the fields of environmental health and environmental medicine. This reflects the large gaps that continue to exist in our understanding of the full implications of lead exposure on health: how lead exposure may impact on chronic diseases; what mechanisms dictate lead\u2019s health effects; how to predict, monitor, and manage lead toxicity; and what factors may modify lead\u2019s effects.Epidemiologic studies form the body of research most relevant to anticipating human health effects and developing guidelines for preventing and managing human exposures. In recent years, we have seen great advances in their level of sophistication and design. Such advances allow greater inference in terms of issues critical to prevention and public health, such as potential causality, dose\u2013response relationships, and susceptible subpopulations.Two of the articles in this mini-monograph are reviews of the effects of lead on the cardiovascular system and upon cognitive function in adults . Issues We also address important issues related to epidemiologic design, such as cross-sectional versus longitudinal studies; community-based versus occupational studies; and the identification and control of bias and confounding. Our goal in this article is to provide the methodologic basis to interpret the major issues that are of relevance to the articles in the mini-monograph as well as future studies intending to investigate the effect of lead on health outcomes.In reviewing studies of the health effects of lead, it is critical to understand the available lead biomarkers in terms of how they represent external exposure , how they are influenced by metabolic factors , and how the combination of these considerations impacts inferences regarding the health effects of lead. In this section, our goal is to persuade the reader that the most informative recent epidemiologic studies of the impact of lead on health are those that were able to derive estimates of both recent and cumulative lead dose for each study participant.in vivo K-shell X-ray fluorescence [KXRF] instruments). Blood lead levels are an indicator of circulating lead that captures variation in recent external lead exposure as well as lead that has been mobilized from tissue stores (mostly bone). Lead levels in tibia and patella provide an indication of cumulative dose over decades  as well as the largest pool of lead in the body that is available for mobilization into blood. The latter phenomenon is heightened at times of high bone resorption . Taken together, blood and bone lead levels have provided recent epidemiologic studies with the best available assessment tools for estimating both recent and cumulative lead. It is also noted that an acceptable surrogate for cumulative lead dose that does not require KXRF measurement of lead in bone can be derived by using repeated measures of blood lead over time of exposure to derive time-integrated indices such as working lifetime time-integrated blood lead levels . Such measures have been demonstrated to be well-correlated with tibia lead levels  and bone  to have substantial statistical power. Below we discuss these issues in more detail.Blood lead levels measured in epidemiologic studies with valid instruments and standardized calibration and quality control procedures have been reported in the literature for more than 35 years. Bone lead levels measured by When reviewing studies on the health effects of an \u201cexposure,\u201d it is critical to evaluate the validity of biological tests  used to measure \u201cexposure.\u201d Validity, in this context, incorporates notions of measurement precision and accuracy as well as the value of the metric in predicting the health outcome(s) of interest.With respect to lead toxicity, biological measurements of lead have been used to measure lead dose for decades. Indeed, the most commonly employed of such tests, the measurement of lead in whole blood, has become one of the few human tests of an environmental toxicant that is widely available in commercial U.S. laboratories and that has been legislated as a test for monitoring exposure required by many states  and by the federal government .However, a recurrent theme of this mini-monograph is that the blood lead test cannot be assumed to be the best and only metric of lead exposure that matters. A blood lead level reflects, for the most part, recent lead exposure  from environmental or occupational sources. Although lead in blood is also in equilibrium with bone lead stores, its variability mostly reflects changes in external exposure. Over the past 10 years or so, epidemiologic studies have generated growing and undeniable evidence that the most important standard for predicting some adverse health outcomes is not recent lead exposure; rather, it is cumulative lead exposure that occurs over many years, with or without the additional dimension of latency .The concept that cumulative lead exposure may be more important than recent lead exposure derives partly from animal studies demonstrating that the long-term administration of low doses of lead for varying lengths of time result in animals with similar blood lead levels but with levels of end-organ toxicity that are directly proportional to the varying cumulative doses [for recent examples of such studies with respect to kidney and brain toxicity, see in vivo measurement of lead in bone, which provide a direct biological metric for estimating retained cumulative lead dose in humans . If lead exposure is long-term , upon cessation the kinetics of clearance of lead from blood is considerably more complicated, with an initial rapid decline in levels reflecting partial clearance from blood and other soft tissues followed by a much slower clearance, reflecting the replenishment of soft-tissue pools of lead with lead from long-lived deposits in bone. Thus, as a biological marker of dose, blood lead levels can be a reflection of acute external exposure, internal bone lead stores released into blood, but, most commonly, a steady-state mixture of both external exposure and internal stores with almost no ability to distinguish between either.With respect to lead and bone, it has been well established from autopsy studies that the skeleton contains 90\u201395% of lead burden in adults and 80\u201395% in children . Roughlyin vivo techniques such as KXRF. In comparison, the much shorter half-time of lead in trabecular bone makes it somewhat less reliable as a dosimeter of cumulative lead dose, but it identifies trabecular bone as a measure that reflects a large pool of stored lead that may be more bioavailable than cortical bone lead  . In a nuin vivo KXRF have been reviewed previously  would be associated with a 1.74-times increase in the odds of hypertension regardless of the starting bone lead level . This moA potential limitation with interpreting CBLI and health effects is that many of the studies that have attempted to use CBLI have involved worker cohorts that had much higher BLLs in the past, but lower levels at the time data were collected and the cumulative lead dose  was calculated. Even though not all lead-exposed workers have had required BLL testing over time, it may be possible to extrapolate an approximate CBLI using available BLL results along with a careful occupational history to estimate the intensity and duration of lead exposure. For example, if a worker is exposed at the current OSHA-permissible exposure limit and permitted to have the maximum BLL (40 \u03bcg/dL) each year for a working lifetime (40 years), the estimated CBLI would equal 1,600 \u03bcg-years/dL, whereas a worker with a BLL of 20 \u03bcg/dL each year for 10 years would have a CBLI of about 200 \u03bcg-years/dL.Another point to consider when interpreting CBLI is that some of tibia lead (and blood lead) may derive from higher past environmental (nonwork) exposures. Older workers may have higher baseline bone lead levels from living at times when environmental exposures were higher. The population mean BLL was 13 \u03bcg/dL in the late 1970s . By the Thus, in this mini-monograph, we believe that epidemiologic studies that measured either tibia lead or CBLI have adequately estimated cumulative dose. The consistent relation between tibia lead and CBLI in validation studies clearly supports this conclusion.Epidemiologic research has evolved considerably in its thinking about study design and causality inference. Recent studies on lead toxicity have been more rigorous in their consideration of such important issues as selection bias, confounding, effect modification and other forms of interactions, and complex causal pathways. In the following sections we briefly review other issues of relevance to the interpretation of associations in epidemiologic studies that have relevance to the two systematic reviews in this mini-monograph .While studies of occupationally exposed populations provided initial data about the harmful effects of lead at high levels of exposure, environmental studies are much less troubled by the healthy worker effect, survivor cohorts, and other sources of bias inherent to occupational studies. Environmental studies also have the capacity to encompass much larger sample sizes with more socioeconomic and racial/ethnic diversity than occupational studies.These are important differences. In some cases, researchers conducting studies in subjects with high chronic occupational lead exposure have failed to observe the adverse impacts associated with lower levels of lead in environmental settings. For example, several studies of renal function in smelter workers have found no evidence of clinical renal dysfunction or changes in markers of tubular dysfunction compared with controls . SimilarThere are many potential explanations for null associations in occupational studies. Occupational studies tend to be based on small sample sizes, making them vulnerable to type II error. Some studies had nonexposed, or control, groups of workers with BLLs well above current background-exposure levels (< 5 \u03bcg/dL), which is likely to underestimate the effect being studied. Perhaps the most important problem is the vulnerability of occupational studies to the healthy worker effect, that is, the bias inherent in studying populations of workers who remain after the departure of sicker and/or more susceptible workers, especially problematic in cross-sectional studies of current workers. In studies that compare health effects in workers with general population controls, the healthy worker effect could explain why associations may not be observed, because workers are, especially for symptomatic conditions, more likely to be healthier than the general population. This problem is often manifested as an attenuation of exposure\u2013response curves in occupational studies at high exposure levels . If leadSuch selection bias can be mitigated in two ways. First, although more difficult, this bias could be avoided in occupational studies that assembled complete cohorts and randomly selected workers for study, including those who left the workplace early or late in their careers. Of interest is that studies that have assembled cohorts of all workers ever employed in a given plant or industry have reported many significant findings not previously observed . Second,In this mini-monograph, both occupational and environmental studies were chosen for inclusion in the systematic reviews . When evEnvironmental lead exposure differs by race/ethnicity and socioeconomic status. Persons with low socioeconomic status  have been known to have higher blood lead levels throughout at least the period of the recurrent National Health and Nutrition Examination Survey (NHANES) blood lead surveys . SeveralThe strong associations of cumulative lead dose with race/ethnicity and socioeconomic status raises methodologic concerns. Factors that in the past were simply termed \u201cconfounding variables\u201d are now more carefully evaluated as potential mediators , moderators , direct causes, or otherwise parts of complex causal pathways . It is nWhat are the implications of the fact that race/ethnicity and socioeconomic status may be causally related to cumulative lead dose? Although low socioeconomic status is associated with higher BLLs in population-based surveys, early life lead exposure has been shown to cause intellectual impairment and worse educational outcomes , which iA similar issue has been raised concerning race/ethnicity. To the extent that race/ethnicity serves as a proxy for other factors influenced by early lead exposure and also adversely affect cognitive function or cardiovascular outcomes , adjustiThus, it can be concluded that inclusion of race/ethnicity in models evaluating relations of cumulative lead dose and cognitive function or cardiovascular outcomes could lead to an underestimation of the direct effect of lead. Given these complex causal pathways, we believe relations of tibia lead and these outcomes are likely to be best estimated by parsimonious regression models that control for such variables as age, sex, and testing technician, for example, but not necessarily those that include race/ethnicity and socioeconomic status, which is at odds with what has been concluded by other authors  and withThe ideal solution to such a conundrum, although not often possible, would be to have separate measures of early-life and late-life lead exposures and/or direct measures of the underlying factors for which race/ethnicity is serving as a proxy  and possA number of important individual-level factors, in addition to race/ethnicity and socioeconomic status, are frequently considered in the body of literature on the health effects of lead. When comparing associations of health outcomes with blood and bone biomarkers, it is essential to recognize that factors such as age, sex, and elevated bone turnover accompanying osteoporosis  may modiAn increasing body of evidence suggests that lead is associated with a number of health conditions that are also causes of cognitive decline, including hypertension , elevateTwo important health behaviors\u2014tobacco and alcohol consumption\u2014have been linked with risk of cardiovascular and cognitive outcomes. This begs the question of whether it is critical to adjust for tobacco and alcohol consumption in evaluating relations of lead dose with cardiovascular and cognitive outcomes. The numerous studies of tobacco and alcohol consumption and its relations with cognitive function are conflicting , 2003. WAs another example, smoking is often included in models of hypertension, and its impact on blood pressure remains an important potential mechanism for its status as a risk factor for end-organ dysfunction . TobaccoTwo articles in this mini-monograph  are syst"}
+{"text": "Using multiple linear regression, we modeled CPT on the different measures of lead dose after adjusting for relevant covariates. CPT had a curvilinear relationship with TWA, with a minimum at a TWA of 28 \u03bcg/dL. Both TWA and IBL accounted for a significant percentage of the variance of CPT2000 . As the criterion blood lead level increased from IBL20 through IBL60, so did the percentage of CPT2000 variance explained, with \u0394R2 ranging from 5.8% (p < 0.03) for IBL20 to 23.3% (p < 0.00) for IBL60. IBL60 also significantly contributed to the explanation of variance of CPT250 and significantly interacted with ergonomic stressors. Measures of chronic blood lead exposure are associated with impairment of large and small myelinated sensory nerve fibers. This effect is enhanced at the highest doses by ergonomic stressors.In this study we investigated the effect of recent and chronic lead exposure, and its interaction with ergonomic stressors, on peripheral nerve function. In a cross-sectional design, we used retrospective exposure data on 74 primary lead smelter workers. We measured blood and bone lead levels and, from historical records, calculated lead dose metrics reflecting cumulative lead exposure: working-lifetime integrated blood lead (IBL) and working-lifetime weighted-average blood lead (TWA). We additionally created five metrics related to IBL that cumulated exposure only above increasing blood lead levels ranging from 20 to 60 \u03bcg/dL (IBL20\u2013IBL60). Current perception threshold (CPT) assessed large myelinated (CPT The classic description of lead neuropathy is that of a motor neuropathy that typically presents as wrist drop. More recently, investigators demonstrated that, in the development of lead neuropathy, sensory nerve fibers are affected earlier than motor nerve fibers , and nerIn evaluating peripheral nerve function, electrodiagnostic testing examines the integrity of only large myelinated nerve fibers with the fastest conduction velocities. Current perception threshold (CPT), a neuroselective test, measures sensory nerve conduction threshold in three nerve fiber populations\u2014large myelinated (A\u03b2), small myelinated (A\u03b4), and unmyelinated (C) nerve fibers. In peripheral neuropathies associated with a variety of medical conditions, CPT abnormalities have demonstrated good agreement with nerve conduction studies . AdditioIn the past, the usual biomarker used to study lead neuropathy was PbB, a blood lead measure of recent exposure . More reIn the older literature, lead poisoning presented as muscle paralysis, typically occurring in the muscles most used . In factWe report here on the use of CPT to examine different nerve fiber populations in the upper extremities of a group of current lead workers with substantial chronic lead exposure and a broad range of ergonomic stressors (ESs).A screening neuropsychological battery had been administered to 468 current and retired smelter workers by testers blinded to the degree of lead exposure of the worker. If performance on two or more tests in any functional domain was < 1.5 SDs compared with age-matched norms, the worker was invited for a complete clinical evaluation. Eighty current workers were identified by this criterion. As employees of a primary smelter , participants were routinely exposed to several sources of inorganic lead dust and, to a lesser extent, lead fumes. Since the smelter began operations in 1966, PbB levels of all employees have been checked at least quarterly. The frequency of PbB measurements depended on the relative degree of lead exposure of any given job and whether the employee had been relocated because of lead exposure. PbB levels precipitating relocation dropped from 90 \u03bcg/dL in 1966 to 75 \u03bcg/dL in 1974, 65 \u03bcg/dL in 1987, and 50 \u03bcg/dL in 1990. In general, the smelter workers in this study had chronic inorganic lead exposure that had been high in the distant past but lower in the more proximate past, with relatively low PbB levels at the time of this study.Blood samples for lead testing had been collected preshift by the facility nursing staff in the infirmary, a building physically distinct from the smelter, using standard techniques to minimize the likelihood of lead contamination of the samples. A local off-site laboratory using the dithizone method initially performed sample analysis. By the early 1970s, these analyses were conducted by a regional contract laboratory using graphite-furnace atomic-absorption spectrophotometry; this laboratory subsequently became a participant in the interlaboratory blood lead proficiency testing program of the then\u2013U.S. Centers for Disease Control. Results of this proficiency testing showed good agreement. For the purpose of this study, blood lead results from the two different laboratories were considered equivalent.We calculated the lead levels used to determine IBL, a measure of cumulative blood lead, as the sum\u2014over each participant\u2019s working lifetime\u2014of the products of each PbB level and one-half the time interval from the preceding blood lead to the following blood lead measure. TWA, the measure of average intensity of lead exposure over the period of employment, was created by dividing IBL by total years of employment at the smelter. To examine the effect of the amount of time a subject\u2019s blood lead concentration was above a criterion level, we also created a series of metrics\u2014IBL20, IBL30, IBL40, IBL50, IBL60\u2014calculated in the same manner as IBL but including only areas under the time\u2013blood lead curve that were above increasingly higher criterion blood lead levels; for example, IBL20 \u03bcg/dL was calculated by cumulating only that part of the area under the curve > 20 \u03bcg/dL . PbB wasAn ES rating was created with the assistance of the smelter safety committee, who reviewed all jobs ever worked by the participants and stratified them on a three-tiered ordinal scale. Using the method of CPT measures the minimum transcutaneous current intensity needed to produce a sensation . Because it uses a constant alternating current, there is no change in current intensity with variations in skin impedance. The sinusoidal waveform of the alternating current excites different subpopulations of nerve fibers as a function of frequency: 2,000 Hz, large myelinated fibers; 250 Hz, small myelinated fibers; and 5 Hz, small unmyelinated fibers.2000, CPT250, and CPT5.Electrodes were attached to the dorsolateral aspect of the fourth digit of the nondominant hand. CPT was initially approximated by the \u201cmethod of limits,\u201d where the current was increased until the worker reported a sensation . To more precisely ascertain threshold, the current was decremented and reincremented until a range was reached where a stimulus was correctly identified at one intensity and not at a slightly lower one for three consecutive trials. During this part of the testing, the stimulus presentation used a \u201cforced choice method\u201d paradigm with the presentation of a real and placebo stimuli. The procedure was repeated for all three frequencies at each site and are referred to in this article as CPTp < 0.001. One individual was missing ergonomic data, leaving 74 individuals for analysis. Those removed were not significantly different from the remaining sample on the independent variables or the covariates.Before the analyses, we examined age, current alcohol use, current smoking, ES, and the lead exposure metrics using univariate descriptive statistics to check for accuracy of data entry, missing values, and assumptions underlying multivariate analysis. Four individuals had values > 2.5 SDs above the mean of the CPT score and considered univariate outliers; one individual was identified through Mahalanobis distance as a multivariable outlier with a priori considerations  was used for data analyses. The determination of covariates was based on risk factors associated with the development of a peripheral neuropathy. These included age, dichotomous current smoking, dichotomous current alcohol use, and working-lifetime weighted-average ES. Other medical conditions commonly associated with peripheral neuropathy were not present. The three CPT measures were modeled using multiple linear regression with the measures of lead dose, PbB, TWA, IBL, IBL20, IBL30, IBL40, IBL50, IBL60, and PbBn after adjusting for the covariates. Additionally, on the basis of erations , we modeDemographic data for the 74 workers included in the analyses are presented in 2000, after adjusting for the covariates. IBL explained 3.9% of the variation in CPT2000 (p < 0.08). Regression diagnostics revealed nonlinearity in the relationship between TWA and CPT2000, which was addressed by including a quadratic term in the model. Combined, the TWA and TWA2 terms accounted for 8.7% of the variation in CPT2000 (p < 0.03). The calculated minimum for the quadratic relationship for TWA and CPT2000 was 28 \u03bcg/dL (28 \u03bcg/dL .n = 74), 30 \u03bcg/dL (n = 73), 40 \u03bcg/dL (n = 70), 50 \u03bcg/dL (n = 68), and 60 \u03bcg/dL (n = 61). The different sample sizes at each level reflect workers who did not have PbB that reached the required level. In 2000 variance explained, with \u0394R2 ranging from 5.8% (p < 0.03) for IBL20 to 23.3% (p < 0.00) for IBL60. Only IBL60 accounted for a significant amount of variance of CPT250, reflecting increased nerve damage with time spent at PbB > 60 \u03bcg/dL. Despite diminished power with IBL60 due to a smaller sample size, the dose effect remained significant.To examine the contribution to CPT by exposure above different blood lead levels, we stratified IBL by the cumulative time a subject\u2019s PbB was above different criterion levels\u2014IBL above a PbB level of 20 \u03bcg/dL  to IBL60 \u00d7 ES . The interaction is shown in To address the interaction of motor activity and lead toxicity on the peripheral nerves, we tested interaction terms created by multiplying the IBL variables based on the increased criterion blood lead levels \u00d7 ES with multiple linear regression, controlling for the covariates and base terms. The strength of association of the interaction term with CPTIn this group of lead-exposed workers, IBL and TWA, two measures of chronic lead exposure, were significantly related to decrements in peripheral nerve function as measured by CPT, whereas PbBn and PbB were not. PbBn, with a half-life of 17\u201325 years, is a measure of lead stored in the bone compartment and is not a consistent biomarker of lead effect in the nervous system . Also, PR2 for IBL = 3.9% (p < 0.08) to \u0394R2 for IBL20 = 5.8% (p < 0.03). One possible explanation is that blood lead levels less relevant to the outcome were removed. This would result in improved precision of measurement due to a decreased nondifferential exposure misclassification.The strength of IBL as a measure of cumulative exposure improved when the amount of time at lower blood lead levels was not included in the exposure term. This resulted in an increased strength of the linear model from \u03942000 is consistent with this hypothesis.IBL is a term composed of duration and intensity of exposure; however, the mean duration of lead exposure in the literature reporting significant association between IBL and peripheral nerve conduction parameters varies from 2.5 years , to 5.3 As reported by 2000) and small (CPT250) myelinated nerve fibers, a biologically plausible finding.CPT for large myelinated fibers showed that these were the primary nerve fibers affected by lead exposure. Vibration perception thresholds also carried by large myelinated fibers is associated with chronic lead exposure . These fLead affects the upper extremities more frequently than the lower extremities . Dermal Another possible explanation for the interaction of lead and active motor units is that nerves affected by lead are more susceptible to traction or mechanical compression, as would occur in the carpal tunnel of workers with exposure to ESs such as heavy lifting and shoveling. This interaction between a peripheral neuropathy and a focal entrapment neuropathy exists in patients with diabetes , GuillaiThe ability to infer a causal relationship between lead exposure and peripheral nerve function is limited in a cross-sectional study. IBL and TWA were based on blood lead levels obtained over the working lifetime of the participants, thus increasing the likelihood of any causal inferences made.In this population of lead smelter workers, nerve function as measured by CPT is associated with impairment in large and small myelinated sensory nerve fibers with a threshold effect at a TWA of 28 \u03bcg/dL. Peripheral nerve impairment is associated with markers of chronic lead exposure, TWA and IBL, but not PbBn, and may be present when recent PbB is at an acceptable concentration. Even with chronic lead exposure, intensity is more important than duration of exposure. At higher levels of lead exposure, nerve fibers affected by lead are more susceptible to the presence of more active motor units as reflected by ESs."}
+{"text": "Much of the practice and research concerning lead poisoning is based on the belief that the most damage is done by that peak. However, lead\u2019s effects on IQ cannot be detected until about 4 or 5 years of age, when IQ becomes testable. Thus, researchers assume, if we wish to know the lowest level at which lead causes damage, we have to measure blood lead in 2-year-olds and follow them, and if we wish to prevent lead toxicity from occurring, we should focus on 2-year-olds. Both assumptions, and the outcomes they encourage, may be incorrect, concludes a U.S. research team after analyzing data from a study that began in 1994 The Treatment of Lead-Exposed Children study was initially designed to evaluate whether a drug called succimer, which lowers blood lead, would reduce or prevent the effects of lead on IQ. The 780 participating children, selected in approximately equal numbers from clinical centers in Baltimore, Cincinnati, Newark, and Philadelphia, were regularly tested for blood lead concentration and given IQ tests from about age 2 years to about age 7.5 years. About half the children had taken succimer, while the others had taken a placebo. The drug lowered the children\u2019s blood lead concentrations, but the group given succimer did no better on IQ tests than the group given placebo.In the current study, researchers used the earlier data to evaluate the strength of the association between IQ and blood lead at various ages, and whether blood lead at age 2 years affected IQ at ages 5 and 7 more than blood lead measured at the older ages. The team examined blood lead and intelligence data from ages 2, 5, and 7, as well as many other factors, such as race, sex, language spoken, caregiver\u2019s IQ, and parent\u2019s education, employment, and status as a single parent.Contrary to most current thinking, which assumes that blood lead concentration at age 2 is the best predictor of IQ at ages 5 and 7, this team found that concurrent blood lead concentration had the strongest association with IQ, and the older the child, the stronger the association. This was true even though blood lead concentrations dropped progressively as the children aged. A few other studies had found somewhat similar results, but the researchers say the size of this study and the quality of its data reinforce the strength of the findings.This study does have some drawbacks. For instance, the investigators had no data reflecting how much caregivers interacted with and stimulated the children, which can influence a child\u2019s intelligence. In addition, the children selected for the original study weren\u2019t representative of the population as a whole. For instance, their initial blood lead concentrations were higher than those of most U.S. children today, 77% of the children were black, 97% were receiving public assistance, and 72% lived in single-parent households.Nonetheless, the team concludes that ongoing lead contamination has a significant effect on a child\u2019s intelligence, emphasizing the importance of testing for and reducing lead contamination in the environment of children much older than typically targeted. They also say the findings, if they hold up and are accepted, would relax an important limitation on lead studies, allowing future efforts to include subjects who were not tested for lead at age 2."}
+{"text": "Lead exposure and psychological stress have been independently associated with hypertension in various populations, and animal studies suggest that when they co-occur, their effects may be exacerbated.We examined whether psychological stress modifies the impact of cumulative lead exposure (measured as bone lead levels) on hypertension and blood pressure in Boston-area community\u2013exposed men participating in the Normative Aging Study.We evaluated the modifying effect of stress on lead exposure on baseline hypertension status (513 participants) and on blood pressure in those without hypertension (237 participants), cross-sectionally. In baseline nonhypertensives, we examined the same risk factors in relation to prospective risk of developing hypertension.Cross-sectional analysis revealed a positive interaction between stress and tibia lead on systolic blood pressure, after adjusting for age, body mass index, family history of high blood pressure, education, smoking, alcohol consumption, physical activity, and nutritional factors. In prospective multivariate analyses, high stress also modified the effect of tibia lead and patella lead on the risk of developing hypertension. Those reporting high stress had 2.66  times the risk of developing hypertension per standard deviation increase in tibia lead and had 2.64  times the risk per standard deviation increase in patella lead.To our knowledge, these are the first analyses to look at interactive effects of stress and lead on hypertension in humans. These results suggest that the effect of lead on hypertension is most pronounced among highly stressed individuals, independent of demographic and behavioral risk factors. Hypertension or high blood pressure affects approximately one-third of the U.S. adult population  and is aPrevious studies have shown an association between biological markers of lead exposure and elevated blood pressure. Many of the studies that used blood lead levels (which reflect mostly recent exposure) showed stable effect estimates but inconsistent associations with blood pressure ; howeverPsychological stress can be defined as a response to life events (stressors) that are perceived or appraised as taxing the individual\u2019s ability to cope with the demands imposed. An individual\u2019s perception of a situation as stressful is a pivotal component in the process whereby a stressor affects health . PreviouThe mechanism by which self-reported stress and lead jointly contribute to hypertension is not well understood. Exposure to low levels of lead seems to cause interference with sodium transport, affect the renin\u2013angiotensin\u2013aldosterone system, stimulate the hypothalamic\u2013pituitary axis, increase sympathetic activity and catecholamines, and elevate the level of reactive oxygen species e.g., . Stress An interactive effect between psychological stress and lead on blood pressure has been demonstrated in animal studies, where lead exposure was shown not only to produce a stress reaction , 1991b bWe hypothesized that older men reporting high stress would have a steeper dose response to the effect of bone lead on baseline hypertension status and blood pressure and on subsequent risk of developing hypertension compared with subjects reporting low stress. To test these hypotheses, we evaluated interactions between stress perception and bone lead on baseline hypertension status, systolic blood pressure (SBP), and diastolic blood pressure (DBP) cross-sectionally, and on incidence of hypertension prospectively, in a sample of community-dwelling older men from the Normative Aging Study (NAS).This research was conducted on a subgroup of the participants in the NAS, a longitudinal study of aging established in 1963 by the Veterans Administration (now the Department of Veterans Affairs). The cohort and subgroup of participants used in this research have been described elsewhere . Brieflya) hypertensive status and blood pressure (in a subset without hypertension) at the time of the first bone lead measurement (baseline exam), and b) development of hypertension in subjects without hypertension at baseline. For the latter, we used a follow-up period through 31 December 2004.Between 1991 and 1996, 797 participants had bone lead content measured by KXRF. Participants were also given a series of questionnaires including questions about stress perception between 1987 and 1993. KXRF and questionnaire measurements were matched for the same year; however, if no questionnaire measurement was available for that year, the questionnaire data in the evaluation cycle up to 3 years before were used. For this study, we defined hypertension as diagnosis of hypertension with treatment by the participant\u2019s regular physician or SBP > 140 mmHg or DBP > 90 mmHg during the study clinic examination. We used two sets of outcomes: This study complied with all applicable requirements of the U.S. regulations, including institutional review board approval and written informed consent from all participants before administering study protocol. This study was approved by the Human Research Committees of Brigham and Women\u2019s Hospital and the Department of Veterans Affairs Boston Medical Center.To assess participant stress perception, we administered the Health and Social Behavior Questionnaire . To anchr = 0.21; p < 0.01), the anxiety subscale , depression subscale , and PSS .Evidence of the validity of this measure can be found in a recent study of stress and coping, where this single item measure of stress was found to be positively associated with a sense of threat and negative affect, and negatively associated with a sense of challenge and positive affect . To furtWe measured bone lead for 30 min each at the mid-tibia shaft and patella using a KXRF instrument . The tibia and patella have been used for bone lead research because they consist primarily of cortical and trabecular bone, respectively, with differing toxicity potential for each. Technical specifications and validity of this instrument are described in detail elsewhere , 1994.a) baseline hypertension status, b) baseline SBP and DBP in nonhypertensives  and c) the risk of developing hypertension (prospective model among participants not hypertensive at baseline).The main objectives of this study were to evaluate whether stress affects the relationship between bone lead and Tibia and patella bone lead measurements with estimated uncertainties > 10 and 15 \u03bcg/g of bone, respectively, were excluded as part of our laboratory\u2019s quality control procedures . In thisWe used logistic regression (dichotomous hypertension outcome) and linear models (continuous blood pressure outcomes) to evaluate the interactive effect of perceived stress and bone lead at baseline. Covariates were chosen based on biology, other studies, and potential mediating effects and included age and age squared ; sodium,p-value < 0.05 was considered significant and < 0.10 marginally significant.We used Cox proportional hazards models to assess the interaction of stress and bone lead on hypertension risk prospectively. The same confounders were included in the Cox proportional hazards models as in the cross-sectional models. We also tested the models to determine whether they satisfied the assumption of proportionality. The follow-up period was until a participant developed hypertension or 2004, whichever came first. All analyses were conducted using the Statistical Analysis System . A Of the initial group of 791 participants with valid bone lead measurement, 513 also completed the stress measures. Compared with those for whom stress was not assessed, those with stress assessment did not differ on age; BMI; family history of hypertension; alcohol consumption; pack-years of smoking; physical activity; sodium, potassium, calcium, and vitamin D intake; and DBP. Those without stress assessment had higher SBP and lower anxiety and educational level. The groups were comparable with respect to tibia and patella lead levels. The mean (\u00b1 SD) age of the 513 participants was 66.9 \u00b1 7.1 years. Mean blood pressure measures were, for SBP, 135 \u00b1 17.0 mmHg, and for DBP, 81 \u00b1 9.6 mmHg. Mean tibia lead was 21.5 \u00b1 13.4 \u03bcg/g, and mean patella lead 31.5 \u00b1 19.3 \u03bcg/g.Of these 513 participants with both valid bone lead measurements and stress assessment, 276 had hypertension and 237 did not. When we controlled for confounders, neither the main effects of self-reported stress and bone lead (tibia lead or patella lead) nor the interactive terms of self-reported stress by bone lead were significant predictors of baseline hypertension status . BMI, faIn the main effect models, controlling for confounders, self-reported stress was marginally significantly predictive  of SBP. In the adjusted tibia lead interaction model, self-reported stress was a marginally significant predictor of SBP, with those with high self-reported stress having an estimated increase in SBP of 2.89 mmHg  . There wIn the adjusted patella lead interaction model, self-reported stress was a marginally significant predictor of SBP, with those with high stress having an estimated increased SBP of 2.98 mmHg  . There wTo take better advantage of the information in the measure, we also examined the above relationships using the continuous form of the stress measure. Results were similar but of greater magnitude. In the main effect model, self-reported stress was significantly associated with systolic blood pressure , in addition to being significant in the models with tibia and patella lead. The interaction with tibia lead on systolic blood pressure was also significant .Among the 237 subjects without hypertension but with reported stress perception, there were follow-up data for 220 men. The average years of follow-up was 6.2 \u00b1 3.2 years, ranging between 2.5 and 13.0 years. Of the 220, 97 new cases of hypertension were observed during the follow-up period. In the longitudinal models, all the variables were found to be proportional.We examined cross-sectional and prospective effects of self-reported stress on the relationship between bone lead and hypertension. Our findings indicate that in this population of older men, bone lead is more likely to be associated with elevated SBP and with increased risk of developing hypertension among men with higher levels of self-reported stress than among those reporting lower stress levels. This lead\u2013stress interaction is intriguing and consistent with findings in the animal literature, but to our knowledge this is the first time it has been reported in a human population.Previous research has found separate relationships between stress and hypertension and lead and hypertension, but our research is among the first to suggest that they may jointly have specific and detrimental effects on cardiovascular health. Stress is suspected to modify the relationship between other environmental pollutants as well, and health outcomes such as atopic disease and ulcer . For exaFindings of a link among self-reported stress, lead, and SBP are particularly interesting given that SBP is directly and continuously related to the risk of stroke or coronary event, and is often included in algorithms developed for predicting the occurrence of cardiovascular disease. An effect of lead and stress was not seen on DBP, consistent with other literature that found effects of stress and of lead on only SBP e.g., . One reaWe found no interactive effect between stress and bone lead in relation to whether a participant was hypertensive at baseline. Similar to other work, our definition of hypertension included both those who had doctor-diagnosed hypertension and those who were grouped as hypertensive based on high SBP or DBP during physical examination. Diagnosed hypertension means that participants are being treated and as a result may be changing behaviors and engaging in stress management. In this case, they may appear to have the same stress levels as those who are not hypertensive, making it difficult to see an effect of stress on prevalent hypertension.For both patella and tibia lead, we observed the trend of higher blood pressure in the higher stress group; however, this relationship was significant only with tibia lead. Tibia lead is made up mostly of cortical bone and has slower turnover than patella bone, which is made up mostly of trabecular bone . The difRegulatory and legislative efforts to reduce lead hazard in the United States beginning in the 1970s have resulted in a continued decline in blood lead in the adult population (approximately an 87% decrease between 1976\u20131980 and 1999\u20132002) . HoweverOur results demonstrating an interactive relationship may be confounded by a neurologic effect of lead exposure on mood states and also stress perception (with more negative moods contributing to higher levels of perceived stress). In a study of occupationally exposed patients, integrated blood lead (which was used in the study as a measure of cumulative lead exposure) was related to general distress . AnotherSignificant relationships were observed controlling for a number of potential confounders: age, BMI, family history of hypertension, pack-years of smoking, alcohol consumption, physical activity, and nutritional factors; however, residual confounding remains possible, and other important variables may not have been considered. Furthermore, this study may have limited generalizability, being a male cohort that was 97% white with slightly higher than median income. Because lead exposure and stress appear to co-occur with low socioeconomic status, these findings may have greater import in these latter populations . PreviouIn conclusion, self-reported stress was found to modify the effect of lead on blood pressure and incident hypertension in a community sample of older men. Compared with those with lower levels of self-reported stress, among men with higher levels, there was a significantly stronger association between lead levels and SBP. Additionally, in prospective analysis, baseline self-reported stress modified the effect of baseline bone lead on the incidence of hypertension. With an increase in the prevalence of hypertension, the aging of generations with high community lead exposure and the potentially deleterious effect of hypertension on cardiovascular health, these findings may point to intervention strategies that can reduce the effects of lead on hypertension. Additional studies are needed to confirm these findings in similar and more diverse populations and to assess interactions between environmental and psychosocial factors on other cardiovascular-related outcomes."}
+{"text": "EHP 115:1242\u20131247; Miranda et al.][. The results show that blood lead levels far lower than 10 \u03bcg/dL in early childhood correlate with lower educational achievement in elementary school as measured by performance on end-of-grade (EOG) tests.Low-level lead exposure has been linked to decreased aptitude\u2014or ability to learn\u2014on standardized IQ tests for school-aged children. Moreover, research studies have suggested that declines in aptitude occur at blood lead levels below the current CDC blood lead action level of 10 \u03bcg/dL. Now a team of scientists has studied how lead exposure affects educational achievement\u2014how well children have mastered material taught in school Data for the study came from two large databases generated by two different offices of the State of North Carolina for the same population but at different time periods. Blood surveillance data were provided by a state registry for seven adjacent North Carolina counties. The scientists used screening data from 1995 through 1998 for 35,815 children. For children who were screened more than once, the researchers used the highest blood lead level recorded. During this period, an estimated 21.9\u201330.4% of North Carolina children aged 1 and 2 years were screened for lead.The North Carolina Education Research Data Center provided educational testing data from 2000\u20132004 for fourth-grade students in the seven-county study region. In North Carolina, each child in grades 3 through 8 takes a multiple-choice EOG test in reading and mathematics.The researchers linked the two separate data sets to locate records of children who had been screened for lead and had also taken at least one EOG test. To ensure accuracy, the researchers used 16 different combinations of identifiers, including Social Security numbers, date of birth, the county\u2019s Federal Information Processing Standards code, and first and last name. This process linked 42.2% of screened children to at least one EOG record.The scientists found a strong dose\u2013response effect between early childhood lead exposure and performance on elementary school achievement tests. Childhood blood lead levels as low as 2 \u03bcg/dL at age 1 or 2 years had a discernible correlation with deficits in later EOG testing. A blood lead level of 4 \u03bcg/dL was associated with a significant decline in EOG reading and math scores, with an impact nearly equal to that of participating in the free or reduced lunch program, the classic poverty indicator in school data. The researchers want to follow the same children through their elementary, middle school, and high school years to assess the persistence of the effects found in this study."}
+{"text": "EHP 115:201\u2013209; Stangle et al.][. The Cornell University study is thought to be the first to show that chelation can alleviate cognitive deficits caused by lead exposure. That finding contradicts the most comprehensive chelation study to date, in which scientists at the NIEHS found no cognitive benefits of the therapy.Clinicians for years have used chelation to treat lead poisoning without knowing whether it prevented cognitive impairment in lead-exposed children. A recent study of chelation therapy now brings new hope to parents of children exposed to lead Chelation\u2019s known effect is to cause lead and other metals to be removed quickly from the blood and excreted in urine and feces. The treatment originally was used to prevent death from toxic exposures. Today, though, with the phaseout of leaded gasoline, solders, and paint, nonoccupational exposures are at much lower levels, and typically come from lead-bearing paint and dust in old houses.In young children, however, even low lead levels can cause learning disabilities, attention difficulties, and antisocial behavior. Clinicians use chelation in children to minimize that risk, despite uncertainties about its effects in this regard. Treatment is recommended by the CDC if the child\u2019s blood lead level exceeds 45 \u03bcg/dL. Yet a CDC survey showed many children are treated for levels as low as 10 \u03bcg/dL.The Cornell researchers tested the commonly used chelation drug succimer on juvenile rats fed lead doses that simulated moderate and high childhood exposures. For the lead-exposed rats, chelation was linked with an effective lessening of problems in cognition and emotionality, with a more complete normalization of behavior seen in the moderately exposed rats. An unexpected finding was that rats not exposed to lead but treated with succimer showed cognitive deficits similar to those of untreated rats with high lead levels during early development.The authors believe that succimer might similarly improve cognition in lead-exposed children if a regimen could be identified that sufficiently reduces brain lead. Succimer\u2019s reduction of brain lead lags behind its effect on blood lead. The authors suggest that the failure of the NIEHS study to show any cognitive benefits of succimer may reflect the small reduction in blood lead\u2014and even smaller reduction in brain lead\u2014achieved by the treatment relative to placebo.The Cornell team could not explain why succimer produced lasting adverse effects in rats not exposed to lead, but speculated it might be related to the drug\u2019s effect on essential metals such as iron and zinc, which are necessary for proper brain development. Their finding led them to warn against using chelation in children who do not have elevated tissue levels of lead or other heavy metals."}
+{"text": "The objective of this study was to evaluate the relations between bone mineral density (BMD) and lead in blood, tibia, and patella and to investigate how BMD modifies these lead biomarkers in older women.In this study, we used cross-sectional analysis.We studied 112 women, 50\u201370 years of age, including both whites and African Americans, residing in Baltimore, Maryland.109Cd-induced K-shell X-ray fluorescence, respectively. We measured vitamin D receptor and apolipoprotein E (APOE) genotypes using standard methods.We measured lumbar spine BMD, blood and bone lead by dual energy X-ray absorptiometry, anodic stripping voltammetry, and 2, 3.3 \u00b1 2.2 \u03bcg/dL, 19.7 \u00b1 13.2 \u03bcg/g, and 5.7 \u00b1 15.3 \u03bcg/g, respectively. In adjusted analysis, higher BMD was associated with higher tibia lead levels (p = 0.03). BMD was not associated with lead levels in blood or patella. There was evidence of significant effect modification by BMD on relations of physical activity with blood lead levels and by APOE genotype on relations of BMD with tibia lead levels. There was no evidence that BMD modified relations between tibia lead or patella lead and blood lead levels.Mean (\u00b1 SD) BMD and lead levels in blood, tibia, and patella were 1.02 \u00b1 0.16 g/cmWe believe that BMD represents the capacity of bone that can store lead, by substitution for calcium, and thus the findings may have relevance for effect-size estimates in persons with higher BMD.The results have implications for changes in lead kinetics with aging, and thus the related risk of health effects associated with substantial early- and midlife lead exposure in older persons. Skeletal lead represents approximately 90\u201395% of an adult\u2019s current body burden of lead ; becauseAfter menopause, the rate of bone loss increases up to fourfold on average, from 0.5 to 1% annually before menopause to 2\u20133% annually after menopause . These r3, which regulate the levels of serum calcium and bone metabolism   and negaVDR) and apolipoprotein E (APOE)  . Previoural loss . In addigenotype . To dateIn this study, we evaluated associations between BMD and lead in blood, tibia, and patella, as well as effect modification by BMD on relations among lead in these three pools, in community-dwelling urban women in Baltimore, Maryland, 50\u201370 years of age with diversity by race/ethnicity. We also evaluated effect modification of these relations by the two polymorphic genes.VDR genotype (by the Fok1 restriction enzyme) to ensure that we had approximately similar numbers of subjects in each race/ ethnicity and VDR Fok1 genotype category. Selected subjects were then contacted by phone to ascertain their interest in participating in this substudy. We telephoned each subject until we had established a disposition after a maximum of 10 attempts. A total of 290 women were contacted, and 112 agreed to participate and completed BMD measurement, a sample size based on a balance of statistical power and budgetary considerations; 42 had BMD measurement at the Johns Hopkins Outpatient Center and 70 at the Johns Hopkins Bayview Medical Center. There were no differences in levels of lead in blood, tibia, or patella, age, the physical activity measures, menopausal status, or race/ethnicity between those who were contacted and did (n = 112) or did not (n = 178) participate for the BMD substudy . All participants provided written informed consent at the beginning of the visit and were paid $25 for their participation in the BMD substudy. The Committee for Human Research at the Johns Hopkins Bloomberg School of Public Health reviewed and approved the study.Study participants represented a subsample of women who completed the third visit (from September 2004 through May 2005) of the longitudinal Baltimore Memory Study. Study population, selection, and recruitment for this study have been previously reported . Women wp-values by chi-square or analysis of variance > 0.05). At each study visit, data were collected in the following order: neurobehavioral testing, blood pressure, height, weight, spot urine collection, structured interview, and a 10-mL blood specimen by venipuncture. Lead in bone was measured by X-ray fluorescence (XRF) during the structured interview.Data collection methods have been previously reported . In brieWe used data from all three visits in the cross-sectional analysis reported here. Data obtained from the first visit included demographics, self-reported menopausal status, medications (including hormone replacement therapy), smoking history, alcohol consumption, blood lead levels, and genotypes. Data obtained from the second visit included tibia lead levels, dietary intake using the Block 98.2 Dietary Questionnaire , and physical activity using the Yale Physical Activity Survey (YPAS), a valid and reliable 43-item self-report instrument designed for epidemiologic studies of older adults . We usedin vivo  and a t-score .We measured BMD at the lumbar spine (L1\u2013L4) by the dual energy X-ray absorptiometry (DEXA) technique. We used a Hologic QDR-4500A elite fan beam bone densitometer with a motorized table and C-arm  located at the Division of Nuclear Medicine, Department of Radiology, at the Johns Hopkins Outpatient Center, and at the Beacham Osteoporosis Center at the Johns Hopkins Bayview Medical Center. Subjects were placed in the supine position on a table and scanned in the antero-posterior projection with a 15-sec measurement. The accuracy error of assessing BMD by DEXA is < 5%, and the precision error is < 1% in vivo . BMD was109Cd-based K-shell XRF , by previously reported methods (We measured blood lead with anodic stripping voltammetry (in micrograms per deciliter) as previously reported . As an ihell XRF . Studieshell XRF  and relihell XRF , 2001 te methods .APOE and VDR polymorphisms. Finally, we aimed to examine effect modification by BMD on the relations of important predictor variables thought to be relevant to bone mineral and bone lead kinetics  with the three lead biomarkers.The primary goals of this cross-sectional analysis were as follows: First, we aimed to evaluate associations of the three lead biomarkers with BMD to understand how lead in bone and blood may influence BMD, and vice versa. Because there are strong biologic rationales for evaluating the directionality of the relations between BMD and tibia lead in both directions , we created models to do so. Although the analysis was cross-sectional, we believe that hypotheses can be generated about the likely causal direction because of the different timing of lead biomarker and BMD measurement and the fact that deposition of lead in bone is likely to reflect a much longer time period than are changes in BMD. Second, we aimed to examine whether these relations were modified by the Because of departures from the normality assumption, blood lead was natural logarithm (ln) transformed before regressing on covariates; the adequacy of this transformation was confirmed by examination of the distributions of the residuals of the final regression models. In the presentation of results, we back-transformed regression coefficients from the analysis of ln-transformed concentrations to facilitate interpretation of results in the original blood lead measurement scale. The resulting coefficients estimate ratios of median concentrations comparing across predictor levels.yi = Xi\u03b2= \u03b5i, where \u03b5i ~ N, but for which we have only observed yi = max. The TOBIT model uses maximum likelihood for estimation. To evaluate whether our results were sensitive to the modeling method, we compared the results from TOBIT models to those from multiple linear regression. The associations and our conclusions were similar (data not shown).Because XRF measurement of bone lead concentration can, due to measurement uncertainty, produce negative point estimates when the true bone lead concentration is close to zero, in our analysis, we kept all point estimates  of bone lead concentrations, which yields less bias and more efficient comparisons . Negativt-score of zero. We first performed univariate analyses by BMD group to compare lead biomarkers, subject characteristics, and covariates in women with high and low BMD. We used t-tests and analysis of variance to evaluate the statistical significance of the differences of mean lead biomarkers and covariates by BMD group and genotypes. We used multiple linear regression to control for covariates and evaluate potential confounding on the associations between BMD and the three lead biomarkers.We used statistical software programs of the STATA Corporation . To describe differences in lead levels and selected subject characteristics by BMD levels and to model effect modification by BMD on the relations between lead biomarkers and their predictors, we dichotomized BMD into high and low groups at a BMD a) known to be important based on prior studies, b) a significant predictor (p < 0.05) of lead biomarkers, c) a confounder (based on a 10% change in regression coefficients), or d) an effect modifier of the relations of interest. The final regression model was used for exploratory analysis of effect modification, by inclusion of cross-product terms for testing of specific effect modification hypotheses, one at a time.Covariates that were examined included weight, height, body mass index , tobacco and alcohol consumption, medications , and lifestyle and other risk factors for bone mineral loss . A variable was retained in the final models if it was p < 0.05).We performed regression diagnostics, including examination of distributions, residuals, partial residual plots, and variance inflation factors, to evaluate the assumptions of linear regression . We also evaluated potential nonlinearity by inclusion of quadratic terms in the linear regression models , 38 (33.9%), and 33 (29.5%) of the VDR Fok1, FF, Ff, and ff genotypes, respectively. There were no differences  in levels of lead in blood, tibia, or patella, or in age, physical activity measures, race/ethnicity, hormone replacement therapy use, menopausal status, or APOE genotype among women who did and did not participate in the BMD substudy  of the participants was 59.7 \u00b1 5.7 years at enrollment; 83% were postmenopausal, 14% pre-menopausal, and 3% suspected they were perimenopausal. The stratified random selection of study subjects by substudy .2, 3.3 \u00b1 2.2 \u03bcg/dL, 19.7 \u00b1 13.2 \u03bcg/g, and 5.7 \u00b1 15.3 \u03bcg/g, respectively. There was no difference in mean BMD levels between the testing site of measurements [p > 0.05 for comparing measurements at the Johns Hopkins Outpatient Center (mean = 1.034 \u00b1 0.025 g/cm2) with those at the Johns Hopkins Bayview Medical Center (mean = 1.027 \u00b1 0.018 g/cm2)]. The prevalences of the APOE \u03b54 allele and the VDR Bsm1 BB genotype were 26.8% and 11.6%, respectively. There were differences by BMD group in the mean of the Yale energy index, and in the prevalence of the APOE \u03b54 allele and the use of HRT   . Even th < 0.05) , the difp > 0.10). However, in the adjusted analysis of BMD levels, higher tibia lead was associated with higher BMD levels, whereas the APOE \u03b54 allele was associated with lower BMD levels  and 0.057 g/cm2 lower for subjects with the \u03b54 allele than subjects without the allele (p = 0.05) . We did not observe any associations of VDR genotypes with BMD levels or effect modification by VDR genotypes on relations between the three lead biomarkers and BMD.In crude analysis, blood, tibia, and patella lead levels were not associated with BMD levels  , model 1with BMD , model 2p < 0.01). There was no evidence of effect modification by BMD on the relations of patella lead or tibia lead with blood lead levels ; tibia lead levels were 0.01 \u03bcg/g higher for every 1 mg/cm2 increase in BMD . In the low BMD group, women with the \u03b54 allele had tibia lead levels that were 6.2 \u03bcg/g higher compared with those without the allele, but in the high BMD group, women with the allele had tibia lead levels that were 9.9 \u03bcg/g lower compared with those without the allele . There was also no evidence that BMD modified relations of important predictor variables with patella lead levels (data not shown).APOE genotype modified associations of sex with patella lead levels. Finally, women had significantly lower blood and patella lead levels than did men. As many of these associations could be explained by the kinetics of lead in bone or bone mineral, further investigation required that we measure BMD. Because bone demineralization with increasing age is much greater in women, we decided to optimize the study design by limiting BMD measurement to a random sample of 112 women, stratified by selected genotypes and race/ethnicity. Although there were interesting race/ethnic differences in analysis of the complete sample, we found no consistent race/ethnic associations in the BMD subsample. Our ability to evaluate whether race/ethnicity modified relations of menopausal status with BMD or lead biomarkers was limited by the limited variation in menopausal status. We found no evidence that race/ethnicity modified relations of age, physical activity, or other predictor variables with lead biomarkers or BMD.In an earlier report that included the entire sample of > 900 adults in the Baltimore Memory Study who completed both tibia and patella lead measurements , we made several observations that motivated us to measure BMD in a sub-sample of women. For example, we found that African Americans had significantly higher tibia lead levels than did whites  , but no difference in patella lead levels. Higher tibia and patella lead levels were both associated with increasing age. Use of HRT and greater physical activity were both independently associated with lower blood lead levels, probably because there was less release of lead from bone with demineralization . APOE geIn the adjusted analysis, we found that higher tibia lead levels were associated with higher BMD. However, BMD was measured at the lumbar spine (L1\u2013L4), which consists of more than 66% trabecular bone , whereasWe considered three other potential explanations for the association of BMD with tibia lead. First, lead in bone may interfere with BMD measurement, resulting in spuriously high BMD estimates. Second, lead may be toxic to osteoblasts, osteoclasts, or both, influencing the biology of bone and thus mineral deposition and mobilization. Finally, bone with higher mineral content may have more binding and deposition sites for lead, so bone with higher density simply allows more deposition sites for lead.10(PO4)6(OH)2] in bone tissue may result in a spurious increase in bone density when measured by DEXA because lead has a higher atomic number and attenuation coefficient than does calcium. This may in turn increase the attenuation of photons by the presence of lead in bone   . Lead ma3) , and, similarly, BMD modified relations of APOE genotype with tibia lead (with tibia lead as the dependent variable). Taken together, these data imply that the \u03b54 allele was associated with lead loss that exceeded bone mineral loss in women with higher BMDs and that lead in bone does not lead to spurious elevations in BMD measurement .As expected, we found that er rates . In addiAlthough we did not find that BMD modified the relations of tibia or patella lead with blood lead levels, we observed that BMD modified the relation of the Yale total energy index with blood lead levels. Higher total energy expenditure might be a risk factor for bone mineral loss in women with lower BMDs. Therefore, this may result in increased release of lead from bone back to blood in women with lower BMDs but may stabilize highly active bone such as patella from releasing lead back to blood in women with higher BMDs.This study has several strengths. First, there was diversity by race/ethnicity and the inclusion of important genotypes, allowing us to evaluate relations of these important predictor variables with both lead biomarkers and BMD. Our sample size was > 50% larger than the only other study of the relation between tibia lead and BMD . FinallyAPOE and physical activity could have important influences on the kinetics of internal stores of lead.We conclude that our data provide, to our knowledge, the first direct epidemiologic evidence that BMD may influence the deposition and kinetics of lead in bone. The findings suggest that the health effects of lead may be underestimated (but probably only slightly) for subjects with higher bone mineral densities. In addition, factors that alter bone turnover rates such as"}
+{"text": "Cumulative logit models were used to characterize the relationship between maternal risk factors and higher BLLs. Maternal blood lead levels more likely result from lead remobilization from historic versus contemporaneous exposures. Even if all lead sources were abated immediately, women and their fetuses would experience lead exposure for decades. This work emphasizes the importance of addressing sources of environmental lead exposure in the United States and internationally.Blood lead among pregnant women, even at modest levels, may impair offspring cognitive development. We examine whether blood lead levels (BLLs) result from current  Since the late 1970s, however, mounting research demonstrates that lead causes irreversible, asymptomatic effects at levels far below thresholds previously considered safe. Research suggests that significant adverse health effects occur at blood lead levels (BLLs) below the current CDC blood lead action level of 10 \u03bcg/dL, such as learning and behavioral deficits  and decrin utero and in the postnatal period tend to be smaller, weaker, less coordinated, and less intelligent than children who have not had significant exposure [i.e., lead-based paint), diet, cosmetics, or occupational hazards, or if she has lead stores in her body from previous exposure. Pregnant women and nursing mothers with high blood lead levels may experience elevations in both systolic and diastolic blood pressure [Children exposed to lead exposure ,16\u201319. Lexposure . Prenataexposure . Prenatapressure ,23. In tpressure ,25.Blood lead levels in women of child-bearing age have been decreasing over the previous decades, but remain a concern. NHANES data from 1999 to 2002 suggest that women aged 20\u201359 nationally have a mean level of 1.2 \u03bcg/dL and 0.3% of women have blood lead levels above 10 \u03bcg/dL . The ratet al. examined the pattern of blood lead levels over the course of a pregnancy among 105 women residing in Mexico [et al. performed a nested cohort study of pregnant women in Pittsburgh, PA to examine the pattern of maternal BLLs over the course of gestation [et al. study. Furthermore, they determined that older mothers had a steeper increase in BLLs during the latter half of pregnancy than did younger mothers, which was modified by calcium intake. Indeed, calcium supplementation may be a cost effective way to reduce maternal blood lead levels and thus fetal exposure [et al. suggest that exposure is underestimated when plasma lead levels are not considered [Relatively little is known about blood lead levels in pregnant women. Rothenberg n Mexico . The autn Mexico . After 2estation . They idexposure . The U-snsidered .versus historic exposures. The results of the analysis are directly relevant to state, national, and international lead policies, as well as the aggressiveness with which the policies should be pursued.Positive findings of blood lead among pregnant women may be indicative of contemporaneous exposure to lead or may result from remobilization of lead from bone stores due to either the aging process or the physiological stress of pregnancy. This paper has two purposes: first, to document the blood lead burdens among a cohort of pregnant women in Durham County, NC; and second, to model predictors of blood lead level, with a particular emphasis on disentangling current 2.The Healthy Pregnancy, Healthy Baby study is an ongoing prospective cohort study of the effects of environmental, social, and host factors on racial disparities in pregnancy outcomes. Duke University Medical Center (DUMC) Institutional Review Board approval was obtained to enroll pregnant women from the Duke Obstetrics Clinic and the Durham County Health Department Prenatal Clinic. Women were excluded from participation if they were less than 18 years of age, were not English-literate, were greater than 28 weeks\u2019 gestation at study enrollment, lived outside of Durham County, had a multi-fetal gestation, had a known fetal genetic or congenital abnormality, or were planning not to deliver at DUMC. Demographic, health behavior, and medical history data were obtained by direct patient interview at the time of enrollment and through electronic medical record review. Participants recruited from June 2005 to December 2008 are included in this analysis. Of the 1505 women approached for participation in the study, 1294 consented (86%). At the time of this analysis, we had lead levels available for 927 of the enrolled and consented women.All participants were geocoded to the individual tax parcel unit based on the residential address reported at time of enrollment (96.7% georeferenced). Such highly resolved spatial referencing of the data allowed each participant to be linked with parcel level data on age of housing and lead exposure risk level. The age of housing (year built) for each parcel was provided by the Durham County Tax Assessor. Each tax parcel\u2019s lead exposure risk level was calculated using a model of lead risk that has been validated by collection of environmental samples in homes in Durham County. Using tax assessor, lead screening, and U.S. Census data, a modeled lead exposure risk estimate for each residential tax parcel was calculated by weighting risk factors for lead exposure, including age of housing, Census blockgroup median income, and Census blockgroup percent African American .Maternal blood lead levels were measured in blood samples collected at the time of admission to the DUMC Birthing Center for delivery. Whole blood, collected in a trace-metal free vacutainer tube, was sent to the Mayo Medical Laboratories for graphic furnace atomic absorption spectrometry for determination of BLLs, with a lower limit of detection of 1.0 \u03bcg/dL .via a score test. The score tests on all three models that we estimate support the validity of the proportional odds assumption. We report the results in terms of adjusted odds ratios, confidence intervals, and p-values. Because these analyses were exploratory in nature, tests of statistical significance did not include an alpha adjustment. All analyses were undertaken using SAS 9.2 .Descriptive statistics were calculated to provide a sense of the cohort under study in terms of both demographic data and lead exposure. The population for this analysis was restricted to non-Hispanic white, non-Hispanic black, and Hispanic participants who completed the study and had a valid lead result available. As only 10.4% of women in our study had blood lead levels greater than 1 \u03bcg/dL, we categorized blood lead into three ordered groups: below the detection limit, 1 \u03bcg/dL, and \u22652 \u03bcg/dL. We then used cumulative logit models with a proportional odds assumption to assess the relationship between maternal risk factors and higher lead levels. The proportional odds assumption implies that the covariate effects are the same across logits and was tested 3.Of the 1294 participants screened and enrolled between June 2005 and December 2008, 6.5% were lost to follow-up and 2.2% withdrew. Lead results were only available for participants completing the study because blood is collected for lead analysis at delivery rather than enrollment. Lead results were available for 927 participants at the time of this study. In addition, only non-Hispanic white, non-Hispanic black, and Hispanic participants were included in the analyses presented here. Under these restrictions, data on 864 participants were used in the overall analysis. Although almost 97% of participants were geocoded, age of housing data was available for 770 of these participants and modeled lead exposure risk was available for 701 of these participants.2 tests of each categorical demographic variable; p > 0.05 for t-tests for differences in mean parity). Non-Hispanic black women account for almost three-fourths (72.6% in basic model) of the study population , and roughly two-thirds (65% in the basic model) of participants were under 30 years old. Parity measures the total number of deliveries to the mother, including previous term births, previous preterm births, and the current delivery. From both national and North Carolina birth data, we know that rates of tobacco use during pregnancy are typically highest among non-Hispanic white women and lowest among Hispanic women [ic women ,36. Our As shown in 2 = 5.39, p = 0.86 for basic model; \u03c72 = 4.97, p = 0.93 for age of housing model; and \u03c72 = 6.14, p = 0.86 for modeled exposure risk model), indicating that the cumulative logit models could be appropriately applied in this case.Three cumulative logit models for the ordered lead level categories were fit: (1) the basic model including race, age, education, parity, and tobacco use during pregnancy; (2) the basic model covariates plus age of housing; and (3) the basic model covariates plus modeled lead exposure risk. The categories of non-Hispanic white and 25\u201329 years of age served as reference groups. The score tests in all three models supported the assumption of proportional odds , those aged 20\u201324 years an aOR of 0.54 , those aged 30\u201334 years an aOR of 2.39 , those aged 35\u201339 years an aOR of 2.98 , and those aged 40\u201344 years an aOR of 7.69 . A similar pattern by age was found in both models that included a measure of current lead exposure; although in the third model which added modeled lead exposure risk, the 20\u201324 years age category was not significantly different (p = 0.058) from the 25\u201329 years referent group. Note, however, that age of housing was not significant in the second model and modeled lead exposure risk was not significant in the third model. Note also that the confidence intervals are wide in some cases due to low sample sizes.In addition, we checked the sensitivity of the results to both outliers and the classification of blood lead level. The two participants with blood lead levels >5 \u03bcg/dL, who were originally included in all three models, were removed from the dataset and the set of cumulative logit models rerun. Removing these outliers did not influence the results or their interpretation. Fitting the three models as simple logistic models with blood lead levels dichotomized as detectable/non-detectable (<1 \u03bcg/dL and \u22651 \u03bcg/dL) also did not affect the results. All standard covariates followed similar patterns, both in terms of direction and statistical significance, as in the corresponding cumulative logit models. Again, the two measures of current lead exposure, age of housing and modeled lead exposure risk, were not significantly associated with blood lead level.4.Maternal blood lead levels can result from either contemporaneous exposure to lead or through the remobilization of lead that has been sequestered in mineralized tissue in response to a historic exposure. When distributed to mineralized tissue, especially bone, lead is mistaken for calcium and used as faulty building blocks . An estiResearch indicates that bone is a living organ that accumulates lead in three compartments with three different half-lives and continually remobilizes lead to the bloodstream and other organs. The first compartment, periosteum, resembles soft tissue and is very common in growing infants. Periosteum readily releases lead stores into the bloodstream . A seconvia kidney function, or calcium desorption from bone [Maternal blood lead levels are inextricably tied to biological processes associated with calcium needs, absorption, and desorption. Pregnancy clearly induces a demand for calcium within the fetal compartment. Maternal responses to meet this demand can occur through increased absorption of calcium in the intestinal tract, changes in calcium conservation rom bone . If leadMaternal blood lead levels may be related to the aging process as well. Peak bone mass is generally considered to be achieved in young adulthood . After bThis study is limited to women from one county in North Carolina in a study population that intentionally oversamples non-Hispanic black women. As such, it should be replicated in other study populations to confirm the results found here. In addition, we are unable to incorporate direct measures of bone turnover, nutritional intake, or genetic vulnerabilities, all of which may contribute to blood lead levels among pregnant women. Nevertheless, we feel that the results presented here constitute an important contribution to the literature on lead levels during pregnancy.Maternal blood lead levels may also be related to current exposures. In our analyses, however, neither measure of current lead exposure (age of housing and modeled lead exposure risk) was significantly associated with blood lead levels. The aOR for age of housing was 1.00  and for modeled lead exposure risk was 0.88 . Taken in combination with the results on maternal age, this finding indicates that maternal blood lead levels are much more likely the result of lead remobilization from historic exposures as opposed to contemporaneous exposures.5.The 2005\u20132006 National Health and Nutrition Examination Survey (NHANES) data reveal blood lead levels elevated above the CDC action level of 10 \u03bcg/dL in 1.3 percent of one to five year olds in the United States, with children tested having an overall geometric mean blood lead level of 1.7 \u03bcg/dL . These dThe results from this analysis indicate that pregnant women themselves  are likely serving as a reservoir for lead stores. These stores are remobilized to the blood stream through natural aging processes, and rates of remobilization are likely accelerated by the physiological stress and calcium homeostasis of pregnancy. Lead diffuses from the mother\u2019s bloodstream to the fetus across the placenta and accumulates in fetal organs. From a public health perspective, this means that even if all lead sources were abated immediately and completely, women and their growing fetuses would remain at risk for lead exposure for decades. Yet a significant number of US children today still carry unacceptable blood lead levels. These numbers are even higher globally when considering the several countries that have limited or no restrictions on lead in gasoline and industry. Thus, this work again emphasizes the critical importance of aggressively addressing sources of environmental lead exposure both in the United States and internationally."}
+{"text": "EHP 116:243\u2013248; Jusko et al.][.Cohort data during the 1980s linked blood lead levels of at least 10 \u03bcg/dL with low cognitive test scores in children, prompting the decision by the Centers for Disease Control and Prevention to redefine the action level for elevated blood lead from 25 to 10 \u03bcg/dL. Now, new data add to the growing evidence that the 10-\u03bcg/dL level may not be protective The investigators recruited children aged 24\u201330 months who had been previously enrolled in a dust control study. All the children were born between July 1994 and January 1995 and lived in Rochester, New York, with parents expressing no plans to relocate. To reduce the possibility of misclassification of exposure, blood samples were collected for measuring blood lead on up to 8 occasions .The children were given the Wechsler Preschool and Primary Scale of Intelligence during their 6-year visit by an examiner trained in neurobehavioral testing and blinded to each child\u2019s blood lead level. These assessments were made at an age when IQ is measured reliably and is a significant predictor of IQ scores and educational and occupational success during adolescence and adulthood. The data analysis employed a regression model that controlled for family income; maternal education, race, prenatal smoking, and Stanford-Binet IQ score; child\u2019s birth weight; breastfeeding; crowding in the home; and quality of childrearing (using the Home Observation for Measurement of the Environment Inventory).The average blood lead level was 7.2 \u03bcg/dL, and lead concentrations for more than half the children never exceeded the 10 \u03bcg/dL mark. Even at these concentrations, blood lead levels were inversely related to IQ scores. The association was most pronounced for the Full-Scale and Performance IQ scores. Children whose blood lead levels measured in the 5- to 9.9-\u03bcg/dL range had significantly lower IQ scores than children with levels below 5 \u03bcg/dL. A descriptive analysis of peak exposure throughout early childhood suggested an inverse association between maximal blood lead level and IQ at blood lead levels less than 3 \u03bcg/dL; levels as low as about 2 \u03bcg/dL were associated with significant IQ declines. These findings, reinforced by previous data gathered by the same research team, support the need for a further reassessment of standard guidelines for responding to blood lead in infants and children."}
+{"text": "Prenatal lead exposure is associated with deficits in fetal growth and neurodevelopment. Calcium supplementation may attenuate fetal exposure by inhibiting mobilization of maternal bone lead and/or intestinal absorption of ingested lead.Our goal was to evaluate the effect of 1,200 mg dietary calcium supplementation on maternal blood lead levels during pregnancy.n = 334) or placebo (n = 336). We followed subjects through pregnancy and evaluated the effect of supplementation on maternal blood lead, using an intent-to-treat analysis by a mixed-effects regression model with random intercept, in 557 participants (83%) who completed follow-up. We then conducted as-treated analyses using similar models stratified by treatment compliance.In a double-blind, randomized, placebo-controlled trial conducted from 2001 through 2003 in Mexico City, we randomly assigned 670 women in their first trimester of pregnancy to ingest calcium (p = 0.004). This reduction was more evident in the second trimester  than in the third  and was strongest in women who were most compliant , had baseline blood lead > 5 \u03bcg/dL , or reported use of lead-glazed ceramics and high bone lead .Adjusting for baseline lead level, age, trimester of pregnancy, and dietary energy and calcium intake, calcium was associated with an average 11% reduction (0.4 \u03bcg/dL) in blood lead level relative to placebo (Calcium supplementation was associated with modest reductions in blood lead when administered during pregnancy and may constitute an important secondary prevention effort to reduce circulating maternal lead and, consequently, fetal exposure. Despite improvements in environmental policies and significant reductions in average U.S. blood lead levels, lead exposure remains a concern for pregnant and lactating women. This is particularly true among certain population subgroups at increased risk, such as women from developing countries and those with occupational exposures . In addiThe potential role of nutrition in altering susceptibility to lead exposure and toxicity has long been recognized , 1990. DInadequate calcium consumption has been shown to increase lead absorption  and reteCalcium requirements are increased substantially during pregnancy and lactation in order to meet the needs of the developing fetus and nursing infant for skeletal mineralization and growth . MaternaIn a randomized, double-blind, placebo-controlled trial of 1,200 mg daily calcium supplementation in lactating women, we have previously shown that calcium supplementation reduced maternal blood lead by 15\u201320%  and brean = 2). Of the remaining 1,853 eligible women, 670 (36%) agreed to participate and signed the informed consent, and were randomly assigned to receive a daily supplement of 1,200 mg calcium  or placebo (n = 336). We assessed blood lead levels, dietary calcium intake, and reported use of lead-glazed ceramics (LGC) at three time points: baseline (first trimester), 6 months (second trimester), and 8 months (third trimester). We assessed compliance by pill count at each follow-up visit. We defined women who had at least one blood lead measurement at 6 or 8 months\u2019 gestation  as having completed follow-up. Eight women did not have baseline blood lead levels, yielding a total of 557 subjects (83%) available for inclusion in the final analyses  pre-natal clinics that serve a low- to moderate-income population in Mexico City. We assessed 3,836 women for eligibility, of whom 1,981 did not meet study eligibility criteria  or had other reasons not being enrolled  were performed using graphite furnace atomic absorption spectrophotometry  at the American British Cowdray (ABC) Hospital Trace Metal Laboratory according to a technique described in in vivo measurements of each subject\u2019s midtibial shaft  and patella (trabecular bone). The physical principles, technical specifications, validation, and use of the K-XRF technique have been described in detail elsewhere (At 1 month postpartum (\u00b1 5 days), maternal bone lead was estimated by a spot-source cadmium-109 K-X-ray fluorescence (K-XRF) instrument at the research facility at the ABC Hospital. We used two 30-min lsewhere . For quaWe assessed maternal dietary intake in each trimester of pregnancy using a semiquantitative food frequency questionnaire designed to estimate usual dietary intake over the prior month. We based the questionnaire on the semiquantitative food frequency questionnaires and validation methodology used in the Harvard Nurses\u2019 Health Study and Health Professionals\u2019 Follow-up Study , 1987. WU-test) two-sample test of equality or Student\u2019s t-test, as appropriate. We performed a similar comparison between those included in the analyses and those lost to follow-up.We compared baseline characteristics of participants between the calcium and placebo groups using Wilcoxon ranksum  below the limit of detection (1 \u03bcg/dL) with random numbers following a uniform distribution between 0 and 1. We adjusted models for the following baseline variables: first trimester log-transformed blood lead concentration, maternal age (years), treatment group, daily calcium (grams per day) and energy intake , and trimester of pregnancy.To assess the overall intent-to-treat effect of calcium supplementation on blood lead concentrations throughout the last two trimesters of pregnancy, we fitted the following model:i,j) is the loge-transformed blood lead concentration for subject i at trimester j, \u03b1 + ui denotes the random intercept where ui represents the error term associated to the ith subject , Si is a dummy variable that indicates treatment assignment, lnBPbi is the initial (baseline) natural log-transformed blood lead concentration of the ith subject, Tj is the jth trimester of pregnancy [j = ], Ci is the baseline daily energy intake, Cai is the baseline daily calcium dietary intake, Ai is age, and \u025bi,j denotes the random variation . The overall treatment effect estimate is the coefficient \u03b21.where ln.where We used a secondary dose\u2013response study to further assess the effectiveness of supplementation. We assessed compliance by pill count at each visit and analyzed it as proportion of expected pills used between baseline (first trimester) and end of follow-up (8 months\u2019 gestation). We defined treatment compliance group in three ways: \u2265 50% of pills consumed, \u2265 67% of pills consumed, and \u2265 75% of pills consumed. To try to disentangle the effect of calcium supplementation on bone lead mobilization versus gastrointestinal absorption, we developed models with an interaction model for postpartum bone lead levels and reported use of LGC. The rationale for fitting this model was that the effect of the supplement may have been larger in those who had larger bone lead concentration and/ or in those who used LGC. We generated a new dummy variable designating high and low patella bone lead levels dichotomized at the median (5.6 \u03bcg/g) and created a two-way interaction term with LGC use (yes/no). We did not include a three-way interaction because we found no reason to think that the magnitude of the effect of bone lead concentrations, and thus bone lead mobilization rates, on blood lead would depend on the use of LGC. We fitted the following model:it is blood lead concentration for the ith subject at the tth trimester, Si is the supplementation group, BPbi is the first available postpartum bone lead measurement, LGCit is current use of LGC in the ith subject at the tth trimester, and \u03b41 represents the difference in the effect of supplementation between the high and low bone Pb concentration groups, and \u03b42 represents the difference in the effect of supplementation between the current use/ not use of LGC groups. Covariates are baseline blood lead level, baseline daily calcium dietary intake, baseline daily energy intake, age, and trimester of pregnancy. Because we were trying to disentangle biologic mechanisms, we restricted these models to those who with \u2265 75% compliance.where PbFinally, to account for possible heterogeneity of treatment effects according to initial blood lead levels, we also performed analysis by baseline blood lead group (< 5 \u03bcg/dL vs. \u2265 5 \u03bcg/dL) using an intent-to-treat analysis and then among only those women with \u2265 50% compliance.We performed all statistical analyses using Stata for Windows .n = 334) or placebo (n = 336) (p = 0.02) (p = 0.05).We randomized 670 eligible women to receive calcium supplementation (n = 336) . Baselin = 0.02) . Approxin = 277; calcium n = 288) with those lost to follow-up , we found no significant differences by treatment group assignment (p = 0.18). Those women who remained in the study reported higher daily energy intake (p < 0.01) and higher use of LGC (p = 0.04) at baseline. Those women who completed follow-up reported higher current use of LGC (36%) than those who did not complete follow-up (26%); among those completing follow-up, however, we found no significant differences in reported LGC use by treatment group.A total of 565 women (84%) completed follow-up. Comparing the group that completed follow-up (placebo n = 557), calcium supplementation was associated with an overall average reduction of 11% in maternal blood lead concentrations relative to placebo (p = 0.004) (p < 0.001) than in the third trimester . These results did not change when we controlled for hematocrit level (data not shown).In the intent-to-treat analysis (= 0.004) . In a sen = 557) using models stratified by treatment compliance, we saw a clear dose\u2013response effect of calcium on blood lead concentration (p < 0.001). This increased to 19% (p < 0.001) and 24% (p < 0.001) for those who consumed \u2265 67% of pills and \u2265 75% of pills, respectively (p for trend < 0.001). When we assessed the dose\u2013response effect of calcium supplementation for women \u201cas treated\u201d (ntration . Among tn = 565), those with low compliance reported higher current use of LGC in the calcium group (35%) compared with placebo (27%), which might explain the apparent increase in blood lead among the low-compliance group. We found no significant differences in reported LGC use among the high-compliance group.Among the low-compliance group (< 50% of pills consumed), blood lead was higher in the calcium-supplemented group, suggesting that these women were somehow different from the low compliers receiving placebo. In fact, in the group that completed follow-up (p = 0.01) for those with no reported use of LGC and a 31% reduction (p < 0.01) for those who reported use of LGC. In this subset of most compliant women with high patella bone lead (> 5 \u03bcg/g) and reported use of LGC, the effect corresponds to an average blood lead reduction of 1.95 \u03bcg/dL .n = 82), those with low baseline blood lead (< 5 \u03bcg/dL) appeared to experience a paradoxical effect of calcium on blood lead levels (an increase of 34%). Those who started the study with higher blood lead (\u2265 5 \u03bcg/dL) showed the same average effects of treatment (17% reduction), although not statistically significant. Further analysis revealed, however, that the reported use of LGC in low compliers was higher among the calcium group (35%) than in the placebo group (27%), which may account for the apparent differences in treatment effect (7% vs. 17% reduction) observed in the intent-to-treat analysis by baseline blood lead.We repeated the analysis by baseline blood lead group (< 5 \u03bcg/dL vs. \u2265 5 \u03bcg/dL) using intent-to-treat and as-treated analyses among only those women with compliance \u226550% of pills consumed . The effIn this randomized control trial, calcium supplementation  was associated with modest reductions in blood lead levels when administered during pregnancy. These effects were clearly stronger with increasing compliance, with a 24% average reduction in the most compliant women, and strongest in those with baseline blood lead level > 5 \u03bcg/dL (17% average reduction). In the subset of most compliant women with high patella bone lead (> 5 \u03bcg/g) and reported use of LGC, we found the greatest reduction in blood lead of 31%, which corresponds to an average reduction of 1.95 \u03bcg/dL .These results are consistent with our previously published randomized trial, which showed that dietary calcium supplementation among postpartum women reduced maternal blood lead by 15\u201320% over the course of lactation . In thatThese results are also consistent with the results of a study by N-telopeptide, was reduced by an average of 13.6 nM bone collagen equivalents/mM creatinine (14%) compared with placebo (The effect of calcium may be exerted, at least in part, by decreasing bone resorption and the consequent mobilization of maternal bone lead stores. In a case\u2013crossover trial of calcium supplementation during the third trimester of pregnancy, we have previously shown that maternal bone resorption, as reflected by urinary cross-linked  placebo , indicatThe effects of calcium may also be attributed to decreasing the intestinal absorption of lead and/or increasing the excretion of lead from circulation. In the present study, we did not have prepregnancy bone lead levels, and Mexican laws forbidding potential radiation exposure during pregnancy did not allow us to obtain bone lead measurements during pregnancy. However, our observation in the stratum of women with no reported LGC use\u2014that the calcium effect is greater in those with high bone lead\u2014suggests that, in this population, the effect may have been exerted mainly through inhibiting bone resorption.Average baseline dietary calcium intake for women in our trials of Mexican women was less than the U.S. recommended dietary intake of 1,000\u20131,300 mg/day for pregnant and lactating women . Levels Nonetheless, dietary calcium intake likely plays a limited, but still important, role in suppressing mobilization of lead from maternal bone and/or decreasing gastrointestinal absorption of ingested lead, thereby decreasing the risk of fetal and infant exposure. Calcium supplementation during pregnancy may also reduce the risk of hypertensive disorders of pregnancy  that may"}
+{"text": "Pulse pressure increases with age in industrialized societies as a manifestation of arterial stiffening. Lead accumulates in the vasculature and is associated with vascular oxidative stress, which can promote functional and structural vascular disease.We tested the hypothesis that cumulative community-level lead exposure, measured with K-X-ray fluorescence, is associated with pulse pressure in a cohort of adult men.p < 0.001). Adjusting for age, race, diabetes, family history of hypertension, education, waist circumference, alcohol intake, smoking history, height, heart rate, fasting glucose, and total cholesterol-to-HDL ratio, increasing quintiles of tibia lead remained associated with increased pulse pressure (ptrend = 0.02). Men with tibia lead above the median (19.0 \u03bcg/g) had, on average, a 4.2-mmHg  higher pulse pressure than men with tibia lead level below the median. In contrast, blood lead level was not associated with pulse pressure.In a cross-sectional analysis of 593 men not treated with antihypertensive medication, tibia lead was positively associated with pulse pressure (These data indicate that lead exposure may contribute to the observed increase in pulse pressure that occurs with aging in industrialized societies. Lead accumulation may contribute to arterial aging, perhaps providing mechanistic insight into the observed association of low-level lead exposure with cardiovascular mortality. In industrialized societies, pulse pressure (systolic minus diastolic blood pressure) increases with age, a trend that accelerates in the sixth decade when the diastolic blood pressure begins to decrease . The incIn vivo , a longitudinal study of aging established by the Veterans Administration in 1961. Male volunteers from the Greater Boston, Massachusetts, area were screened at entry and enrolled in the study if they had no history of heart disease, hypertension, diabetes, cancer, peptic ulcer, gout, recurrent asthma, bronchitis, or sinusitis. Those with either a systolic blood pressure > 140 mmHg or a diastolic blood pressure > 90 mmHg were disqualified. Between 1963 and 1968, 2,280 men were enrolled; their ages at entry ranged from 21 to 80 years. Participants were asked to return for follow-up examinations every 3\u20135 years, and the attrition rate was roughly 1% per year over the life of the study. Beginning in 1991, we invited the men still being monitored by the NAS to take part in a study of lead exposure, as assessed by KXRF measurements. The study was approved by the human subjects committees of both the Boston Veterans Administration Medical Center and the Brigham and Women\u2019s Hospital.A priori we chose to examine tibia lead as a marker of cumulative lead exposure because tibia bone is mostly cortical bone, whereas the patella is mostly trabecular bone and has a greater turnover rate  with a KXRF instrument . The physical principles, technical specifications, and validation of this instrument have been described in detail elsewhere , 1990b. ver rate .Blood samples were obtained and analyzed by graphite furnace atomic absorption spectroscopy ; this instrument was calibrated after every 21 samples with National Bureau of Standards\u2019 blood lead standards materials . The limit of detection for the GF-AAS method is < 1 \u03bcg/dL; thus, values are expressed as integers going down to 0 \u03bcg/dL. Ten percent of the samples were run in duplicate; at least 10% of the analyses were controls, and 10% were blanks. In tests on reference samples from the Centers for Disease Control and Prevention , the precision (the coefficient of variation) ranged from 8% for concentrations between 10 and 30 \u03bcg/dL to 1% for higher concentrations. In comparison with a National Bureau of Standards\u2019 target of 5.7 \u03bcg/dL, 24 measurements by this method gave a mean of 5.3 \u03bcg/dL with an SD of 1.23 \u03bcg/dL.During each clinical visit, a physician using a standard mercury sphygmomanometer with a 14-cm cuff measured the participant\u2019s blood pressure. With the participant seated, the systolic blood pressure and fifth-phase diastolic blood pressure were measured once in each arm to the nearest 2 mmHg. For this study, the mean of the right and left arm measurements was used as each participant\u2019s systolic and diastolic blood pressures. Pulse pressure was calculated as the mean systolic minus the mean diastolic blood pressure. Heart rate was recorded as beats per minute.For each clinical visit, the NAS participant reported to the study center in the morning after an overnight fast and abstinence from smoking. At the start of the visit, height and weight were measured. Thereafter, a physician took a complete medical history and confirmed the identity and purpose of medications taken daily. Medications were considered anti-hypertensive if they included a beta-blocker, calcium channel blocker, diuretic, or other vascular agent prescribed by the participant\u2019s physician. The participant also indicated whether his mother or father had hypertension that was diagnosed by a physician. Alcohol and dietary intake were assessed with a standardized semiquantitative food frequency questionnaire , in whicThe present analysis is a cross-sectional examination of the association of blood and bone lead levels with pulse pressure in subjects with these measurement made in the years 1991\u20131997. The participants for the present study were a subgroup of the NAS cohort who underwent at least one KXRF bone lead measurement and were not on antihypertensive therapy at the time of this measurement. Of the 1,262 men who were seen for their regularly scheduled visits between August 1991 and December 1997, 840 (66.6%) underwent KXRF measurement. The most common reason given for not having a measurement was the inconvenience involved in making another visit to the bone lead laboratory on a separate day. As a standard quality-control procedure, we excluded seven men who had high uncertainty estimates (> 10 \u03bcg/g) for bone lead measurement . A compaF-test  to evaluate the overall association between level of lead biomarker and pulse pressure, and we computed tests of linear trend by fitting models with an ordinal term, which took on the values of each biomarker quintile . We fit additional models that further adjusted for dietary sodium and calcium as well as total caloric intake.For each of the two lead biomarkers (blood lead and tibia lead), we used multiple linear regression to compare the mean pulse pressure across quintiles of the lead biomarker. We used quintiles of lead level to limit the influence of outliers and to not assume a linear relationship between lead level and pulse pressure. We determined covariates for our core models based on known determinants of bone and blood lead level, blood pressure, risk factors for arterial aging, and physiologic determinants of pulse pressure. Our regression analyses were all adjusted for the following variables, all of which were assessed at the time of bone lead measurement: age (years), age squared, height (meters), race (white vs. nonwhite), heart rate (beats/minute), waist circumference (centimeters), diabetes, family history of hypertension (yes/no), education level achieved, smoking (pack-years), alcohol intake (grams per day), fasting plasma glucose (mmol), and ratio of total cholesterol to HDL (high-density lipoprotein) cholesterol . We did p < 0.05 as the level of statistical significance. All authors had full access to the data and take responsibility for its integrity. All authors have read and agree to the manuscript as written.All analyses were conducted with the SAS software program  with The blood lead levels of the study population ranged from < 1 to 35 \u03bcg/dL, with a mean (\u00b1 SD) of 6.12 \u00b1 4.03 \u03bcg/dL. These values are representative of community-level  exposure in the U.S. general population in this age range . The meaWe examined participants\u2019 characteristics in relation to quintile of tibia lead level to provide insight into potential confounders of the association between lead and pulse pressure . Of partWe examined the progression of systolic and diastolic blood pressure and pulse pressure with age, categorized in 5-year increments . As demoWe evaluated unadjusted, age-adjusted, and multivariable-adjusted correlations of blood and bone lead levels with systolic and diastolic blood pressure . Blood lF-test, p < 0.01), with pulse pressure increasing with tibia lead\u2013level quintile . Dietary intake of sodium, dietary intake of calcium, and hematocrit were all added individually to our models but did not substantially change these results. In addition, we did not find a significant interaction between dietary calcium intake and tibia lead quintile in determining the pulse pressure. The association of patella lead with pulse pressure was of borderline statistical significance (data not shown).We observed significant differences in pulse pressure across quintiles of bone lead but not blood lead after multivariable adjustment. Tibia lead\u2013level quintile was significantly associated with pulse pressure , and adjusting for antihypertensive therapy (using vs. not using). In this analysis, tibia lead level remained associated with pulse pressure , though the effect of tibia lead quintile on pulse pressure was somewhat attenuated .Analyses were repeated excluding the 14 nonwhite participants; the association of tibia lead with pulse pressure was not changed. We performed additional analysis including men treated with antihypertensive therapy . The tibia bone is mostly cortical bone, whereas the patella is mostly trabecular bone and has a greater turnover rate . Tibia lWe found that men with bone lead levels above the median had pulse pressures that were on average 4.2 mmHg higher compared with men with lower bone lead levels. The magnitude of this association is numerically small but potentially clinically significant. In the Conduit Artery Function Evaluation (CAFE) study of the Anglo-Scandinavian Cardiac Outcomes Trial (ASCOT) comparing amlodipine \u00b1 perindopril versus atenolol \u00b1 thiazide in the treatment of hypertension, a 3-mmHg decrement in central pulse pressure conferred a cardiorenal advantage to the amlodipine \u00b1 perindopril strategy . Pulse pBecause this is a cross-sectional study, we cannot explicitly examine the temporal association between lead exposure and subsequent pulse pressure or individual changes in pulse pressure. Nonetheless, our bone lead measures, particularly tibia lead, do reflect exposures that occurred over the past years to decades, suggesting a temporal ordering of the association that we observed between bone lead and pulse pressure. Moreover, reverse causation\u2014the situation in which pulse pressure affects lead exposure\u2014is highly unlikely. Blood pressure was measured once in each arm; averaging these values increases the precision of our measurement. It is possible, however, that differences in the blood pressure between the arms due to subclavian stenosis or other processes may introduce error into our blood pressure determination and limit the precision of our lead effect estimates. Although our results were adjusted for numerous important potential confounders, we cannot rule out the possibility that the association we found derives from confounding by unmeasured factors or that categorical tibia lead level may not entirely account for the association of bone lead with aging. The data suggest that there may be a threshold to the effect of lead exposure on pulse pressure, because only the top two quintiles of tibia lead were associated with a mean pulse pressure greater than that of the first quintile. It is possible that selective survival biased our findings in this older cohort of men, in that survival may be related to lower lead exposures and lower pulse pressure; even so, such bias would tend to make our results a conservative estimate of the adverse association between bone lead and pulse pressure.Although lead exposure has been associated with elevated blood pressure in women  and blacIn conclusion, we found that cumulative lead exposure, as reflected by bone lead level, was independently associated with increased pulse pressure in a cohort of middle-aged and older men with community-level lead exposure. These findings implicate vascular accumulation of lead in the pathogenesis of vascular stiffening, a mechanism consistent with the findings of aortic lead deposition in humans and increased vascular oxidative stress in the lead-exposed animal. Future work will determine the effect of lead exposure on the progression of pulse pressure with aging. We suggest that further examinations of the association of lead exposure on arterial pressure should use bone lead level as an indicator of cumulative lead exposure."}
+{"text": "Epidemiologic studies suggest a temporal trend of earlier onset and longer duration of puberty, raising concerns regarding the potential impact of environmental factors on pubertal development. Lead exposure has been associated with delayed pubertal onset in girls; however, epidemiologic data in boys are limited.We used multivariable logistic regression models to explore the cross-sectional association of blood lead levels with growth and pubertal onset based on physician-assessed testicular volume (TV) and pubertal staging in 489 boys 8\u20139 years of age from Chapaevsk, Russia. We used multivariable linear regression models to assess associations of blood lead levels with somatic growth at the study entry visit.p < 0.001) and weight (p = 0.06) after adjustment for birth weight, gestational age, and age at examination. In multivariable adjusted analyses, boys with blood lead levels \u2265 5 \u03bcg/dL had 43% reduced odds of having entered G2 compared with those with lower levels .The median (25th\u201375th percentile) blood lead level was 3 \u03bcg/dL (2\u20135 \u03bcg/dL). Height, weight, body mass index, birth weight, and gestational age were predictive of the onset of puberty as assessed either by TV (> 3 mL), genitalia stage (G2), or both. Blood lead level was inversely associated with height (Relatively low environmental blood lead levels were associated with decreased growth and differences in pubertal onset in periadolescent Russian boys. Future analyses of this prospective cohort will address pubertal onset and progression in relation to lead and other environmental chemicals. Puberty, the period of transition from childhood to attainment of mature reproductive function, is characterized by accelerated growth, development of secondary sexual characteristics, and psychological changes. Activation of the hypothalamic\u2013pituitary\u2013gonadal axis, manifest as increasing pulsatile secretion of gonadotropin-releasing hormone (GnRH), initiates puberty. Although the precise mechanisms responsible for pubertal onset are not fully understood, body mass and nutritional status , psychosEpidemiologic studies suggest a temporal trend of earlier pubertal onset in girls , with leThe present study was conducted among boys from Chapaevsk, a town of 72,000 residents, in central Russia. Several large industries in Chapaevsk previously manufactured chemical warfare agents but presently produce industrial and agricultural chemicals . These pThe study was approved by the Human Studies Institutional Review Boards of the Chapaevsk Medical Association, Harvard School of Public Health, University of Massachusetts Medical School, and Brigham and Women\u2019s Hospital. The parent or guardian signed an informed consent, and the boy signed an assent form.a) children without legal guardians , because birth or family history was unavailable; b) children of Azerbaijanian nationality, because they were generally born elsewhere and likely to relocate; and c) children with chronic illnesses that might affect growth and puberty, such as severe asthma, renal failure, diabetes, and congenital cardiac defects.All boys 8\u20139 years of age who were residents of Chapaevsk, Russia, between May 2003 and May 2005 were identified, using health insurance records and the centralized clinic system servicing all Chapaevsk children. The following were exclusion criteria: The primary caregiver  completed nurse-administered health, lifestyle, and dietary questionnaires. The health and lifestyle questionnaires were developed through pilot work in Chapaevsk  and wereWith a nurse present, a trained physician (O.S.) performed a standardized examination including height, weight, and pubertal staging without knowledge of the boys\u2019 lead levels. Height (to the nearest 0.1 cm) was measured in stocking feet using a stadiometer. Weight (to the nearest 0.1 kg) was measured with the boys in undergarments using a balance scale with moveable weights and level platform.Pubertal status was staged from 1 to 5 by visual inspection and compared with published photographs according to internationally accepted criteria . PubarchAt the physical examination visit, 3.0 mL of venous blood was collected in trace metal\u2013free Vacutainer tubes  after cleaning the site serially with three alcohol pads. Whole blood samples were diluted with a matrix modifier solution and analyzed by Zeeman background-corrected flameless graphite furnace atomic absorption . All measured values were reported. The detection limit was 1.0 \u03bcg/dL.Although the data are from a prospective cohort study on the growth and development of Russian children, for this study only the baseline measurements for exposure were available. Therefore, the statistical analyses explored the cross-sectional association of blood lead levels with measures of growth and pubertal onset at baseline. Blood lead levels were modeled as either a continuous measure based on a natural logarithmic transformation to approximate a normal distribution or a dichotomous indicator of high lead defined as \u2265 5 \u03bcg/dL. We evaluated the association of log-transformed lead levels with somatic growth , penile length, and birth characteristics  using both univariate and multivariable linear regression models adjusted for potential confounders . All statistical models used the exact age of each boy in days based on the actual birth date. Study visits were timed to be close to the birthday, and the majority were conducted within 1 month of each boy\u2019s birth date. Standard diagnostic methods were used to evaluate the appropriateness of the linear regression model  and to identify potential outliers.To evaluate the association of both log-transformed lead and high lead (\u2265 5 \u03bcg/dL) with pubertal onset, we used logistic regression models for the binary outcomes of TV > 3 mL and \u2265 stage 2 for genitalia and pubarche, considered separately. We also fit ordinal logistic regression models under a proportional odds assumption for TV . A test of the proportional odds assumption was conducted for each model, and there was no evidence that this assumption was violated. Similar to the above linear regression models, the logistic regression models were first fit to evaluate univariate effects of log-transformed lead or high lead, and then adjusted for birth weight, gestational age, height, BMI, and age at examination. Selection of covariates in the multivariable models were based on the association of birth history and somatic characteristics with puberty onset in the absence of lead. In addition, an assessment of potential confounding by nutritional status of the associations between lead and pubertal onset was conducted based on preliminary dietary information. Multivariate regression models were further adjusted for macronutrients  as a percentage of caloric intake, using the nutrient density method . A sensitivity analysis of the influence of high blood levels on associations with pubertal onset was conducted by excluding 16 (3%) subjects with blood lead values of \u2265 10 \u03bcg/dL.Demographic data and birth characteristics of the 489 boys enrolled in the study with blood lead levels, physical examinations, and questionnaire information are presented in The median (25th\u201375th percentile) blood lead levels of the boys were 3 \u03bcg/dL (2\u20135 \u03bcg/dL), with slightly higher levels among 9-year-old boys compared with 8-year-olds . Twenty-p < 0.001 and p = 0.06, respectively).Height and weight, but not BMI or penile length, were inversely associated with blood lead concentrations . For eacPubertal onset defined as TV > 3 mL was present in 14% of the boys, including 12% of 8-year-olds and 18% of 9-year-olds . Pubertap = 0.01] and a 13% increase in the odds of being in G2 per one-unit increase in BMI . Similar magnitudes of associations were found for these predictors and pubertal onset using TV categorized as six levels (1\u20136 mL) and two levels (\u2264 3 mL and > 3 mL). Gestational age was inversely associated with pubertal onset based on TV > 3 mL .Height, weight, BMI, birth weight, and gestational age were predictive of pubertal onset as defined by either TV > 3 mL or G2, or both. In multivariable models with adjustment for exact age at examination and other growth and birth history measures, there were almost twice the odds of being in G2 per kilogram increase in birth weight [odds ratio (OR) = 1.91; 95% CI, 1.15\u20133.17; p = 0.10) (p = 0.03). In unadjusted models, there was an association between TV (which ranged from 1 to 6 mL) with dichotomized blood lead . However, after adjustment for covariates, the association became only marginally significant . No association of blood lead levels with either TV > 3 mL or stage P2 was identified, despite trends in the same direction as G2.After adjustment for confounders, when pubertal onset was defined using G2, each log unit increase in blood lead concentration was associated with a marginally significant reduction in odds of being in G2  . When blp = 0.06) and high blood lead . In addition, the association of TV with high lead (\u2265 5 \u03bcg/dL) became significant after adjustment for dietary macronutrients .Several sensitivity analyses were conducted to evaluate the impact of nutritional status, socioeconomic status, a higher blood lead cut point (\u2265 10 \u03bcg/dL), and elimination of outliers on the robustness of the associations between blood lead and pubertal onset. These sensitivity analyses helped to confirm and support the previous results. Associations of blood lead with G2 had similar ORs but narrower CIs after further adjustment for dietary macronutrients using the nutrient density approach in models with both log lead  and with high lead .Because shorter boys may have higher lead levels than taller boys and are less likely to have puberty onset, we also conducted several analyses to specifically assess the impact of stature on associations between blood lead levels and puberty. The adjusted models in p = 0.06). Similarly, exclusion of two boys with lead levels \u2265 30 \u03bcg/dL had essentially no effect on the results shown in After excluding 16 subjects with blood lead values \u2265 10 \u03bcg/dL, the significant association of pubertal onset reflected by G2 with high versus low blood lead persisted  . In addiOur findings suggest that lead is unlikely to be playing a role in the observed secular trend of earlier pubertal onset. However, independent of lead exposure, the pattern of pubertal development among the Chapaevsk boys  parallelAmong these Russian boys, there was a higher prevalence of pubertal onset as defined by \u2265 G2 (30%) compared with that defined by TV > 3 mL (14%). Of the boys in G2, 60% had a prepubertal TV, whereas of the boys with TV > 3 mL, all but 12 boys (17%) were in G2. Although changes in genital staging and TV are thought to occur in parallel, few studies have specifically assessed both of these signs of pubertal onset. A similar discordance has been reported in a large East German study in which the 3rd percentile for G2 occurred at 8.5 years in contrast to 11.8 years for achieving a testicular length \u2265 30 mm  . Our incAnimal models suggest that both the timing and duration of exposure may be important for lead\u2019s reproductive toxicity. For example, male rats exposed to lead during gestation had decreased birth weights and pubertal growth rates due to disrupted growth hormone (GH) secretion and decreased plasma insulin-like growth factor 1 (IGF-1) concentrations during puberty , 1998a. 210Pb accumulation in the median eminence , suggesting that dioxin exposure is unlikely to confound our findings. In future work, we will complete dioxin analyses for the remaining study participants and explore the interrelationships of lead and dioxin with growth and development.In addition to lead, dioxin exposure is of concern for the Russian boys studied. In preliminary analyses on data from 125 boys, serum dioxin had no correlation with blood lead levels . Although the lead-associated changes in pubertal onset of the boys in the study do not constitute clinically defined pubertal delay, modest changes in the mean age of pubertal onset can result in substantial increases in the occurrence of clinically abnormal onset in a population, and thereby have important public health consequences . Because"}
+{"text": "Low-level exposure to lead and to chronic stress may independently influence cognition. However, the modifying potential of psychosocial stress on the neurotoxicity of lead and their combined relationship to aging-associated decline have not been fully examined.We examined the cross-sectional interaction between stress and lead exposure on Mini-Mental State Examination (MMSE) scores among 811 participants in the Normative Aging Study, a cohort of older U.S. men.We used two self-reported measures of stress appraisal\u2014a self-report of stress related to their most severe problem and the Perceived Stress Scale (PSS). Indices of lead exposure were blood lead and bone (tibia and patella) lead.p < 0.05).Participants with higher self-reported stress had lower MMSE scores, which were adjusted for age, education, computer experience, English as a first language, smoking, and alcohol intake. In multivariable-adjusted tests for interaction, those with higher PSS scores had a 0.57-point lower  MMSE score for a 2-fold increase in blood lead than did those with lower PSS scores. In addition, the combination of high PSS scores and high blood lead categories on one or both was associated with a 0.05\u20130.08 reduction on the MMSE for each year of age compared with those with low PSS score and blood lead level (Psychological stress had an independent inverse association with cognition and also modified the relationship between lead exposure and cognitive performance among older men. Furthermore, high stress and lead together modified the association between age and cognition. Cognitive decline has been associated with aging, and as the U.S. population shifts to a more elderly population, there is growing concern about the implications of cognitive dysfunction. However, cognitive decline varies widely across ages, which suggests that it may not be just a natural consequence of aging but may be linked to multiple risk factors .The relationship between lead and cognitive impairment has been documented extensively in children and in occupationally exposed populations e.g., . PreviouPsychological stress (hereafter referred to as stress) has also been associated with decrements in short-term memory and attention e.g., . HoweverExposure to both lead and stress often co-occur and potentially operate through overlapping biologic pathways of action  MMSE score. This is equivalent to the effect of 6.4 years of age in our data. Higher PSS scores were also associated with a 0.20 lower MMSE score, although this did not quite reach statistical significance . No interaction was observed with age for either the most stressful event score or the PSS.p-interaction = 0.02) (p-interaction = 0.06) (n = 7 for patella and n = 8 for blood) by the ESD procedure, we observed a stronger negative interaction between PSS and patella lead on the MMSE score (p-interaction = 0.02), although the interaction between PSS and blood lead was not significant (p-interaction = 0.23).Both stress measures showed a trend toward negatively modifying the association of lead on cognition. Only the interaction between PSS and log blood lead was significant. Among men with higher PSS scores, an IQR increment in log blood lead was associated with a significant 0.57 lower  MMSE score, but among men with lower PSS scores, this same increase in log blood lead was associated with a nonsignificant 0.05 lower MMSE score , a \u22120.52 difference per IQR of log blood lead by stress ( = 0.02) . A margi = 0.06) . In analBased on the positive two-way interaction with PSS, we investigated the association of the relationship with age for each of the PSS\u2013lead categories: high stress\u2013high lead, high stress\u2013low lead, and low stress\u2013high lead compared with low stress\u2013low lead . For bloIn this cohort of older men, increased self-report of stress was related to lower cognition. Moreover, an inverse association with blood lead and MMSE was more pronounced among those who reported higher perceived stress using the PSS than among those who reported lower perceived stress. In addition, the combination of perceived stress and lead modified the relationship between age and cognition. This study corroborates laboratory studies and one other human study that indicated lead and stress interact to affect cognitive function  and furtPrevious studies have reported that heterogeneity in cognition is especially pronounced in the elderly compared with younger adults . SapolskAging has been associated with an increase in oxidative stress and elevated glucocorticoids . It has As proposed by a) measures such as the life events measure may pick up acute or direct effects, whereas the PSS may be indicative of dispositional affect  and that b) the former may drive the development of symptoms, whereas the latter may be related to increased susceptibility.We observed some differences in the relationship between the two stress measures on cognition and their interactive relationship with lead. We found a significant negative relationship between the most stressful life event measure and MMSE score and a marginal negative relationship with PSS. In addition, even though the direction of the association was the same, only PSS showed significant interaction with lead in association with MMSE. The most stressful life event rating assesses a stressful event judged by the respondent to have a negative impact, whereas the perceived stress measures the individual\u2019s perception of the current demands exceeding the ability to cope . These mWe also found a difference between the interactive association of stress and lead among the measures of lead exposure: a significant interaction with blood lead, marginal interaction with patella lead, and no interaction with tibia lead. Of note, there were substantially fewer bone lead measures than blood lead. However, our results for blood lead remained significant after we restricted the blood analyses to those with only bone lead measurements (data not shown). In a previous study in this cohort that looked at the cross-sectional relationship between lead and elevated MMSE, The combined effect of lead and stress is of particular concern, because HPA axis dysfunction has been linked to myriad disorders, in addition to cognitive impairment, including cardiovascular and metabolic diseases and psychiatric disorders . Indeed,We note a number of limitations that may be addressed in future research. This study is cross sectional, so temporality cannot be established. It is conceivable that deficits in cognitive function could be a source of stress or produce stressful experiences. As eluded to earlier in the discussion, use of the MMSE may be considered a limited assessment of cognition; however, the strength of the MMSE is that it is a general measure that is widely used and understood. We evaluated relationships using two measures of psychological stress and three measures of lead exposure, raising the issue of multiple comparisons. However, we chose to make these comparisons because of reported differences between the stress and lead exposure measures in their relationship with disease. In addition, although we controlled for a number of risk factors, there is the risk of omitted or inadequately controlled confounders. In addition, this study was not conducted in a low socioeconomic population where there is a greater likelihood of dual exposure to stress and lead. Finally, there are noted differences in the association of stress with cognition and in the interactive effect among males and females (at least in laboratory studies) . This fiIn summary, our results show that stress is associated with lower cognition and modifies the relationship of age to cognition among community-dwelling older adult males. Furthermore, stress negatively modifies the relationship of blood lead and cognition, and combined high lead and high stress negatively modify the association of age with cognition."}
+{"text": "The aim of our study was to examine the memory functions of pistol sport shooters using powder charges when exposure to lead is expected to be considerably lower than in occupational circumstances.A neuropsychological battery of memory and intelligence tests was administered to 20 sport shooters and 20 controls whose mean ages (SDs) were 55 (9.6) and 54 (9.3) years respectively. Memory functions were evaluated with three subtests of the Wechsler Memory Scale - Revised (WMS-R) and an incidental memory test. Intelligence was assessed with four subtests of the Wechsler Adult Intelligence Scale - Revised (WAIS-R). The level of alcohol consumption and depression were examined in both groups. Blood lead level was determined among the shooters.The shooters performed worse than the controls in the tests of incidental and logical memory. The groups did not differ in intelligence, mood or alcohol consumption. The mean (SD) blood lead level of the sport shooters was 0.52 \u03bcmol/L (0.40), responding 10.76 \u03bcg/dl (8.28).Low lead exposure in recreational shooting conditions may impair verbal memory. Therefore it is important to ensure that lead exposure is prevented among those shooting for sport. Shooting with lead-containing bullets on indoor firing ranges is known to expose people to lead.5Numerous studies have demonstrated that occupational lead exposure is associated with low neuropsychological test performance.28Lead may affect memory, executive functions, reasoning, visual and motor functions.33The aim of this study was to examine sport shooters\u2019 memory functions since lead exposure is known to affect memory. To the best of our knowledge there is very little evidence of the neuropsychological effects caused by lead exposure in sport shooters using powder charges. We wanted to examine if lead impairs the memory functions of sport shooters as evaluated in clinical neuropsychological memory tests. We assumed that sport shooters would perform worse than controls in memory tests as a result of lead exposure.The study included 20 sport shooters and 20 controls. The study population consisted of pistol sport shooters who practised on indoor or outdoor firing ranges, mainly with unjacketed lead bullets. All sport shooters from two local shooting clubs who volunteered to participate in the study were contacted. The sport shooters had to meet the following inclusion criteria: a) at least 10 years of continuous sport shooting with lead bullets in indoor or outdoor shooting ranges, and b) male gender. The control group consisted of volunteers, who were similar to the shooters regarding to gender, age and years of education. The controls did not have any known lead exposure. The eligibility of respondents was confirmed by a subsequent questionnaire. The potential participants were excluded if any of the following criteria was met: a) neurological and/or psychiatric disease, b) alcohol or drug abuse, or c) other exposure to heavy metals and/or solvents.Each eligible respondent participated in a single two-hour neuropsychological examination. The participants completed questionnaires on personal background, alcohol consumption and shooting habits. The analysis of blood lead level was carried out only for the sport shooters.A trained examiner blind to participants\u2019 exposure administered neuropsychological tests which have been found to be useful in occupational studies. The clinical tests are shown in 34In the incidental memory testThe level of depression was assessed with the Beck Depression InventorySport shooters participated in a blood lead (PbB) analysis. Blood samples were collected one week after the neuropsychological examination. An amount of 5\u201310 mL of whole blood in heparinised vacuum tube for trace element analysis was collected. Blood lead concentration was determined with an electrothermal atomic absortion spectrophotometric methodStatistical Package for the Social Sciences (SPSS-PC version 11.5) was used for the data analysis. In the background variables  the group differences were studied with t-tests for independent groups. In the intelligence tests and in the immediate memory tests, the sums of raw scores were used, but in the delayed recalls of the memory tests percent variables. In the tests of logical memory and visual retention the percent variable was the delayed recall score as a percentage of the immediate recall score. In the verbal learning test the delayed recall score as a percentage of the third (last) immediate recall score was used. The difference between the two groups was tested with a multivariate analysis of covariance (MANCOVA) separately on the four intelligence and the nine memory variables, with age as a covariate. Correlations between the psychological test variables, the blood lead level and shooting habits were studied with Pearson\u2019s correlation coefficients. The significance level of statistical analysis was set at p \u2264 0.05.The sport shooters did not differ from the controls on the background variables . The spoThe results of the blood lead analysis and the amount of bullets fired during the last month are given in The mean blood lead level of the sport shooters was 0.52 \u03bcmol/L (responding 10.76 \u03bcg/dl), which is higher than the normal level 0.3 \u03bcmol/L (responding 6.21 \u03bcg/dl) of non-exposed people.The results of the neuropsychological tests are shown in The aim of this study was to find whether sport shooters\u2019 lead exposure has an adverse effect on memory functions. The sport shooters performed significantly worse than the controls on two verbal memory tests, namely on the immediate and delayed Logical Memory test and the incidental memory test. No other significant differences were found in the verbal or visual memory tests. The groups did not differ on the intelligence tests, on mood or alcohol consumption. To the best of our knowledge there is very little evidence so far about neuropsychological effects caused by lead exposure on firing ranges.In our study the blood lead levels among sport shooters were slightly higher than the reference limit for non-exposed people. In Finland the reference level of non-exposed people is 0.3 \u03bcmol/L (responding 6.21 \u03bcg/dl) determined by Finnish Institute of Occupational Health. The level is in balance with other papers.In studies reporting the detrimental effects of occupational lead exposure on verbal learning,There are contradictory results concerning the effect of low lead exposure on cognitive functions. On the one hand, relatively low blood lead levels  due to occupational exposure have been associated with neuropsychological deficits, for example with executive and visuospatial dysfunctions.42One limitation of this study is that it was not possible to conduct the blood lead level analysis for the control group, although it is highly likely that the lead exposure of the controls did not exceed the normal level. It is worth noting that all sport shooters had practised shooting for many years. Although the blood lead level does not indicate the effect of long-term cumulative lead exposure, our results suggest that long-term recreational lead exposure results in memory impairment. To summarize, recreational lead exposure was associated with verbal memory deficits examined in clinical neuropsychological tests. In future studies it would be interesting to examine whether recreational lead exposure has equally progressive effects on verbal or visual memory as occupational lead exposure after that exposure ceases."}
+{"text": "This study is a cost\u2013benefit analysis that quantifies the social and economic benefits to household lead paint hazard control compared with the investments needed to minimize exposure to these hazards.This research updates estimates of elevated blood lead levels among a cohort of children \u2264 6 years of age and compiles recent research to determine a range of the costs of lead paint hazard control ($1\u2013$11 billion) and the benefits of reduction attributed to each cohort for health care ($11\u2013$53 billion), lifetime earnings ($165\u2013$233 billion), tax revenue ($25\u2013$35 billion), special education ($30\u2013$146 million), attention deficit\u2013hyperactivity disorder ($267 million), and the direct costs of crime ($1.7 billion).Each dollar invested in lead paint hazard control results in a return of $17\u2013$221 or a net savings of $181\u2013269 billion.There are substantial returns to investing in lead hazard control, particularly targeted at early intervention in communities most likely at risk. Given the high societal costs of inaction, lead hazard control appears to be well worth the price. Lead poisoning is a serious hazard for children and causes significant biological and neurologic damage linked to cognitive and behavioral impairment , 2008b. Recent research has indicated that significant neurologic damage to children occurs even at very low levels of exposure . PreventA growing body of literature has detailed the economic costs and risks of lead poisoning, including several analyses summarizing these costs and setting them against the estimated costs of lead paint hazard control. However, recent research has broadened still the scope of our understanding of the societal costs of lead poisoning. For example, new studies have begun to analyze the correlation of lead poisoning with crime rates and their associated costs, as well as linking early lead exposure to adult-onset health problems. In this article I aim to comprehensively address the costs and benefits of household lead hazard control vis-\u00e0-vis new discoveries in the medical, psychological, and economic literature. I focus on children \u2264 6 years of age, because lead exposure is the highest for this age group, and this is the period when lead exposure produces the most significant damage.In this analysis, I constructed an upper and lower bound on the cost-effectiveness of strategies to reduce lead exposure. The reasoning behind this methodology is that there is no single estimate that accurately reflects either the costs or benefits of lead hazard control. On the costs side, the actual expense of reducing lead paint hazards in affected homes varies with the extent of interventions required. On the benefits side, the number of children with lead exposure ranges from those reported in state child blood lead surveillance data to those determined from weighted estimates of national surveys. Although several factors could make one extreme or another more credible, it is likely that the truth lies within this interval.Although the attention on lead and children historically has focused on BLLs of \u2265 10 \u03bcg/dL, recent evidence suggests that lower levels incur high individual and societal costs. Although community, medical, and environmental interventions have generally been initiated at a BLL of 10 \u03bcg/dL, the government has found no level of exposure to lead below which adverse health effect do not occur . BLLs beOf the 27.97 million children \u2264 6 years of age in the United States in 2006 , 24.7%, Although bans on leaded gasoline and paint have greatly reduced the incidence of dangerous lead levels in children, many children are still at risk for damaging lead exposure. Lead paint and the related dust and chips are the leading cause of high lead levels in U.S. children . NontrivOther incidental sources of household lead exposure include the manufacture of stained glass and glazed pottery, remodeling of homes, toys or pottery containing lead-based paints , certain calcium supplements including antacids and infant formula , and secUnfortunately, assessing the costs of removal of all lead hazards is difficult, so this analysis is restricted to the most common source of dangerous lead in children\u2019s environments: lead-based paint. Although I posit an adjustment for this assumption in the final sections of this article, this restriction downwardly biases the costs estimates, inflating the return on investment.Lead paint was used frequently in housing units until its ban in 1978; occupants of pre-ban houses are at a significantly greater risk for lead exposure. For these older housing units, the According to the High lead levels can cause multiple and irreversible health problems, which include learning disabilities, attention deficit\u2013hyperactivity disorder (ADHD), mental retardation, growth stunting, seizures, coma, or, at high levels, death. Previous studies have identified damaging effects of lead on the nervous, hematopoietic, endocrine, and renal systems .Treatment for low lead levels entails continuous monitoring of blood levels and prevention of further exposure, whereas higher lead levels require chemical chelation to leach lead from the body, an expensive, time-consuming, painful, and sometimes dangerous procedure. Although there is no BLL below which adverse health effects have not been observed , the cosFor children with levels ranging from 10 to 20 \u03bcg/dL, further diagnostic testing is required, necessitating venipuncture and a lead assay, followed by an additional nurse-only visit, for a total cost of $74 per child. For children with levels ranging from 20 to 45 \u03bcg/dL, the The estimated number of children affected in each group is a combination of two sets of data: pooled The estimated range includes only the direct lead treatment costs for children \u2264 6 years of age. Lead poisoning causes negative health effects later in life, such as neurologic disorders, adult hypertension, heart disease, stroke, kidney malfunction, elevated blood pressure, and osteoporosis . Many ofThe most well-established area of research on the effects of BLLs on children and society centers around the relationship between high BLLs and cognitive and behavioral impairment. Even low levels of exposure appear to lower children\u2019s IQ, which increases the need for enrollment in special education services, reduces the likelihood of high school and college graduation, lowers lifetime earnings , and greatly increases their propensity to engage in violent criminal activity. In this section I examine each of these factors in turn, assessing the evidence and determining the costs of lead exposure to the individual and society.A variety of studies analyze the effects of high BLLs on intellectual function, most frequently quantified by IQ. Data from Total IQ loss is computed for each BLL group, summed, and then multiplied by the estimated number of children affected. IQ loss from elevated BLLs falls between 9.3 and 13.1 million points. Although these losses have severe social and behavioral consequences, they also carry a significant financial burden of lost lifetime earnings.Drawing from With every loss in lifetime earnings comes an associated loss in potential tax revenue for the government. Children with high lead levels are in need of special education because of their slower development, lower educational success, and related behavioral problems. Based on the findings of In addition to the relationship of reduced IQ on lifetime earnings and the additional investments required in special education, research indicates adverse effects of lead exposure directly on educational achievement and children\u2019s readiness for school . In addiElevated BLLs are associated with an increased risk of not completing high school . Cohen eResearch by The total cost of lead-linked ADHD cases in the United States is found by computing the number of ADHD cases annually linked to early lead exposure, extracted from the study of Medical and economic research has established a connection between early childhood lead exposure and future criminal activity, especially of a violent nature. Recent work by Both clinical and econometric evidence suggest that lowered lead levels will lead to lower crime rates. A 1-\u03bcg/dL reduction in the average pre-school BLL results in 116,541 fewer burglaries, 2,499 fewer robberies, 53,905 fewer aggravated assaults, 4,186 fewer rapes, and 717 fewer murders . The totThe consequences of an antisocial and destructive pathology among lead-poisoned children are not isolated to criminal activity alone. Recent research has indicated that moderate levels of childhood lead exposure can greatly increase an individual\u2019s propensity for risk-taking activities. For instance, To demonstrate the cost-effectiveness of lead hazard control, I summed and compared the total benefits and costs of childhood lead level reduction. The costs of lead hazard control range from $1.2 to $11.0 billion. The benefits to lead hazard control is the sum of the costs for medical treatment ($11\u2013$53 billion), lost earnings ($165\u2013$233 billion), tax revenue ($25\u2013$35 billion), special education ($30\u2013$146 million), lead-linked ADHD cases ($267 million), and criminal activity ($1.7 billion), for a total of $192\u2013$270 billion. The net benefit of lead hazard control ranges from $181 to $269 billion, resulting in a return of $17\u2013$221 for each dollar invested in lead hazard control .The estimate of the benefits of controlling lead hazards presented in this paper is still quite conservative. The absolute lower bound of lead prevalence > 10 \u03bcg/dL uses state-level confirmed cases and excludes many important and potentially substantial costs. These include health care later in life, neonatal mortality, benefits of lead hazard control on property value and energy savings, community improvement, lead paint litigation, indirect costs to criminal activity, and other intangible benefits. Similarly, this analysis calculates the benefit for one cohort of U.S. children, whereas the duration of lead hazard controls are likely to endure for \u2265 6 years . IncludiThat said, the major source, lead-based paint, is by no means the only source of dangerous lead exposures among children. If a similar distribution of lead exposures or high and low BLLs are found from both lead-based paint and other types of lead hazards, a rough adjustment for other major sources of lead exposures on these benefits decreases the final benefit range by 30%, because lead-based paint represents about 70% of childhood exposure to lead . This lePublic health and housing policy has been slow to address these remaining lead poisoning risks, moving incrementally with targeted, more reactive policies. If the cost of proactive and universal lead hazard control is seen as prohibitive, the costs of inaction have proven to be significantly greater. For every dollar spent on controlling lead hazards, $17\u2013$221 would be returned in health benefits, increased IQ, higher lifetime earnings, tax revenue, reduced spending on special education, and reduced criminal activity.To put these results in perspective, it is useful to compare these net benefits to an intervention commonly understood as tremendously cost effective\u2014that of vaccinations. Cost\u2013benefit analyses show that vaccination against the most common childhood diseases delivers large returns on investment, saving between $5.30 and $16.50 in costs for every dollar spent on immunizations . Given t"}
+{"text": "Providence, Rhode Island, and Portland, Oregon, are two cities that by all accounts have well-run water utilities and health departments. Both have also had recurring problems with lead in tap water, yet both\u2014according to some critics\u2014have downplayed the potential importance of lead in tap water as a route of exposure. The experiences of these cities and others across the United States illustrate the difficulty not only of determining the causes behind specific cases of lead poisoning but also of ensuring that lead sources are eliminated.Unlike most water contaminants, lead gets into water after it leaves a water treatment plant. Often this contamination is the result of water treatment changes meant to improve water quality that end up altering the water chemistry, destabilizing lead-bearing mineral scales that coat service lines and corroding lead solder, pipes, faucets, and fixtures. \u201cLead is a \u2018close-to-home\u2019 contaminant,\u201d says Marc Edwards, an environmental engineer at Virginia Polytechnic Institute and State University. \u201cThat makes it very difficult to regulate and monitor.\u201dUnder the U.S. Environmental Protection Agency\u2019s (EPA) 1991 Lead and Copper Rule (LCR), municipal water utilities must sample a small number of homes at high risk for elevated lead levels, such as those known to have lead plumbing components. The size of the water system determines how many samples must be collected in each sampling period (the maximum required is 100), and the sampling interval can vary from 6 months to 3 years, depending on past compliance. The law requires that samples be \u201cfirst-flush\u201d water that has stood in pipes for a minimum of 6 hours. This scenario represents high but routine exposures to lead in tap water, because the longer corrosive water sits in contact with lead parts, the more lead leaches out. In many households, this worst-case normal-use scenario happens twice daily Monday through Friday: in the morning when the residents awake, and in the afternoon when they return home from work and school.Under the LCR, utilities are required to notify customers and take remedial action if more than 10% of the households sampled have tap water with lead levels exceeding 15 ppb. Remedial action might include changing chemical treatment methods to make the water less corrosive or, if treatment fails, to replace lead pipes that lie beneath publicly owned spaces such as streets and sidewalks. These provisions would seem to suggest that if a water utility is in compliance with the rule, then none of the dwellings served by the utility need worry about their tap water being a significant source of lead. Yet LCR compliance is based upon the results of sampling only a tiny percentage of the homes served. So even when a utility is entirely within LCR compliance, some consumers may unknowingly receive and consume water that contains lead levels much higher than 15 ppb.New evidence linking low-level lead exposure with cognitive deficits and other data linking lead-contaminated water with increases in the prevalence of children having blood lead levels over 10 \u03bcg/dL suggest that testing water for lead contamination should be done routinely in older cities.\u2014Bruce Lanphear, Simon Fraser University\u201cEPA as the regulator of lead in tap water and CDC [Centers for Disease Control and Prevention] with its concern for preventing lead poisoning in children should be working together to get on top of this problem,\u201d says Edwards. \u201cBut in my experience this is not occurring to the extent it should.\u201dRhode Island has one of the country\u2019s most serious lead problems. According to the Rhode Island Department of Health, the state has 3 times the U.S. average number of children with blood lead levels above 10 \u03bcg/dL, the \u201clevel of concern\u201d at which the CDC recommends intervention. The state, like most of New England, also has soft, naturally corrosive water and, with the fifth-oldest housing stock in the nation, tens of thousands of lead water pipes are still in use. In Providence alone, about 27,000 homes  have lead service lines, according to Pamela Marchand, head of the city\u2019s Water Supply Board. Despite numerous attempts to control lead corrosion by modifying the water chemistry, the utility has consistently failed to meet LCR action levels and in 2006 began replacing the publicly owned portion of the lead pipes for about 1,000 homes per year.At the same time, roughly 10% of Providence children with blood lead levels high enough to require a home inspection also have high lead levels in their tap water, confirms Rhode Island Department of Health spokeswoman Annemarie Beardsworth. From September 2003 to March 2007, the state conducted over 300 home inspections for children with elevated blood lead levels\u2014meaning 1 blood lead test result of at least 20 \u03bcg/dL or 2 test results of at least 15 \u03bcg/dL taken between 3 and 12 months apart. Samples exceeded the EPA action level of 15 ppb in 37 of the inspections, with a maximum measured concentration of 152 ppb.Compared with many other states, Rhode Island is unusually proactive in routinely collecting water samples during such home inspections. Yet standard Rhode Island protocol is to collect samples after 1 minute of flushing the target tap, which reflects a remedial measure that the health department recommends to a family after a child with elevated blood lead levels is identified. And taking samples after flushing can result in lead levels that are lower than those in unflushed samples.Michael Moore, director of the Australian National Research Centre for Environmental Toxicology at the University of Queensland, says, \u201cI am very surprised to see such high concentrations in flushed samples. Usually flushing drops the lead dramatically. In our work, fully flushed samples have lead concentrations ten times lower than first-flush samples. These levels of lead in the water could certainly cause the high blood lead levels in these children.\u201d Moore\u2019s work in the 1970s was key in revealing the link between elevated blood lead levels in children in Glasgow, Scotland, and high levels of lead at the tap.The Rhode Island Department of Health contends that water is not a primary source of lead exposure to children in any of these cases, according to Beardsworth. She points out that in Providence, both the incidence and prevalence of lead poisoning have dramatically decreased\u2014from 11.7% and 19.8%, respectively, in 1998 to 2.7% and 4.2% in 2007\u2014while the levels of lead in Providence tap water have stayed the same or increased slightly. \u201cOur opinion is that other sources are responsible [for elevated blood lead],\u201d she says\u2014even in cases where flushed samples collected at random during the day exceed 100 ppb. \u201cThe health department generally finds that lead hazards from paint, dust, and soil are the primary sources of exposure for a child with significant lead poisoning,\u201d Beardsworth says.But Bruce Lanphear, a pediatric epidemiologist at Simon Fraser University in Vancouver who has studied lead effects on children, is not as certain. He says many, if not most, urban children with blood lead levels greater than 10 \u03bcg/dL have multiple sources of lead exposure, including water. \u201cNew evidence linking low-level lead exposure with cognitive deficits and other data linking lead-contaminated water with increases in the prevalence of children having blood lead levels over ten micrograms per deciliter suggest that testing water for lead contamination should be done routinely in older cities,\u201d he says.Portland, Oregon, takes a unique approach to addressing lead in water, an approach that has won both accolades and accusations. \u201cPortland has very interesting water politics and dynamics, and people did not want to add chemicals that most utilities usually use for corrosion control,\u201d Lisa Ragain, a Portland risk communications consultant, explained at the American Public Health Association (APHA) annual meeting in Philadelphia in November 2009.  The city has opted instead for partial corrosion control combined with aggressive public education aimed at lead paint abatement.The city has no lead water pipes, but thanks to water that is naturally very corrosive, lead may leach from solder and brass plumbing that can be labeled \u201clead free\u201d but still contain up to 8% lead. Since 2000 the city has exceeded the LCR action level 5 times, most recently in 2006, according to Oregon state records. In 2005 the Portland Water Bureau implemented partial corrosion control that program manager Scott Bradway says has reduced lead in water levels by more than 75%.Compliance with the LCR could be achieved with optimized corrosion control similar to what many other cities use, according to Ragain\u2019s presentation. But based on the city\u2019s preference for minimal water treatment and the belief that paint is a more significant source of lead to children than water, Portland instead spends $500,000 annually on a public education campaign and lead paint abatement program. \u201cThis approach was a win\u2013win for community public health, reducing lead exposure across the community and across media of exposure, especially for children,\u201d says David Leland, manager of the Oregon Department of Human Services Drinking Water Program.Drinking Water: Safeguarding the District of Columbia\u2019s Supplies and Applying Lessons Learned to Other Systems praised Portland\u2019s multimedia approach, in particular pointing to the city\u2019s effective methods for notifying residents about problems.Water regulators have divergent attitudes toward Portland\u2019s approach. The state regulators are enthusiastic about the program. \u201cLook at the hierarchy of concern for lead,\u201d says Leland. \u201cNumber one was the lead from gasoline in the air, before it was banned. Now it\u2019s paint,\u201d he says. The 2004 Government Accountability Office report But Harold Rogers, EPA Region 10 Safe Drinking Water Act coordinator, notes that many Portland residents likely are being exposed to lead in drinking water without their knowledge. \u201c[Portland does] mainly do lead education\u2014that\u2019s a good thing, but it\u2019s not so good for people who unwittingly have high levels of lead at the tap,\u201d he says. The Portland Water Bureau offers free lead-in-water testing upon request, and the bureau\u2019s data on this testing give an indication of the problem mentioned by Rogers. Since 2006, 3,205 tap water samples taken by the city of Portland have been tested. Twenty-five samples of every 1,000 have measured over 15 ppb, 1 of every 100 has measured over 35 ppb, and 1 of every 1,000 has measured over 120 ppb. The highest sample, taken in August 2008, measured 910 ppb. These self-selected homes are not from the high-risk compliance sampling pool.EPA headquarters holds a similar view to Rogers. \u201cPortland Water Bureau has not exceeded the lead action level since December 2006, and the system performs extensive public outreach to educate the public about possible exposure. However, without conducting optimal corrosion control, they are still in violation of the treatment technique requirements of the Lead and Copper Rule,\u201d says EPA spokeswoman Enesta Jones. Portland can be simultaneously in and out of compliance thanks to a loophole in the LCR that allows the primary regulator, usually the state health or environmental protection department, to independently define \u201coptimal corrosion control\u201d and thus allow flexibility in water lead concentrations in order to meet other drinking water laws, according to EPA insiders.Washington Post investigative report: In 2002, \u201cthe utility dropped more than half the homes with lead higher than the federal limit, replacing them with suburban homes that had, on average, significantly lower levels, [state] records show.\u201dAnother loophole that relates to which homes are sampled for compliance monitoring may also be fostering a picture of Portland\u2019s water that is rosier than reality. Between September 2000 and November 2001, three rounds of compliance monitoring at 100 high-risk homes showed that at least 10% of the samples exceeded the 15-ppb action level. Compliance monitoring from 2002 onward showed generally lower levels of lead in tap water, an achievement the water bureau credits to higher pH levels in the water. But the lower levels also coincided with a change in the 100 high-risk homes selected for compliance monitoring, according to a 5 October 2004 Such a change in sampling \u201cgoes against the spirit of the LCR,\u201d says Jim Elder, who headed the EPA drinking water program from 1991 to 1995. \u201cThe monitoring is a dynamic protocol for sampling that is supposed to reflect constant vigilance\u2014going after the homes at risk. If you know that tap water lead is high in the city, then that\u2019s where you should look.\u201d In addition, Portland\u2019s choice between optimum corrosion control and public education is a \u201ccovert form of cap and trade,\u201d Elder says.American Journal of Diseases of Children that infants who were fed formula with 70 ppb lead had blood lead levels that spiked to an average of 14.4 \u03bcg/dL within a few months. When the formula contained 10 ppb lead, the children\u2019s blood lead was stable at an average of 7.2 \u03bcg/dL. In 1985, R. F. Lacey et al. reported in the 1 March 1985 issue of Science of the Total Environment that a 100-ppb increase in water lead levels resulted in an average increase in children\u2019s blood lead of 6.2 \u03bcg/dL.In her presentation at the November 2009 APHA annual meeting, Virginia Tech environmental engineer Simoni Triantafyllidou noted that until about 1985 water was generally acknowledged as potentially a significant source of lead exposure. Prior to this time, many studies demonstrated a strong correlation between lead in water and children\u2019s blood lead levels. The impact of lead in commercial infant formula that was marketed in 1975 and 1976 on blood lead levels was determined by Jacqueline E. Ryu et al. They reported in the September 1983 issue of the According to Triantafyllidou, the public health mindset in the United States appears to have changed in the mid 1980s with the onset of studies such as the Cincinnati Lead Study, a long-term research effort that helped put lead paint and dust front and center in the struggle to reduce children\u2019s exposure to lead. Despite its many successes, the study failed to adequately account for water, she says. \u201cThe researchers did not measure lead in water at all as part of their study. Instead, they cited a contact from the water utility, saying that lead in water samples from the distribution system had measured to be very low with a median lead concentration below the detection limit of five parts per billion,\u201d she says. \u201cPerhaps tap water would have measured very low in lead if they did check. But they did not check, and we know that samples from the distribution system are not necessarily representative of exposure at the tap.\u201dEnvironmental Research that blood lead levels correlated with higher water lead even in situations where a citywide problem with water lead was not recognized. Since 2004 drinking water has been directly linked to elevated levels of lead in children\u2019s blood in Washington, DC, North Carolina, and Maine . A February 2007 EHP research article by Marie Lynn Miranda and colleagues documented that changes in water treatment also have been linked with broad increases in children\u2019s blood lead levels. As a result, more experts believe the problem of lead in drinking water is much bigger than currently recognized.Nonetheless, a few studies continued to consider tap water as a source of lead exposure. For instance, Lanphear et al. noted in the February 1998 issue of \u201cThe problem is that water is in everyone\u2019s home,\u201d Moore explains. \u201cEven if people don\u2019t drink tap water, they cook with it. Lead slams straight into pasta. Boil up peas in contaminated water, and the lead is in the peas.\u201dMary Jean Brown, chief of the CDC Lead Poisoning Prevention Branch, says all sources of lead are important to consider, especially when it comes to children\u2019s exposure. \u201cIndividuals may have legitimate differences of opinion about the relative contribution of drinking water lead and be in total agreement about the need to remove this source of exposure,\u201d she says. \u201cIt would be a mistake to place various sources of lead in competition with each other. Identifying and removing sources of lead before children are exposed should be our focus.\u201dYet the majority public health opinion in the United States remains largely blind to water as a source of lead to children, according to Ralph Scott, former community projects director at the Alliance for Healthy Homes, who described the current situation at the National Environmental Public Health conference in Atlanta, Georgia, in October 2009. The confusion begins with questions of how\u2014or even if\u2014to sample for lead in water in the homes of children with elevated blood lead levels.The CDC and the EPA do not provide specific guidance on when and how to test water for lead. Health agencies wanting to address lead at the tap are largely on their own, says Scott, who notes that no government agency currently identifies a specific threshold amount of lead in water as a hazard. Prior to 2004, the EPA Office of Water provided the most specific information, advising that \u201clead at concentrations of 40 ppb or higher poses an imminent and substantial endangerment to the health of children and pregnant women.\u201d But in March 2004, the EPA removed this statement from its website. \u201cWhen EPA updated its website, the agency found there was no reference for that risk estimate and found no research on which it was based,\u201d says Jones.Managing Elevated Blood Lead Levels Among Young Children: Recommendations from the Advisory Committee on Childhood Lead Poisoning Prevention notes the water supply should be considered only \u201cwhen no other source of lead is found.\u201dAs a result, current official recommendations for assessing the risk of lead exposure typically omit or downplay water, says Scott. For instance, the 2002 CDC document EHP. Even in cases where lead dust is implicated and remediated, blood lead levels often fail to fall, Brown and colleagues reported in the January 2006 issue of Pediatrics. \u201cThe distribution of lead in the body is one plausible explanation of why blood lead levels in children do not decline rapidly,\u201d Brown says. She points to a study by Roberto Gwiazda et al. in the January 2005 issue of EHP that found that bone acted as an endogenous source of lead after home remediation, contributing as much as 96% of blood lead in the children studied.When a child has elevated blood lead levels, the CDC Lead Poisoning Prevention Program\u2019s state and local grantees are often the groups that direct home inspections designed to locate the source of the lead. An estimated 30% or more of cases of elevated blood lead do not have an immediate lead paint source, and no source at all can be identified for 5\u201310% of cases, according to a review by Ronnie Levin et al. in the October 2008 issue of The problem is that water is in everyone\u2019s home. Even if people don\u2019t drink tap water, they cook with it. Lead slams straight into pasta. Boil up peas in contaminated water, and the lead is in the peas.\u2014Michael Moore, University of QueenslandAccording to Lanphear, another reason for the lack of reduction may be that the current safety standard for dust lead is so lenient that even a remediated home is still hazardous. Edwards agrees with Lanphear for many cases, but also believes still another reason children\u2019s blood lead levels could fail to fall is that the remediation ignored water as an ongoing important background source of lead exposure. With a team of undergraduate students, in 2006 Edwards surveyed a group of state and local agencies on the front line of lead poisoning prevention to find out how they deal with the potential of lead exposure via drinking water. He presented the results at the November 2009 APHA meeting.The Virginia Tech students contacted agencies in 21 cities and states and received 17 responses. They found that 2 states, Connecticut and North Carolina, require water tests during home inspections of children with elevated blood lead levels. Agency staff in Arizona, Los Angeles, and Iowa told the students that they \u201coften\u201d test. Staff in Florida, Kansas, Massachusetts, New York, Nevada, Ohio, Texas, and Wisconsin said they \u201csometimes\u201d test, and respondents from Detroit, Oklahoma, Philadelphia, and Washington, DC, said they \u201cnever\u201d test.Comments made in the 2006 survey by the 8 jurisdictions that sometimes test indicated they do so very infrequently. For example, Florida officials test only if water is a suspected source. In Kansas, the water is tested if no other lead sources are found and if lead plumbing is known to exist. Massachusetts officials test the water only if a child\u2019s elevated blood lead persists after paint hazards have been addressed or if requested by the occupants. If a municipality in Nevada exceeds the 15-ppb action level, then home inspectors test. Ohio inspectors will test the water if it is a suspected source and if it is from a private well or other private supply.The Virginia Tech survey responses also revealed there is no standard protocol for sampling the water in the home of a child with elevated blood lead. If a water sample is taken at all, it tends to be obtained at the time of the inspection, in whatever way the inspector chooses to sample. This means that in the few instances when agencies do collect water, they usually do not collect samples with the high levels that normal use patterns in the United States can produce, and that are needed to characterize risk, says Levin. Moreover, says EPA corrosion chemist Michael Schock, \u201cNot only are [inspectors] not collecting a well-defined sample\u2014representing any particular kind of exposure scenario, right or wrong\u2014they are haphazardly sampling in a way that defeats any ability to make comparisons to other sites, within or outside of their particular investigation. So, there is a big loss of potentially useful information on lead exposure sources and amounts to public health agencies across the United States.\u201dSince October 2008, the EPA has been considering the possibility of long-term revisions to the LCR, according to Jeff Kempic, treatment technology and cost team leader with the EPA Office of Ground Water and Drinking Water. Among the topics being considered are sampling protocols, how utilities should determine the most at-risk housing, and whether replacing the publicly owned portion of lead water lines is beneficial. The agency is making progress, but there is no deadline for these revisions, he says.\u201cIt is very hard to persuade cash-strapped organizations trying to protect children that they need to spend money on water testing,\u201d says Scott. But reluctant municipalities might look to Washington, DC, which presents a good example of how the official attitude toward drinking water as a potential lead exposure source can change, says Scott. The city, which prior to 2006 rarely if ever tested drinking water in properties associated with elevated blood lead in children, now does so routinely\u2014and inspectors are finding some high levels. An educational fact sheet is being written by the DC Department of the Environment with input from community health advocates for parents and guardians, and the city is considering legislation that would include a ban on lead plumbing fixtures and possibly other measures to address lead levels in drinking water.International Journal of Hygiene and Environmental Health, although flushing lowered the blood lead levels in German women whose tap water contained at least 5 ppb lead, the majority of subjects considered flushing to be an unsustainable health preventative behavior in the long term. It\u2019s also difficult for many people, particularly children, to judge time when flushing.Such efforts may be especially important given the realities of human nature. Cities with a problem of lead in their water often advise residents to flush their water before drinking or cooking\u2014sometimes for as long as a minute\u2014and to never use hot water tap for food preparation. \u201cOf course it\u2019s not realistic to assume many people will follow such a recommendation,\u201d says Scott. \u201cEven if someone decides that flushing is a good idea, sixty seconds seems like forever, and even many conscientious people will grow impatient and cut the flushing short.\u201d In fact, in a study by Regina Fertmann et al. reported in the July 2004 issue of the \u201cThis entire issue of water as a source of lead for children is surrounded by assumptions that could well be masking a significant problem,\u201d says Scott. \u201cThe exposure pathway is clear\u2014from the plumbing to the tap to the child\u2014but [lead-]contaminated water looks, smells, and tastes exactly like pure water. The only way to know is to measure lead levels accurately. But we aren\u2019t. It\u2019s a sure bet you won\u2019t find something if you don\u2019t look for it.\u201dThe human body cannot use lead but will absorb and store it in various tissues, predominantly the bones and teeth; lead also circulates in the blood. People can excrete a certain amount of the lead they breathe or swallow. Efficiency of excretion depends on age.Infants and young children are believed to absorb about 40\u201350% of ingested water-soluble lead; adults absorb 3\u201310%, but this amount may increase to 50\u201360% during fasting. Studies with stable lead isotopes raise some uncertainty about the difference in estimates of gastrointestinal absorption between children and adults.If more lead is absorbed than is excreted, obviously the body burden increases. Stored lead can be released back into the blood stream during events marked by bone turnover, such as pregnancy, menopause, and bone breaks.A diet deficient in calcium, iron, and/or zincBeing in a state of increased calcium demand, such as during pregnancy and lactationGenetic factors that affect the efficiency of iron or calcium absorptionExposure to cigarette smokeLead ingestion on an empty stomachSource: U.S. EPA. 2006. Air quality criteria for lead. Washington, DC: U.S. Environmental Protection Agency), National Center for Environmental Assessment, Office of Research and Development."}
+{"text": "EHP 116:249\u2013255; Gump et al.][. This finding corroborates concerns that there is no safe level of lead exposure.Lead exposure is linked to cognitive deficits, cardiovascular disease risk, and behavioral problems, outcomes that potentially follow dysregulation of the hypothalamic\u2013pituitary\u2013adrenal (HPA) axis. In animal studies, lead exposure has heightened the release of corticosterone, the counterpart to the human stress hormone cortisol. New research now reveals for the first time a similar response in children with blood lead levels below 10 \u03bcg/dL, the action level established by the Centers for Disease Control and Prevention The researchers drew their study population from the ongoing Oswego Children\u2019s Study, a longitudinal study at the State University of New York at Oswego\u2019s Center for Neurobehavioral Effects of Environmental Toxics. Of the 169 children in the current study, blood lead levels were known for 154 prenatally (\u22641\u20136.3 \u03bcg/dL) and for 120 during infancy or toddlerhood (1.5\u201313.1 \u03bcg/dL). At the time of their participation in the current study, children were 9.5 years old.Cortisol levels vary diurnally, rising quickly after awakening and then declining steadily thereafter. To help control for this diurnal variation, tests always occurred in the late afternoon. Beginning with a brief rest period, each child\u2019s session involved submerging an arm in ice water for 1 minute and completing a series of simple tasks with intervening rest periods\u2014a standard protocol to assess neuro-endocrine response to acute stress. Saliva was collected for cortisol measurements during the first rest period and at 21, 40, and 60 minutes after the cold stressor test.The researchers controlled for numerous potentially confounding factors, including demographics, socioeconomic status, and the health, nutrition, and substance use of mothers and children. They also tested for the presence of other neurotoxicants such as poly-chlorinated biphenyls, DDE, and hexachlorobenzene in children\u2019s blood, as well as maternal mercury exposure.Pre- and postnatal blood lead were not associated with any variation in baseline cortisol levels. However, increasing blood lead levels were independently and significantly associated with increasing cortisol responses to stress. Curiously, cortisol levels remained elevated throughout the test period instead of tapering off as expected. The authors suggest that the children may have already been stressed when the test began or that 60 minutes was insufficient for cortisol levels to return to baseline.The precise mechanisms of lead\u2019s effect on the HPA axis are unclear. However, given the effects they found at relatively low lead exposures, the authors suggest that cortisol reactivity be considered in future studies as a potential mediator of lead-induced disorders."}
+{"text": "Lead exposure has long been associated with deficits in IQ among children. However, few studies have assessed the impact of lead on specific domains of behavior and cognition.We evaluated the associations between lead and different domains of neurobehavior and their relative sensitivity to lead.Z-scores to assess the relative strengths of the associations between log-blood lead and the different domains of behavior.We determined blood lead levels using a LeadCare instrument in 756 children 3\u20137 years of age attending pre- and elementary schools in Chennai, India. Anxiety, social problems, inattention, hyperactivity, and attention deficit hyperactivity disorder (ADHD), as well as executive function were assessed in children by their schoolteachers using Conners\u2019 Teacher Rating Scales-39, Conners\u2019 ADHD/Diagnostic and Statistical Manual for Mental Disorders, 4th Edition Scales (CADS), and the Behavior Rating Inventory of Executive Function questionnaires, with higher scores denoting worse behavior. Analyses were carried out using multivariate generalized estimating equations with comparisons of outcome p = 0.01), social problems , and higher scores in the ADHD index . The effect estimate was highest for global executive function .Mean blood lead level was 11.4 \u00b1 5.3 \u03bcg/dL. Blood lead was associated with higher anxiety (\u03b2 = 0.27, Higher blood lead levels in this population of young children is associated with increased risk of neurobehavioral deficits and ADHD, with executive function and attention being particularly vulnerable domains to the effects of lead. The removal of lead from sources in the environment, such as gasoline and residential paint, have resulted in declines in blood lead levels in many countries , 2005a. Many studies have shown that lead exposure is associated with significant deficits in intelligence quotient (IQ) of children . HoweverThe objective of this study was to explore the associations between lead and specific neurobehavioral outcomes such as ADHD-like behaviors, executive function, and internalizing problems (anxiety and sociability) in a cohort of children 3\u20137 years of age in Chennai, India. In addition, we investigated the shape of the dose\u2013response relationships and the relative sensitivity of the different behavioral outcomes to lead exposure.This cross-sectional study of 814 children was carried out during 2005\u20132006 in Chennai, India. Four traffic and industry zones were selected on the basis of industrial zoning information provided by the Tamil Nadu State Pollution Control Board and the Chennai traffic police department. Children 3\u20137 years of age were recruited from 12 schools (three schools within each zone). Informed consent was obtained from each child\u2019s primary caregiver. Venous blood was collected from each child, and questionnaires were administered in Tamil  to the teachers and primary caregivers  of the children. A semi-quantitative food frequency questionnaire was used to assess nutritional status. Information was collected on a family\u2019s average monthly income, educational attainment and occupation of the parents, and type of housing. Data on family size, maternal age at birth of child, and child\u2019s age, birth weight, and birth rank were also collected.This investigation was conducted as part of a collaborative study between the Harvard School of Public Health (HSPH), Boston, Massachusetts (USA), and Sri Ramachandra Medical College and Research Institute (SRMC), Chennai, India, on lead genetics and neurotoxicity. The study was approved by institutional review boards at HSPH, SRMC, the University of Michigan, and the Indian Council for Medical Research, New Delhi, India, and complied with U.S. federal and Indian regulations and laws regarding research on human subjects.Blood was collected from the cubital vein of each child into lead-free tubes  by a trained phlebotomist during a school day. The blood was transferred to the laboratory at SRMC, and blood lead was measured using Anodic Stripping Voltammetry by a LeadCare Analyzer , which is a well-validated field instrument with sensitivity of 1 \u03bcg/dL blood lead . Duplicaa) the Conners\u2019 ADHD/Diagnostic and Statistical Manual for Mental Disorders, 4th edition (DSM-IV) Scales (CADS-T) (b) an older version of the Conners\u2019 Teachers Rating Scales (CTRS-39) (c) the Behavior Rating Inventory of Executive Function (BRIEF)  ; b) an oCTRS-39)  that con (BRIEF) . For allThe CADS-T is a self-administered questionnaire for teachers comprising 27 questions that assess behaviors associated with ADHD. It yields three scores: ADHD index score, DSM-IV inattentive-impulsive subscale, and DSM-IV hyperactive subscale. The ADHD index was empirically derived from the 12 items best differentiating children with ADHD from nonclinical children in several large data sets. The items that comprise the DSM-IV inattentive-impulsive and hyperactive scales correspond to the DSM-IV criteria for ADHD diagnosis.The CTRS-39 consists of 39 questions used to assess internalizing and externalizing dimensions of behavior with five subscales: aggressivity, inattentiveness, anxiety, hyperactivity, and sociability. However, because this is an older version of the CTRS-39, we chose to use only the subscales that did not overlap with those of the CADS-T, namely, anxiety and sociability.a) behavioral regulation index , and b) metacognition index . These scales were derived theoretically and empirically, and good convergent validity was observed with other measures of inattention, impulsivity, and learning skills  were identified using extreme studentized deviate  using random effects mixed models. Because most outcomes were not normally distributed and covariance within the levels did not fit a specified structure, we chose to account for the clustering of observations in the marginal models with generalized estimating equations (GEE) which use quasi-likelihood methods for estimation .Scores on the different subscales of the CADS-T and CTRS were analyzed separately. For executive function, the BRIEF global executive composite score was analyzed first, and because a significant association was found, further analyses were then carried out on the subscale scores.Z-scores with respect to sex and age (similar to the process used to create T-scores in psychometric tests). Analyses were carried out on the resulting Z-scores and compared with the analyses using raw scores to determine the consistency of the results.Because there are no normative data on these questionnaires for Indian children, we standardized raw scores internally by computing Z-scores as repeated measures of neurobehavior and added an indicator (dummy) variable for each neurobehavioral domain. The association between blood lead and a particular neurobehavioral domain was considered significant if the interaction term for lead and the dummy-coded domain variable had a p < 0.05. Similar analyses were carried out to investigate differences between BRIEF subscales of executive functions and between the CADS-T ADHD index score, DSM-IV inattentive and hyperactivity subscales.To ascertain whether the associations with blood lead differed across neurobehavioral domains , we treated the We explored dose\u2013response relationships using generalized additive models within mixed models, accounting for clustering, using R statistical software . When nonlinearity was present, the penalized spline model was compared with the linear model using Akaike\u2019s information criterion and generalized cross-validation.Mean (\u00b1 SD) blood lead was 11.4 \u00b1 5.3 \u03bcg/ dL  and 54.5% of the children had blood lead levels > 10 \u03bcg/dL. Blood lead was associated with markers of socioeconomic status, with higher blood lead observed among those who had lower average family monthly income  and greater number of children in the family. Significantly lower blood lead levels were noted among children whose parents had finished college .Bivariate analyses indicated a trend of higher  behavioral scores with increasing blood lead concentrations .Z-scores (indicating worse behavior). The use of Z-scores versus raw scores did not change the overall direction or significance of the associations , sex, hemoglobin level, family average monthly income, maternal and paternal education, and number of children in the family, showed that higher blood lead level was associated with higher behavioral raw and ciations . NeverthZ-score (p = 0.017) and 0.20 higher sociability Z-score (p = 0.027). On the CADS-T, blood lead was associated with higher ADHD index Z-scores and DSM-IV inattentive,  but not hyperactive. On the BRIEF, the global executive composite score was strongly associated with higher blood lead level (p < 0.001).On the CTRS-39, a one-unit increase in log blood lead was associated with 0.27 higher anxiety p < 0.001), with a change of 0.42 Z-scores per increase in one unit of log blood lead. Within the behavioral domains of ADHD, a one-unit change in log blood lead was associated with an increase of 0.24 Z-score of attention compared with 0.13 points of Z-score of hyperactivity and was significantly different (p < 0.05). There were no significant differences between the effects of lead within the different domains of executive function  through responsiveness and verbal stimulation . This finding is consistent with studies that report significant associations with perseverative errors (indicating an inability to shift attention) in the Wisconsin Card Sorting Test and the California Verbal Learning Test .N-methyl -aspartate (NMDA) receptor complex, which is associated with learning and memory, is affected by lead exposure in animals  and vulnerable to the long-term effects of lead exposure. These findings likely have implications not only for the Indian population, but for other populations in developing countries where similar lead exposure scenarios exist."}
+{"text": "Given the association between iron deficiency and lead absorption, we hypothesized that variants in iron metabolism genes would predict higher blood lead levels in young children.HFE) and transferrin (TF) genes and blood lead levels in 422 Mexican children.We examined the association between common missense variants in the hemochromatosis (HFE (H63D and C282Y) and TF (P570S) variants. Blood lead was measured at 24, 30, 36, 42, and 48 months of age. A total of 341 subjects had at least one follow-up blood lead level available and data available on covariates of interest for inclusion in the longitudinal analyses. We used random-effects models to examine the associations between genotype  and repeated measures of blood lead, adjusting for maternal blood lead at delivery and child\u2019s concurrent anemia status.Archived umbilical cord blood samples were genotyped for HFE H63D, HFE C282Y, and TF P570S variants, respectively. One percent of children carried both the HFE C282Y and TF P570S variants, and 3% of children carried both the HFE H63D and TF P570S variants. On average, carriers of either the HFE  or TF  variant had blood lead levels that were 11% and 10% higher, respectively, than wild-type subjects. In models examining the dose effect, subjects carrying both variants  had blood lead 50% higher than wild-type subjects and a significantly higher odds of having a blood lead level > 10 \u03bcg/dL .Of 422 children genotyped, 17.7, 3.3, and 18.9% carried the HFE variants are associated with increased blood lead levels in young children. The joint presence of variant alleles in the HFE and TF genes showed the greatest effect, suggesting a gene-by-gene-by-environment interaction.Iron metabolism gene variants modify lead metabolism such that  Despite efforts to reduce lead in the environment by removing lead in gasoline and banning lead-based paint, an estimated 310,000 U.S. children 1\u20135 years of age have elevated blood lead levels . In deveBecause of the well-described inverse relationship between iron stores and lead absorption , iron meHFE) gene account for most cases: the C282Y and H63D variants, which are common in the U.S. population, with a prevalence of 7\u201317% and 10\u201332%, respectively (Iron absorption is regulated by iron stores and erythropoiesis  and is iectively .HFE gene on iron absorption depend on the complex relationship between HFE and the transferrin receptor (TfR)  is P570S, with a prevalence rate of about 15% in the general population (Transferrin forms a stable complex with the HFE protein to facilitate iron transfer . It has or (TfR) . Feder epulation .H63D or C282Y  were associated with blood lead levels in children.Previous reports suggest that subjects with clinical hemochromatosis have higher  or equivor C282Y . The dif4 report , we hypoStudy participants were identified from among pregnant women receiving antenatal care between 1994 and 1995 at three hospitals in Mexico City that serve low- to middle-income populations. The women were approached before giving birth to participate in a randomized trial of calcium supplementation to lower blood lead levels over the course of lactation . Infant Data collection methods and exclusion criteria have been described in detail elsewhere . Intervin = 520). Children were subsequently assessed for neurocognitive development, and blood lead levels were obtained at 24, 30, 36, 42, and 48 months of age. Data on the neurocognitive test performance are presented elsewhere  at the ABC Hospital Trace Metal Laboratory in Mexico City according to a technique described by Complete blood count  in manually diluted samples of whole blood  and serum ferritin  were measured using standard clinical methods at the ABC Hospital.We extracted high-molecular-weight DNA from white blood cells of archived umbilical cord blood with commercially available PureGene Kits . After DNA quantification, samples were adjusted to TE buffer , partitioned into aliquots, and stored at \u221280\u00b0C. Multiplex polymerase chain reaction (PCR) assays were designed using Sequenom SpectroDESIGNER software  by inputting sequence containing the single nucleotide polymorphism (SNP) site and 100 base pairs of flanking sequence on either side of the SNP. The extension product was then spotted onto a 384-well spectroCHIP  before being flown in the MALDI-TOF (matrix-assisted laser desorption ionization\u2013time of flight) mass spectrometer .HFE) C282Y (rs1800562) and H63D (rs1799945) , and transferrin (TF) P570S (rs1049296) . Specifically, the following primers were used in the multiplex assay:For this study, we included three SNPs: hemochromatosis (HFE H63D (rs1799945): forward PCR primer, 5\u2032-ACGTTGGATGTCTACTG-GAAACCCATGGAG-3\u2032; reverse PCR primer, 5\u2032-ACGTTGGATGTTGAAGC-TTTGGGCTACGTG-3\u2032; extension primer 5\u2032-GCTGTTCGTGTTCTATGAT-3\u2032For HFE C282Y (rs1800562): forward PCR primer, 5\u2032-ACGTTGGATGTACCCCA-GATCACAATGAGG-3\u2032; reverse PCR primer, 5\u2032-ACGTTGGATGTGGATAAC-CTTGGCTGTACC-3\u2032; extension primer 5\u2032-GAAGAGCAGAGATATACGT-3\u2032For TF P570S (rs1049296): forward PCR primer, 5\u2032-ACGTTGGATGTGAGTTG-CTGTGCCTTGATG-3\u2032; reverse PCR primer, 5\u2032-ACGTTGGATGATCTTTC-CGTGTGACCACAG-3\u2032; extension primer, 5\u2032-CGCATACTCCTCCACAG-3\u2032.For HFE and TF alleles and genotypes and tested frequencies using a chi-square statistic to compare observed and expected counts according to principles of Hardy\u2013Weinberg equilibrium. A priori the two HFE variants (H63D and C282Y) were combined into a single indicator term , and subsequent analyses compared carriers of HFE or TF variants with wild-type subjects, thus assuming dominant effects. We calculated summary statistics for child characteristics, stratified by genotype. Bivariate associations between children\u2019s blood lead, ferritin, and hemoglobin levels by genotype (wild type vs. carrier) at each time point were compared using Student\u2019s t-test.We examined distribution of HFE and TF genotype and repeated measures of log-transformed blood lead in separate models. These models are flexible with respect to imbalance in the data and, in addition, take into account the correlation between repeated measures on subjects. To explore a possible gene\u2013gene interaction between HFE and TF genotypes in predicting blood lead, we modeled combined HFE plus TF joint genotype as a dichotomous variable (any variant present vs. both wild type) and then, to assess allele \u201cdose\u201d effects, as an ordinal variable  with wild type for both variants as the reference group. Separate models were repeated controlling for concurrent hemoglobin and concurrent ferritin to account for potential differences in dietary iron intake. We also constructed two-way interaction terms between HFE and TF genotype, and between each gene and lead, hemoglobin, and ferritin levels at each time point to explore potential interactions. Finally, we used logistic regression (PROC NLMIXED) to examine the odds of having a blood lead level \u2265 10 \u03bcg/dL associated with presence of gene variants. All statistical analyses were performed using SAS software version 9.1.3 .Blood lead levels followed a log-normal distribution and were log transformed for the analyses; thus, beta coefficients from regression models represent percent change in blood lead. We used multivariate linear regression to model the effect of genotype on blood lead in cross-sectional analyses at each time point, adjusting for maternal blood lead level at delivery  and child\u2019s concurrent anemia status (as a marker of dietary iron intake). Anemia was defined as a hemoglobin concentration < 12.1 g/dL, based on recommendations for children 2 to < 5 years of age living at an altitude of 7,000\u20137,999 feet above sea level . We usedHFE H63D, HFE C282Y, and TF P570S variants, respectively , but these differences were non-significant (HFE + TF genotype) were consistently higher (at any age) than subjects who were wild type, although these differences were also not statistically significant (Unadjusted mean blood lead levels were consistently higher for carriers of either the nificant . There wnificant .HFE or TF) and blood lead level (at any age) was non-significant (data not shown). However, in the longitudinal analysis  adjusting for covariates , the relationship between HFE genotype and blood lead was statistically significant , and the relationship between TF genotype and blood lead was borderline significant   . Thus, ounadj = 0.37, p = 0.02) between the HFE and TF genotypes and, when adjusted for maternal blood lead level at delivery and child\u2019s concurrent anemia status, this interaction term was marginally significant  (data not shown). There were no significant interactions between either gene with concurrent hemoglobin or with concurrent ferritin concentration (data not shown).There was a statistically significant unadjusted gene-by-gene interaction  versus both wild type. The dichotomous combined HFE + TF genotype was not significantly related with blood lead (at any age) in cross-sectional models (data not shown). Next, we defined a combined joint genotype by grouping subjects into four categories  to examine the dose effect for presence of gene variant(s). This specification did not reveal any statistically significant associations with blood lead (at any age) in cross-sectional models (data not shown).We then examined the data to explore whether there was an interactive effect of the presence of both p = 0.07) was similar to having either HFE  or TF  variant compared with subjects who were wild type for both variants  than subjects who carried either TF variant/HFE wild type  or HFE variant/TF wild type  (HFE and TF. These results were unchanged when adding concurrent ferritin or concurrent hemoglobin (in place of anemia status) as covariates in our models (data not shown).In longitudinal models, the result of having any variant present  . TherefoHFE or TF (any) variant present had significantly higher odds of having a blood lead greater than or equal to 10 \u03bcg/dL  compared with those who were wild type. Those subjects with both variants present had significantly higher odds of having a blood lead \u2265 10 \u03bcg/dL  compared with those wild type for both HFE and TF, though the wide CIs are attributed to the fact that < 5% of our study population had both variants present.HFE variant genotype had blood lead levels 11% higher than wild-type subjects. Furthermore, carriers of both HFE and TF variant alleles had 50% higher blood lead levels compared with wild-type subjects in models comparing the joint effect of combined HFE + TF genotype on blood lead levels. Those subjects with both gene variants present also had significantly higher odds of having a blood lead level \u2265 10 \u03bcg/dL. Our results suggest that genes affecting iron metabolism also affect lead metabolism, and this impact may be magnified by the presence of multiple genotypic variant alleles.In our current study of Mexican children, carriers of the HFE variant carriers. In another study, This is the first study to examine the association between iron metabolism genes and lead exposure in children. There are at least three previous reports in adults or studies of mixed ages. H63D or C282Y) carriers in a group of elderly men. These results contrast particularly with those of HFE gene effect on blood lead level may vary by age because of these differences in iron stores/needs that correlate with age/sex, and that in a younger population with higher body iron needs, the effect of HFE variants may be to increase lead absorption among variant carriers. Conversely, in an older population of elderly males, the HFE variant effect may be attributable to down-regulation of iron and lead absorption, because iron stores in men are higher than in women. Our current study supports this hypothesis; in a population of young children with high body-iron needs, we found higher blood lead levels among HFE variant carriers. This study is among the first to present evidence that gene environment interactions may vary by life stage.In a previous population-based cohort study , we founHFE + TF combined genotype on blood lead levels in children. Our results suggested that iron metabolism and body lead burden are affected more profoundly by the joint presence of genotypic variant alleles in both HFE and TF. Given the relatively small sample size to detect gene\u2013gene or gene\u2013environment interactions, we used longitudinal random\u2013effects models, because these models are flexible with respect to imbalance in the data. We were able to include subjects with incomplete data to increase the power of the study to detect these effects.In addition, our current study explored the interactive effect of C282Y variant  than people from Europe (9.2%) and the Americas (9.0%), but a higher prevalence than people from Africa/Middle East (0.2%), the Indian subcontinent (0.5%), Asia (0%), and Australia (0%) (C282Y variant (heterozygotes), it will be important to replicate this study in different populations. The potential for misclassification should also be considered, because there may be other polymorphisms in the HFE or TF genes or in a proximal gene that is in tight linkage disequilibrium with these genes that could account for our findings. Residual confounding is always a concern in observational studies. We chose covariates for this analysis based on biological plausibility as confounders . Among common predictors of blood lead, few are likely associated with HFE or TF genotype. For example, HFE and TF are not X-linked; therefore, sex should not be a confounder because it is not associated with HFE or TF genotype, and any sex-related differences due to menstruation are not yet an issue in a pre-pubescent population. Genotype should also be independent of environmental lead levels. Iron status is plausibly related to blood lead and HFE genotype  as well as child\u2019s concurrent anemia status (to account for differences in dietary iron intake).There are several limitations to our study. Our sample was restricted to a homogeneous sample of Mexican children with a lower prevalence of the lia (0%) . Therefogenotype , but shoHFE and TF, and ours is not the first study to find synergy between these two variant alleles. The HFE gene product regulates the binding of transferrin to transferrin receptors, which in turn regulates the transfer of iron  across cell membranes  and risk for multiple myeloma, breast cancer, and colorectal cancer. In their study, the HFE and TF genotypes tested separately were not associated with any of these neoplastic disorders, but there was a significant difference between patients and controls with respect to the two genotypes combined.With respect to the gene-by-gene interaction findings, a limitation of this study is that carriers of both variants represent < 5% of our study population, and even though the result is statistically significant, this could be a chance finding. However, there is biological plausibility to the relationship between embranes . Furtherembranes . FurtherHFE genotype is associated with higher blood lead levels in Mexican children over time. Our results also suggest an interaction between HFE and TF genotype in predicting higher blood lead in young children. These results differ from reports in elderly adults in which HFE variants predicted lower blood lead levels, demonstrating that genetic effects differ by life stage.Fok1 variant to be an effect modifier of the relationship of floor dust lead exposure and blood lead concentration (In conclusion, iron deficiency has been associated with increases in absorption and deposition of lead ; howeverntration . In combntration . Guilartntration . These r"}
+{"text": "Few studies provide data directly relevant to the question of whether blood lead concentrations < 10 \u03bcg/dL adversely affect children\u2019s cognitive function.We examined the association between blood lead concentrations assessed throughout early childhood and children\u2019s IQ at 6 years of age.Children were followed from 6 months to 6 years of age, with determination of blood lead concentrations at 6, 12, 18, and 24 months, and 3, 4, 5, and 6 years of age. At 6 years of age, intelligence was assessed in 194 children using the Wechsler Preschool and Primary Scale of Intelligence\u2013Revised. We used general linear and semiparametic models to estimate and test the association between blood lead concentration and IQ.p = 0.006) and Performance IQ scores (p = 0.002). Compared with children who had lifetime average blood lead concentrations < 5 \u03bcg/dL, children with lifetime average concentrations between 5 and 9.9 \u03bcg/dL scored 4.9 points lower on Full-Scale IQ . Nonlinear modeling of the peak blood lead concentration revealed an inverse association (p = 0.003) between peak blood lead levels and Full-Scale IQ down to 2.1 \u03bcg/dL, the lowest observed peak blood lead concentration in our study.After adjustment for maternal IQ, HOME scale scores, and other potential confounding factors, lifetime average blood lead concentration  was inversely associated with Full-Scale IQ (Evidence from this cohort indicates that children\u2019s intellectual functioning at 6 years of age is impaired by blood lead concentrations well below 10 \u03bcg/dL, the Centers for Disease Control and Prevention definition of an elevated blood lead level. Cohort studies of children during the 1980s in North America, Europe, and Australia documented that blood lead concentrations of at least 10 \u03bcg/dL are inversely associated with cognitive test scores in children . These fPreventing Lead Poisoning in Young Children was issued in 2005 . All analytical measurements for blood lead were carried out in the Wadsworth Center\u2019s Lead Poisoning and Trace Elements Laboratory , using a well-established method based on electrothermal atomic absorption spectrometry (ETAAS) . The WadThe analytic procedure for lead determination was as follows: Whole blood was diluted 1:9 with phosphate modifier, and a 12-\u03bcL aliquot was injected into a Model 4100ZL atomic absorption spectrometer equipped with a transverse-heated graphite atomizer (THGA) and a longitudinal Zeeman-effect background correction system . The THGA instrument was calibrated daily before each run with aqueous lead standards traceable to the National Institute of Standards and Technology . Three concentrations of New York State Department of Health  blood-based reference materials (including one < 10 \u03bcg/dL) were analyzed before, during, and after each analytical run as part of the laboratory\u2019s internal quality assurance program . AdditioChildren were administered the Wechsler Preschool and Primary Scale of Intelligence, Revised, (WPPSI-R) during their 6-year visit at the Rochester General Hospital in Rochester by an examiner trained in pediatric neurobehavioral testing . The WPPa) lifetime average blood lead concentration, computed by dividing the total area under each child\u2019s age-by-blood-lead curve by 66 (72 months \u2013 6 months); b) concurrent blood lead concentration, the blood lead concentration measured on the day of cognitive testing at 6 years of age; c) infancy average blood lead concentration (area under the child\u2019s age-by-blood-lead curve from 6 to 24 months); and d) peak blood lead concentration, the child\u2019s highest measured blood lead concentration from 6 months through 6 years of age. We used conditional means regression to impute 131 missing age-specific blood lead measures  before construction of the lead exposure variables.We constructed four exposure variables from the eight blood lead measures: At each semiannual visit, a parent or guardian was interviewed to obtain information about their child\u2019s medical history and demographic information about the respondent, child, and his or her family. Birth records provided data on perinatal factors including parity, birth weight, and gestational age at birth. The Home Observation for Measurement of the Environment Inventory (HOME)  was admia priori and used in a previous report from this cohort  and each WPPSI-R IQ score . Blood lead was modeled categorically to reduce the influence of outlying blood lead values and to demonstrate differences in mean IQ across blood lead groups. Categories were defined as < 5 \u03bcg/dL (reference), 5.0\u20139.9 \u03bcg/dL, and \u2265 10 \u03bcg/dL for lifetime average, concurrent, and infancy average blood lead concentration. Because of the greater range of values for peak blood lead, concentrations \u2265 10 \u03bcg/dL were divided further into two categories: 10.0\u201314.9 \u03bcg/dL and \u226515.0 \u03bcg/dL. These natural categories were chosen for their potential relevance to decision making in clinical and health policy settings and to ensure adequate numbers of subjects in each category. We pre-specified a general linear model that included the same predictors of child IQ that had been selected Because of our previous research indicating a nonlinear dose\u2013response relation and confirmation of this in the analyses in which lead measures are modeled categorically, we conducted a secondary analysis of peak blood lead levels in relation to Full-Scale IQ. This analysis also makes full use of the quantitative nature of the measured lead concentrations. We modeled peak blood lead as the exposure of interest because analysis of this variable helps answer the public health question of setting a maximum allowable blood lead concentration for developing children.We estimated the dose\u2013response relation using a generalized additive model (GAM), employing a locally weighted scatterplot smooth (LOESS) on the quantitative peak blood lead variable. This model was implemented in SAS version 9.1 (SAS Institute Inc.) using the GAM procedure, specifying a LOESS smoother with 2 degrees of freedom. This semi-parametic GAM model allowed us to adjust parametrically for the same covariates used in the linear analyses and at the same time estimate the association between peak blood lead concentrations and IQ nonparametically. We truncated the top 3% of peak blood lead values  to ensure that the shape of the dose\u2013response relation was not influenced by outlying values.n = 174), those with missing covariate information (n = 20), and those not participating at 6 years (n = 48). Except for maternal IQ, characteristics among the three groups were similar.Of the 194 children and families participating when the child was 6 years of age, 174 had complete information on all explanatory variables and are included in the results described below. Distributions of each blood lead measure are given in r = 0.52, p < 0.001), and with the children\u2019s own scores on the Stanford-Binet IV, previously administered at 3 and 5 years of age , at magnitudes consistent with the standardization samples for these instruments (The mean (\u00b1 SD) Full-Scale IQ score at 6 years of age was 85 \u00b1 14 , consistent with previous IQ assessments in this cohort . Full-Scs of age  (r = 0.7truments .p = 0.006 for trend) and Performance IQ (p = 0.002 for trend) and marginally associated with Verbal IQ (p = 0.11 for trend) (p = 0.03) and 4.9 points lower on Performance IQ  (p = 0.34). A similar pattern was noted for Performance IQ .After covariate adjustment, lifetime average blood lead concentration was inversely associated with Full-Scale (r trend) . Compare = 0.03) . Mean Fup = 0.03 and p = 0.004 for trend, respectively), but not with Verbal IQ (p = 0.28 for trend) after adjustment (p = 0.10), and 3.2 points higher than estimated for children with concurrent blood lead concentrations \u2265 10 \u03bcg/dL . For Performance IQ, children with concurrent blood lead concentrations between 5 and 9.9 \u03bcg/dL scored an average of 5.5 points lower than children with concurrent blood lead concentrations < 5 \u03bcg/dL , but the estimated Performance IQ for children with concurrent blood lead concentrations \u2265 10 \u03bcg/dL was only 2.7 points lower than children with concurrent blood lead concentrations between 5 and 9.9 \u03bcg/dL .A dose\u2013response relation also was observed between concurrent blood lead concentrations and Full-Scale and Performance IQ  (p = 0.34 for trend). Consistent with results from the lifetime average and concurrent blood lead measures, a dose\u2013response function was observed, with larger Full-Scale and Performance IQ decrements occurring between blood lead categories < 5 \u03bcg/dL and 5\u20139.9 \u03bcg/dL than between blood lead categories 5\u20139.9 \u03bcg/dL and \u2265 10 \u03bcg/dL (p = 0.02) and 5.4 points lower on Performance IQ  than did children with infancy average blood lead concentrations < 5 \u03bcg/dL.Adjusted Full-Scale and Performance IQ scores were associated with infancy average blood lead concentrations (ctively) . However10 \u03bcg/dL . Notablyp = 0.03 and p = 0.02 for trend, respectively). Verbal IQ exhibited a less consistent trend with peak blood lead concentration (p = 0.19 for trend) (p = 0.09), but only a 2.3-point IQ difference was observed comparing groups 2 and 3 , and an even smaller difference was observed comparing groups 3 and 4 . A similar pattern was observed for Performance IQ.Both Full-Scale and Performance IQ exhibited a dose\u2013response relation with peak blood lead concentration. Again, lower IQ scores were associated with higher peak blood lead concentrations (r trend) . Comparip = 0.003) between the child\u2019s maximum (peak) blood lead concentration and Full-Scale IQ was apparent down to 2.1 \u03bcg/dL, the lowest measured peak concentration in our sample. Further, the slope of the blood lead\u2013IQ relation was steeper at lower than at higher levels of exposure. For instance, IQ decreased by approximately 1.2, 0.32, and 0.15 points per 1-\u03bcg/dL increase in peak blood lead over the range of 2.1\u201310 \u03bcg/dL, 10\u201320 \u03bcg/dL, and 20\u201330 \u03bcg/dL, respectively.A plot of the nonlinear relation between peak blood lead and Full-Scale IQ is shown in The findings of this study are directly relevant to the question of whether blood lead concentrations < 10 \u03bcg/dL adversely affect children\u2019s cognitive functioning: Blood lead was measured on up to eight occasions during infancy and early childhood; the lifetime average blood lead concentration was 7.2 \u03bcg/dL, and more than half of the children never had a measured blood lead concentration of \u2265 10 \u03bcg/dL; we gathered extensive information about influences other than lead exposure that are known to affect intellectual development; and we assessed intelligence at an age when IQ is measured reliably and is a strong predictor of intelligence during adolescence and adulthood. The results show that childhood blood lead concentrations are inversely related to IQ scores, whether lead exposure is measured by lifetime and infancy average measures, maximal (peak) exposure, or on the same day the IQ test is administered. This pattern of findings is most apparent for the Full-Scale and the Performance IQ scores. In particular, children with blood lead concentrations in the 5\u20139.9 \u03bcg/dL range had significantly lower IQ scores than children who had blood lead concentrations < 5 \u03bcg/dL. Further, additional nonlinear analysis of peak exposure throughout early childhood indicated that blood lead levels as low as about 2 \u03bcg/dL may be associated with declines in Full-Scale IQ. These findings also add to the body of evidence that the effect of blood lead on child intellectual development is larger for equal increments of lead < 10 \u03bcg/dL than it is at higher levels.The analytic approach in this study allowed for direct comparisons between children with blood lead concentrations < 5 \u03bcg/dL with those who had levels > 5 \u03bcg/dL but still below the CDC definition of an elevated blood lead level . The declines in IQ observed with this approach reinforce the conclusions of previous findings from this cohort  that chiA second pattern in our data is that Performance IQ is more strongly associated with blood lead levels than is Verbal IQ. This result is consistent with the findings from other cohort studies. In particular, considering the 15 relevant cognitive assessments of children from 3\u201313 years of age in these studies, 11 find blood lead levels associated with poorer performance on Performance IQ or related tests of visual\u2013spatial or visual\u2013motor functioning . For thrin utero exposures and neurodevelopment  among all children in the United States between 1 and 5 years of age declined from 77.8% in 1976\u20131980 to just 1.6% in 1999\u20132002 . It can Important decisions about school placement, aptitude for college work, and opportunities for training and advancement in the workplace are often based on an individual\u2019s performance in relation to arbitrary cutoff scores on IQ-like tests . Thus, a"}
+{"text": "Recent data indicate that chronic low-level exposure to lead is associated with accelerated declines in cognition in older age, but this has not been examined in women.We examined biomarkers of lead exposure in relation to performance on a battery of cognitive tests among older women.Patella and tibia bone lead\u2014measures of cumulative exposure over many years\u2014and blood lead, a measure of recent exposure, were assessed in 587 women 47\u201374 years of age. We assessed their cognitive function 5 years later using validated telephone interviews.p = 0.04), similar to the difference in cognitive scores we observed between women who were 3 years apart in age.Mean \u00b1 SD lead levels in tibia, patella, and blood were 10.5 \u00b1 9.7 \u03bcg/g bone, 12.6 \u00b1 11.6 \u03bcg/g bone, and 2.9 \u00b1 1.9 \u03bcg/dL, respectively, consistent with community-level exposures. In multivariable-adjusted analyses of all cognitive tests combined, levels of all three lead biomarkers were associated with worse cognitive performance. The association between bone lead and letter fluency score differed dramatically from the other bone lead-cognitive score associations, and exclusion of this particular score from the combined analyses strengthened the associations between bone lead and cognitive performance. Results were statistically significant only for tibia lead: one SD increase in tibia lead corresponded to a 0.051-unit lower standardized summary cognitive score (95% confidence interval: \u22120.099 to \u22120.003; These findings suggest that cumulative exposure to lead, even at low levels experienced in community settings, may have adverse consequences for women\u2019s cognition in older age. Impaired cognition and cognitive decline in older age are associated with heightened risks of subsequent physical disability  and hospThese modifiable risk factors potentially include exposures to environmental toxicants, and among the most historically pervasive and well-established neurotoxic pollutants is lead. Lead has been shown to be neurotoxic at progressively lower doses in children  and at hThe measure of lead exposure is a critical feature of any study that examines lead exposure and cognition among older, community-exposed women in the United States Blood lead level is a gauge of recent lead dose, in contrast to concentration of lead in bone, which is an integrative measure of lead exposure over many years, in addition to being an endogenous source of lead . Thus, bTherefore, to better characterize the effects of recent and cumulative lead exposure on cognition in older women, we conducted a prospective study of both bone and blood lead levels in relation to cognitive function in a cohort of older, community-exposed women, hypothesizing that measures of lead exposure would be related to worse performance on the cognitive tests, but that associations would be stronger for bone lead levels, measures of cumulative exposure.The Nurses\u2019 Health Study (NHS) began in 1976 when 121,700 registered nurses, 30\u201355 years of age and living in 11 U.S. states, returned a questionnaire on their medical history and health-related behaviors . Since t2). Women who remained free of major, chronic disease from 1990 to 1994 were invited to participate as controls, and women who first reported a diagnosis of hypertension between 1990 and 1994 were invited to participate as cases. Controls were frequency matched to cases by 5-year age groups. In total, between 1993 and 1995, 301 NHS participants agreed to participate and attended our outpatient General Clinical Research Center (GCRC), where they underwent the study evaluation, including measurement of their lead exposure.Our study population came from two sub-samples of the NHS cohort that had previously been evaluated for lead exposure. The first was a sample of women participating in a case\u2013control study of lead exposure and hypertension . We inviThe women in the second sample were originally recruited for a cohort study of lead exposure and osteoporosis. Similar eligibility criteria used for controls in the hypertension study applied here, with participants being free of chronic diseases during the recruitment period from 2000 to 2004. In total, 320 NHS participants attended our outpatient GCRC for evaluation including lead exposure assessment. In both studies of lead exposure, we measured lead content in blood and in both cortical and trabecular bone.Cognitive assessments occurred from 1995 to 2005. Of the 621 women who participated in the lead exposure studies, 6 had died and 3 were too ill to participate in a cognitive assessment. We were unable to contact 17. Of those remaining, 8 (1.3%) declined participation. Thus, 587 women had cognitive assessments. Our analyses of tibia and patella bone lead included, respectively, all (587) and nearly all (586) of these women; 581 women had valid blood lead measurements and were included in analyses of blood lead and cognitive function.Participants visited the outpatient GCRC of the Brigham and Women\u2019s Hospital for measurement of lead content in their bone by K-X-ray fluorescence (KXRF), a noninvasive technique for measuring skeletal lead content that can distinguish among very low lead burdens . The KXRBone lead measurements were made at each woman\u2019s mid tibial shaft and patella. These sites are targets for bone lead research because the tibia consists mainly of cortical bone, and the patella of trabecular bone. The half-life of lead in trabecular bone varies by age and previous exposure, but in a cohort of older men, it has been estimated to be 8 years, whereas the half-life of lead in cortical bone is on the order of decades .When we began measuring the women\u2019s bone lead, we used an instrument developed by ABIOMED . A technical description and validity specifications of this instrument have been published elsewhere . In 1999We collected samples of blood in trace-metal\u2013free tubes (with EDTA) and analyzed them for whole blood lead using graphite furnace atomic absorption with Zeeman background correction . The instrument was calibrated with National Institute of Standards and Technology (NIST) Standard Reference Material (SRM) 955a, lead in blood , after every 20 samples. Ten percent of samples were run in duplicate; at least 10% of the samples were controls and 10% were blanks. In tests on reference samples from the Centers for Disease Control and Prevention  precision (coefficient of variation) ranged from 8% for lead concentrations of 10\u201330 \u03bcg/dL to 1% for higher concentrations. Compared with an NIST target of 5.7 \u03bcg/dL, 24 measurements by this method gave a mean \u00b1 SD of 5.3 \u00b1 1.23 \u03bcg/dL. Eighteen percent of women in our study had blood lead levels below the minimum detection limit of 1.0 \u03bcg/dL; we recoded these values to be 1 \u03bcg/dL divided by the square root of 2 (0.71 \u03bcg/dL).Cognitive testing occurred as part of several substudies, although overall methods were identical in all participants. Of the 587 women included in our analyses, 72 (12%) were tested as part of a large-scale study of cognition that began in 1995 of NHS participants \u2265 70 years of age; 14 (2%) were tested in 2002 and 2004 as part of a study of cognition in \u201cyounger\u201d older women and a study of Parkinson disease; and the remaining 501 women were tested during 2004\u20132005 to assess those in the lead study who had not been evaluated as part of these other studies. On average, cognitive assessments took place 5 years  after lead exposure assessments.n = 587) (n = 569) from the TICS to assess delayed verbal memory; the East Boston Memory Test  to assess immediate and delayed paragraph recall (n = 582) in which participants were asked to name as many animals as they could in 1 min (n = 566), to assess working memory and attention (n = 508), another test of working memory and attention, women were asked to recall in alphabetical order an increasingly longer list of unordered words (n = 511) by asking them to name as many words beginning with \u201cf\u201d as they could in 1 min (n = 568), a strong predictor of Alzheimer disease (AD) development  , a test n = 587) . A scoreh recall ; categorin 1 min ; and thettention . The womed words . We alsoin 1 min . For anaelopment , by averr = 0.7). In a validation study we conducted among 61 women from the Religious Orders Study  per SD increment in levels of each of the three lead biomarkers. To summarize the overall association of each lead biomarker with cognitive performance, we used generalized estimating equation (GEE) models, initially treating the eight z scores as correlated repeated measures of cognitive function . We tested this assumption by fitting a GEE model, as described above, but which also included cross-product terms between the lead biomarker of interest and indicators for each cognitive test . A generalized score test with 7 degrees of freedom corresponds to the cross-product terms combined. Large values of the generalized score test indicate substantial deviation from the common exposure effect assumption, meaning that at least one of the cognitive tests differs significantly from the others in its association with lead and suggesting reconsideration of the individual cognitive tests included in the model.We examined performance on the individual test function . If all We adjusted all models for factors evaluated near the time of the lead exposure assessment that may confound the association between lead and cognition or, to improve analytical precision, were strongly associated with cognition in previous work. These factors included age at lead exposure assessment, age squared, education , husband\u2019s education , alcohol consumption , smoking , regular pattern of physical activity , aspirin use , ibuprofen use , vitamin E supplementation , menopausal status  and postmenopausal hormone use . We also included terms for age at cognitive assessment, lead substudy, and cognitive substudy. In separate models, we further adjusted for vascular and mental health factors that might be either confounders or intermediates in the causal pathway between lead exposure and cognitive function, including high blood pressure, antihypertensive medication use, poor mental health on the mental health scale of the Short Form-36, and antidepressant use. p < 0.05 as the level of statistical significance.We conducted all analyses using SAS version 9 , using PROC GENMOD to fit the GEE models. We used This study was approved by the institutional review boards of the Brigham and Women\u2019s Hospital, the Harvard School of Public Health, and the University of Michigan. Study participants gave their written consent to participate in the studies of lead exposure and gave their verbal consent to participate in the cognitive portions of the study at the time of their cognitive assessment.r = 0.44) than with blood lead . As observed previously . Nearly all (99%) identified themselves as non-Hispanic white. Typical of a nonoccupationally exposed population, they had relatively low concentrations (mean \u00b1 SD) of lead in their tibia (10.5 \u00b1 9.7 \u03bcg/g), patella (12.6 \u00b1 11.6 \u03bcg/g), and blood (2.9 \u00b1 1.9 \u03bcg/ dL). These levels were about half of levels observed among a cohort of slightly older men  also living in the greater Boston area . Lead leeviously , lead bieviously . Among tp = 0.19) and the alphabetizing span tests (p = 0.23), both tests of attention and working memory.After adjusting for potential confounding factors, higher levels of the lead biomarkers were generally associated with worse performance on the individual cognitive tests, although none of these negative associations reached statistical significance . The invp = 0.05) (p = 0.02). In particular, the association of patella lead with letter fluency test score was significantly different from the other patella lead\u2013cognitive test associations (p = 0.006). Therefore, in addition to fitting GEE models that used all cognitive scores, we fit GEE models that excluded letter fluency scores.Unexpectedly, higher levels of bone lead were associated with better performance on the letter fluency test, significantly so for patella lead ( = 0.05) . This dip = 0.04]. To help interpret this finding, we contrasted the association of tibia lead with cognition to the association we found for age and cognition. Specifically, the 0.051-unit decrement in standardized cognitive score was equivalent to the difference in scores we observed between women in our study who were about 3 years apart in age. In these models, associations of both bone lead biomarkers with overall cognitive function were stronger than associations corresponding to blood lead.Results from the GEE models that included all cognitive tests indicated that all three lead biomarkers were associated with worse overall cognitive function, although none of these associations was statistically significant . HoweverResults remained unchanged when we further adjusted for potential vascular and mental health intermediates.In this large study of healthy \u201cyoung old\u201d women, cumulative community-level exposure to lead, measured by concentration of lead in tibia bone, was associated with significantly worse overall performance on cognitive function tests. Specifically, the average decrement in cognitive test scores we observed for each SD increase in tibia lead corresponded to the decrement in scores we observed for each 3-year increase in age among women in our study.Levels of two other lead biomarkers\u2014patella lead and blood lead\u2014were also associated with worse cognitive function, but these associations were not significant. This pattern of association suggests that lead exposures in the distant past may be more important than relatively recent exposures in influencing cognitive function in these women, because tibia lead levels measure cumulative exposures over the past decades, in contrast to the more recent exposures measured by patella and blood lead levels . AlthougThe only large-scale study to report on lead\u2019s association with cognition among older women occurred in the Study of Osteoporotic Fractures. Investigators cross-sectionally examined urban- and rural-dwelling women and found that higher blood lead levels predicted worse performance on several cognitive tests , althougNumerous studies of adults with occupational exposures to lead have found adverse associations between current blood lead level and cognitive outcomes. Nonetheless, many of these studies also have found that measures of cumulative dose  generally are more strongly associated than current blood lead with adverse cognitive outcomes . These cFew large-scale studies of cumulative lead exposure and cognition in older adults have included women, and none has reported results that are specific to women . The preMore generally, although lead levels in the environment have fallen dramatically in the past two decades, many older adults have endured protracted exposures to lead in the preceding decades and have accumulated lead in their skeletons. Together with previous findings, our results have important implications for the cognitive functioning of this growing population of older adults. In the United States, the population of persons \u2265 65 years of age is projected to double between 2000 and 2030 , leadingChronic, low-dose exposure to lead may adversely affect cognitive functioning in older age through several actions. Chiefly, lead can damage and eventually kill neurons through its oxidative toxicity, whereby lead both induces oxidative stress  and impeSeveral limitations of our study warrant consideration. It is unlikely that our study findings directly reflect the acute cognitive effects of lead because current exposure levels, indicated by blood lead levels, were distributed over a very limited range. However, as a result of these limited current exposures, our study provides further evidence that past and cumulative exposures\u2014apart from current exposures\u2014may have chronic cognitive effects.Previous studies have identified inverse associations between cumulative lead exposure and visuo spatial ability , but we In addition, the GEE analysis was useful for summarizing our results and effectively optimized the precision of our effect estimates. Use of these models is contingent on reasonably homogeneous associations between lead and cognitive function for all cognitive tests included; however, the puzzling association of higher patella lead with better performance on the letter fluency test violated this assumption. This appears to be a unique finding, likely due to chance. Alternatively, this finding may hint that lead-induced cognitive impairments in older age overlap with those of AD. In AD, deficits in semantic fluency  are common, whereas deficits in phonemic fluency  are not . HoweverOur single assessments of cognitive function do not directly capture change in cognitive function, nor do they evaluate dementia status. The women in our study were in their 50s and 60s at the time of their lead assessments, and were 5 years older, on average, when cognitive testing occurred. At these ages, dementia is still relatively rare , but subIt is possible that our results were influenced by selection processes, although the direction of the ensuing bias, if any, is not altogether clear. About half of the participants were women from a case\u2013control study of hypertension. Because lead exposure appears to be related to hypertension , it is pFinally, as in any observational study, our results could be confounded by unmeasured or mismeasured factors. The NHS cohort is fairly well-characterized, however, and is more homogeneous in terms of occupational and socioeconomic factors than most community-based cohorts. In addition, our results were robust to adjustment for numerous potential confounders, including education and husband\u2019s education, indicators of socioeconomic status. It remains possible that the lead exposure during adulthood that we measured directly via tibia lead is a proxy for lead exposures and its consequences endured during childhood and, therefore, that the association between tibia lead and cognition mis specifies the importance of adult exposures. Although our data are insufficient to satisfactorily confirm or refute this possibility, we examined our findings in the presence and absence of adjustment for educational attainment\u2014a blunt indicator of the consequences of childhood lead exposure\u2014and the findings were unchanged.In summary, in this study of 587 \u201cyoung old\u201d women who had community-level exposures to lead, higher levels of tibia lead (a measure of cumulative dose) were significantly associated with worse overall performance on a series of cognitive tests. In contrast, associations between a measure of recent lead exposure and cognition were weaker and not significant. This pattern of results suggests that, even in the absence of substantial current exposures to lead, chronic, low-level historical exposures to lead may have adverse consequences for the cognitive aging of women and thus merit further research."}
+{"text": "Environmental Health Perspectives provide additional evidence of adverse health effects in children at blood lead levels (BLLs) < 10 \u03bcg/dL\u2014the Centers for Disease Control and Prevention\u2019s (CDC) BLL of concern. A surprising feature of the new data in children with BLLs < 10 \u03bcg/dL is the steepness of the blood lead\u2013IQ curve at these low levels. Nonlinear modeling conducted by in vitro studies that demonstrate a steeper slope for adverse effects of lead exposure at lower BLLs than observed at higher levels.The CDC\u2019s National Health and Nutrition Examination Survey (NHANES) data indicate that the entire population of U.S. children 1\u20135 years of age enjoyed a decline in geometric mean BLLs from about 15 \u03bcg/dL in the late 1970s to < 2 \u03bcg/dL in 2002 , but thea) no effective, feasible interventions to reduce BLLs in this range have been demonstrated; b) no threshold for adverse effects has been identified; and c) given current laboratory methods, risk for misclassification of children is high. Thus, the approach of arbitrarily defining a new, lower BLL of concern was rejected. This decision also is consistent with the recently released recommendations of the In the past, the CDC has responded to reports of adverse health effects at BLLs below the level previously thought to cause harm, by lowering the BLL that defines a child as lead poisoned. However, in 2005, the CDC and its Advisory Committee on Childhood Lead Poisoning Prevention, after a review of the available evidence, determined that children with BLLs < 10 \u03bcg/dL should not be considered lead poisoned as the term is used in the clinical setting . In addiRather, the CDC recommends a multitiered approach that includes case management of children with BLLs > 10 \u03bcg/dL coupled with an increased focus on primary prevention through the control and elimination of lead in children\u2019s environments. The elements of this strategy include:State-based strategic plans to eliminate childhood lead poisoning through a systematic society-wide effort that includes legislative and enforcement efforts to control lead paint hazards, particularly in the highest-risk housing A partnership between the CDC, the Environmental Protection Agency, and the U.S. Department of Housing and Urban Development to enforce the Elimination of lead in consumer products that are marketed to childrenRecommendations that regulatory agencies abandon the practice of using a BLL of 10 \u03bcg/dL as the threshold for enforcement activities.These strategies focus on primary prevention of lead exposure to children, an approach that is in agreement with the conclusions of In 1990, the nation adopted an ambitious goal to eliminate BLLs > 10 \u03bcg/dL as a public health problem by 2010. Recent data indicate that this goal is in sight. However, studies such as those by Therefore, even after the 2010 goal is achieved, primary prevention efforts must be maintained to ensure that lead sources in children\u2019s environments are controlled or eliminated before children are exposed and that surveillance systems are in place to ensure that these efforts are effective."}
+{"text": "We assessed the extent of exposure to lead, cadmium, and mercury in the New York City (NYC) adult population.We measured blood metal concentrations in a representative sample of 1,811 NYC residents as part of the NYC Health and Nutrition Examination Survey, 2004.The geometric mean blood mercury concentration was 2.73 \u03bcg/L ; blood lead concentration was 1.79 \u03bcg/dL ; and blood cadmium concentration was 0.77 \u03bcg/L . Mercury levels were more than three times that of national levels. An estimated 24.8%  of the NYC adult population had blood mercury concentration at or above the 5 \u03bcg/L New York State reportable level. Across racial/ethnic groups, the NYC Asian population, and the foreign-born Chinese in particular, had the highest concentrations of all three metals. Mercury levels were elevated 39% in the highest relative to the lowest income group . Blood mercury concentrations in adults who reported consuming fish or shellfish 20 times or more in the last 30 days were 3.7 times the levels in those who reported no consumption ; frequency of consumption explained some of the elevation in Asians and other subgroups.Higher than national blood mercury exposure in NYC adults indicates a need to educate New Yorkers about how to choose fish and seafood to maximize health benefits while minimizing potential risks from exposure to mercury. Local biomonitoring can provide valuable information about environmental exposures. Lead, cadmium, and mercury are naturally occurring metals, but most human exposure occurs as a consequence of human activities. Mounting awareness and concern about environmental pollutants and their adverse health effects have led to an increase in measures to protect the public from avoidable exposures.Blood lead concentrations in the United States have declined dramatically since the 1970s because of the phaseout of leaded gasoline, the ban of lead in paint and consumer products, and the discontinuation of lead use in plumbing and domestically manufactured soldered cans . HoweverCadmium occurs naturally in some soils in addition to being deposited through emissions from mining operations and fossil fuel combustion, application of phosphate fertilizer or sewage sludge, and disposal of cadmium-containing products . Tobaccoin utero have been reported in studies from the Faroe Islands, New Zealand, and the United States  law requires that all children be tested for lead at 1 and 2 years of age. NYS law also requires clinical laboratories to report all blood lead levels and elevated levels of mercury and cadmium in blood or urine to the State Heavy Metals Registry. However, testing among adults is voluntary and, therefore, likely to overrepresent higher-risk groups, for example, those in certain occupations or who request tests because of known or suspected exposures.In 2004 New York City (NYC) conducted the first-ever local health and nutrition examination survey [NYC Health and Nutrition Examination Survey (HANES)] in a representative sample of NYC adults. The survey measured blood concentrations of lead, mercury, and cadmium using a design that mirrored the National Health and Nutrition Examination Survey (NHANES). In the present article we describe blood metal concentrations by demographic and behavioral characteristics. Results will be used to prioritize public health actions in NYC, where demographics and environment differ in many respects from the United States as a whole.a) selection of census blocks, or groups of blocks; b) random selection of households within selected segments; and c) random selection of study participants within households. No oversampling of demographic groups was done.The NYC HANES was a population-based, cross-sectional survey representing the civilian, noninstitutionalized adult population (20 years of age and older) residing in the five boroughs (counties) of NYC and was conducted between June and December 2004. Participants were recruited into the study using a three-stage cluster sampling design. The stages of sample selection were Selected subjects were invited to any of four clinic sites in the boroughs of Manhattan, Brooklyn, the Bronx, and Queens for interview and blood collection. Using a face-to-face, computer-assisted personal interview, study participants were asked their age, sex, race/ethnicity , education, income, smoking status, place of birth, length of time in the United States, occupation, and consumption of fish or shellfish in the past 30 days. Current job information was categorized according to the Standard Occupational Classification System 2000 (U.S. Bureau of Labor Statistics 2000). The survey instrument was translated into Spanish; interviews in other languages were conducted using a staff or family member proxy or a telephone translation service. Blood specimens were collected by venipuncture using supplies provided specifically for trace metal measurements.The NYC HANES protocol was approved by the NYC Department of Health and Mental Hygiene (NYC DOHMH) and the NYS Department of Health (NYS DOH) Institutional Review Boards. Study participants provided written, informed consent, and those who provided interview and laboratory data were remunerated $100 for their time. More information on data collection and protocols, as well as a detailed description of the study design, has been published .Of the 4,026 households selected, 3,388 (84%) completed an eligibility interview. Of the 3,047 selected, eligible survey participants, 1,811 (59%) completed the interview and provided a blood sample, yielding an overall response rate of 50%.Specimens were shipped to the Wadsworth Center\u2019s Trace Elements Laboratory at the NYS DOH, and stored at \u201380\u00b0C until analyzed. The Wadsworth Center\u2019s Laboratory is certified under the federal Clinical Laboratory Improvements Amendments of 1988 (CLIA-88 1992) and holds an NYS DOH clinical laboratory permit for blood lead and trace elements.Total mercury, lead, and cadmium were determined in whole blood using a PerkinElmer Sciex  ELANDRC Plu inductively coupled plasma\u2013mass spectrometer (ICP-MS). The ICP-MS method has been validated for biomonitoring measurements , and perInternal quality control (IQC) materials covering the range of exposure expected in the U.S. population were analyzed at the beginning and end of each batch of blood specimens and throughout each analytical run. The IQC samples were prepared in-house from whole blood obtained from lead-dosed animals and supplemented with inorganic cadmium, inorganic mercury, and methylmercury chloride. NIST Standard Reference Material 966  was periodically analyzed throughout the study to maintain independent validation. Full details regarding the characterization of the IQC pools, including metal concentrations, and QC performance statistics have been described elsewhere .Method detection limits for lead, cadmium, and mercury were 0.05 \u03bcg/L, 0.09 \u03bcg/L, and 0.17 \u03bcg/L, respectively. Typical repeatability, or between-run imprecision, was 1.4\u20131.7% for lead, 3.1\u20134.1% for cadmium, and 2.6\u20133.7% for mercury. A repeat analysis was performed on any specimens exceeding the upper threshold of 4 \u03bcg/L for cadmium, 10 \u03bcg/dL for lead, or 10 \u03bcg/L for mercury. In addition 2.5% of all blood specimens were randomly selected for re-analysis.Education was dichotomized by collapsing adjacent categories with similar geometric means. This resulted in collapsing categories whose geometric means differed by no more than 6%. For the lead analyses, participants were dichotomized into having up to a high school diploma and some college or higher. For the mercury and cadmium analyses, participants were dichotomized into having less than a bachelor\u2019s degree and a bachelor\u2019s degree or higher.n = 83) were considered heavy smokers.Smoking status was defined as current, former, or never smoker. Ever smoking was defined as having smoked at least 100 cigarettes in one\u2019s lifetime. Those who reported smoking 20 cigarettes or more per day (n = 93). The Chinese represent the largest subpopulation in the NYC Asian community.In addition to the broad race/ethnicity classifications of non-Hispanic White, non-Hispanic Black, non-Hispanic Asian, and Hispanic, we further classified as foreign-born Chinese any participant who was Asian and either reported a place of birth in China, Hong Kong, or Taiwan, or else requested a Chinese language interview  and \u226515 \u03bcg/L (the NYS investigation level). Lead was dichotomized at \u22655 \u03bcg/dL and \u226510 \u03bcg/dL, consistent with reporting in previous publications .We applied sample weights to adjust for differential selection probabilities and survey nonresponse. Weights were poststratified to reflect the age, sex, race/ethnicity, and borough of residence breakdown of the NYC population . WeightsWe calculated crude population geometric means for blood metal concentrations by taking the antilog of the mean of the natural log-transformed values. Upon visual inspection, logging the values made a substantial improvement toward the approximation of a normal distribution. We used the method of t-tests to compare geometric mean and prevalence estimates across categories of nominal predictors. To test for trends across continuous predictors, we categorized income, education, years in the United States (among the foreign-born), and fish consumption variables into four ordinal levels (scored 1\u20134); we used age in continuous form. To test for trends across geometric means, we used the p-value associated with the beta coefficient from a crude linear regression of the natural logarithm of the metal concentration on the predictor. To test for a trend in prevalence, we used p-values associated with the beta coefficient from a crude binary linear model that regressed having an elevated metal (0 or 1) on the predictor (We used redictor . The binn = 27), and those with missing covariate data (n = 77), in these models. To assess the relation between blood lead and cadmium, we added blood cadmium concentration to the adjusted model of lead concentration, and vice versa. The exponentiated model coefficients represent the proportional change in the arithmetic mean associated with each level of the predictor, relative to a referent level, adjusting for the other predictors in the model. We considered a result to be statistically significant if the 95% CI did not include one (p < 0.05).We fit multiple linear regressions of the log-metal concentrations on the predictor variables. We excluded persons categorized as \u201cNative American or Non-Hispanic Other\u201d race/ethnicity because of small numbers . Sample levels all exceeded the limit of detection, and ranged between 0.33 and 37.5 \u03bcg/dL. There were eight people with blood lead concentrations > 10 \u03bcg/dL , and two exceeded the NYS adult investigation level of 25 \u03bcg/dL. Most of these eight were male (7) and born outside the United States (7). An estimated 4.8% of the NYC adult population had lead levels \u22655 \u03bcg/dL , including 12 women of reproductive age (20\u201349 years of age) . The 97.5th percentile for blood lead concentration overall was 6.29 \u03bcg/dL.p-values for trend tests < 0.04). Blood lead concentrations were highest in heavy smokers (2.49 \u03bcg/dL), the foreign-born Chinese (2.66 \u03bcg/dL), and those working in construction and maintenance (2.86 \u03bcg/dL). Upon removal of the latter group, the geometric mean blood lead level in smokers decreased slightly to 2.00 \u03bcg/dL (95th percentile = 5.51 \u03bcg/dL), suggesting some confounding of the smoking association by occupation. Prevalence of current smoking among construction and maintenance workers was 45% compared with a citywide estimate of 23%.We describe blood lead results in p-value for trend test = 0.54), and former smokers had only 8% higher blood lead concentrations than never smokers (compared with a crude elevation of 26%). Age remained the strongest predictor of blood lead. Upon adding blood cadmium to the adjusted model, a 1-\u03bcg/L increase predicted a 22% elevation  in mean blood lead concentration.The patterns of lead concentrations across population subgroups were similar after we adjusted for predictors simultaneously in a log-linear regression\u2014with several exceptions. The crude association between decreasing income and increasing geometric mean blood lead was no longer apparent (n = 1) or lead > 10 \u03bcg/dL (n = 1). No samples attained the NYS reportable level for cadmium of 10 \u03bcg/L, although the highest measured level of 9.67 \u03bcg/L came close. The 97.5th percentile for blood cadmium concentration overall was 2.49 \u03bcg/L.The geometric mean blood cadmium concentration in NYC adults was 0.77 \u03bcg/L  as shown in Blood cadmium levels were most strongly associated with smoking status. Heavy smokers had the highest geometric mean cadmium concentration (1.58 \u03bcg/L) of all subgroups examined. However, the geometric mean among foreign-born Chinese New Yorkers (1.34 \u03bcg/L) exceeded that of current smokers (1.22 \u03bcg/L), even though the estimated prevalence of smoking in this population subgroup (21%) was not higher than that of the general adult population (24%).Results from a multiple linear regression were consistent with the patterns of crude geometric means observed across population subgroups. Current smoking and Asian race/ethnicity remained the strongest predictors of elevated blood cadmium. Blood lead was a relatively strong predictor of blood cadmium. After adjusting for other predictors, a 5-\u03bcg/dL increase in blood lead concentration predicted a 17% elevation in blood cadmium concentration .The geometric mean blood mercury concentration among NYC adults was 2.73 \u03bcg/L  as shown in p-values for trend test < 0.01 for geometric mean and prevalence \u22655 \u03bcg/L) (Frequent consumption of fish or shellfish was associated with increasing mercury levels (\u22655 \u03bcg/L) . The geop < 0.01).People born outside the United States had higher mercury levels than those born in the United States; however we did not see a trend toward increasing mercury concentration with shorter time in the United States as we did with lead levels. In contrast, those who had lived in the United States for > 10 years had a higher crude geometric mean blood mercury level than newer arrivals . The 95th percentile was among the highest (19.19 \u03bcg/L). The geometric mean in foreign-born Chinese New Yorkers was even higher (7.26 \u03bcg/L), surpassing that of all other subgroups we examined. Almost half of adult Asian New Yorkers (46.2%) had blood mercury \u22655 g/L. Among the 93 foreign-born Chinese New Yorkers in the survey, 68 had blood mercury concentrations \u22655 \u03bcg/L , and 19 of these were \u226515 \u03bcg/L .p < 0.01) and those with less education , but the associations were attenuated and no longer statistically significant in the adjusted model.Fish consumption was the strongest predictor of increasing blood mercury concentration in a multiple linear regression of log-mercury concentration on the predictors in Findings presented here from the nation\u2019s first local HANES, conducted in NYC in 2004, suggest that there is variability in exposure to toxic metals across population subgroups. Blood lead increased most with age; blood cadmium increased most with cigarette smoking; and blood mercury was most strongly related to fish or shellfish consumption. New Yorkers who self-identified as Asian had the highest blood concentrations of all three metals compared with other racial/ethnic groups. Foreign-born Chinese New Yorkers, in particular, had higher mercury levels than the most frequent fish consumers, higher lead levels than the oldest New Yorkers, and higher cadmium levels than current smokers. The wide range of exposure to metals in a geographically contiguous but diverse urban population highlights the importance of local-level examination surveys in guiding public health actions.NHANES 1999\u20132002  providedBlood mercury levels were higher in NYC than nationally across similar levels of reported fish or shellfish consumption . A possiBlood metal concentrations among Asians have not routinely been reported from the NHANES because of sample size limitations. However, an analysis of 1999\u20132002 data identified the aggregate of Asians, Pacific Islanders, Native Americans and multiracial groups as having the highest mercury levels of all race/ethnicities , similarWe are not aware of NHANES reports that describe elevated blood cadmium or lead in Asians, either alone or as an aggregate group, so we do not know whether the higher levels we measured among Asian New Yorkers mirror national data. Current smoking did not explain the higher cadmium or lead levels in Asians; in fact, prevalence of current smoking was slightly lower among Asian New Yorkers compared with the citywide estimate. Shellfish consumption is a possible source of the higher cadmium levels observed in Asians. Exposure could have occurred outside the United States as well, as cadmium and lead can remain in the body for decades, and body stores may serve as a source of subsequently measured metals in blood . In NYC,The geometric mean blood lead concentration in NYC adults (1.79 \u03bcg/dL) is similar to the 2001\u20132002 national estimate  is slightly higher than the 1999\u20132000 national estimate for adults , compared with the 55% response in the NYC HANES (response rates for blood collection component of the examination are slightly lower in both surveys).Self-reported exposure data are limited by respondents\u2019 memories and ability to answer questions. We do not know how accurately respondents were able to provide the number of times they ate fish or shellfish in the last 30 days. Furthermore, our questionnaire did not distinguish consumption of fish species according to mercury content. Consequently, confounding by contaminated fish and seafood consumption is likely to remain in our comparisons of mercury levels across population subgroups after adjustment for fish or shellfish consumption.Laboratory methods for determining chemical exposures have become increasingly sensitive, so the detection of lead, mercury or cadmium in the blood of an adult does not necessarily imply a health risk. Findings are difficult to interpret in terms of public health impact, as reference doses are not necessarily meaningful threshold values for toxicity. The data we present attempt to describe exposures in the NYC adult population for the purpose of targeting intervention to high-risk groups and establishing baseline exposure levels.A local HANES is an important source of information about the health of a community, particularly in the area of environmental exposures that are difficult\u2014if not impossible\u2014to assess without laboratory data, and that may vary across the nation. Our findings suggest that while NYC is keeping pace with national reductions in exposure to lead, exposure to mercury is elevated relative to national levels. The most significant source of exposure to mercury is likely to be fish consumption, implying a need to educate New Yorkers about how to choose fish to maximize health benefits while minimizing health risks. Asians may be at increased risk of exposure to mercury and other metals. Because lead and mercury are known to harm the developing nervous system and because both metals cross the placenta, it is critical that we support efforts to track and develop methods of intervention to reduce exposures in women of reproductive age. Our findings are also a reminder of the ramifications of failing to control mercury emissions into the environment."}
+{"text": "No data are available with the labor departments among the workers of small-scale lead-based units with regard to lead poisoning. One hundred and ninety-five workers were investigated for lead exposure and three were found exceeding the limit of 80 mg/dL, which required a treatment for lead poisoning.To assess the exposure and health risk in workers working in small lead-based units.Random sampling is selected from the cross-sectional medical study.Medical examination cum biochemical/hematological investigations along with blood lead estimation were carried out in these workers.Epi-Info and SPSS 16.0 were used for statistical analysis.Workers' blood lead levels were brought down from 114.4, 110.0 and 120.6 mg/dL with treatment of D-penicillamine to 40 mg/dL. It may be concluded that lead poisoning is a preventable public health problem that particularly affects the industrial workers in small lead-based units. Lead poisoning is one of the compensable diseases in India since 1924.[One hundred and ninety-five workers working in small-scale lead battery manufacturing, lead stearate, lead oxide and battery recycling plants in Ahmedabad and nearby areas were included. Workers are exposed to lead particulates and fumes during the process through inhalation and ingestion of dust due to poor housekeeping and unhygienic conditions. Six workers had blood lead levels > 80\u03bcg/dL. As per the DG FASLI, blood le\u03bcg/dL, of which three were from battery recycling units, two from a lead oxide plant and one from a lead stearate plant. The workers from the battery recycling units did not cooperate for treatment, whereas the remaining three workers were given treatment.Six workers from the 195 studied were found to have blood lead levels exceeding 80 The study encompasses medical cum biochemical/hematological investigations along with lead estimation in blood samples of these three subjects. The physician of the Civil Hospital, Ahmedabad, carried out the medical examination. Biochemical tests like blood sugar, serum glutamic pyruvate transaminase serum glutamic oxaloacetate transaminase, serum alkaline phosphates, cholesterol, creatinine, urea, bilirubin, serum protein, potassium, calcium, etc., using an auto analyzer with standard biochemical methods, the erythrocyte sedimentation rate and basophilic stippling using standard methods and the chest X-ray were carried out in the Civil Hospital. Hematological parameters such as hemoglobin, total count and differential count using a cell counter (Sysmax-KH21) and lead levels in the blood analyzed using an atomic absorption spectrophotometer  were carried out at the NIOH along with the quality control samples to assure the validity of the results.The first, second and third workers aged 41, 22 and 44 years, respectively, had more than 8, 4 and 6 years past experience in the lead manufacturing (oxide and sterate) units, respectively.All the three workers were exposed to lead dust and fume during their work and were not using any personal protective equipment . In addition, the first two workers were also likely to ingest lead dust during and off the shift as they were staying in the plant premises.Nothing significant was elucidated in the past, family or personal history of all the cases. The first worker had a habit of smoking, drinking alcohol and tobacco chewing, the second had a habit of drinking alcohol and tobacco chewing while the third had a habit of tobacco chewing only.In all the three workers, the vitals were normal, with pulse rates of 80/min and a blood pressure of 120/80, 128/88 and 110/80 mm Hg, respectively. The first worker had pain in the right knee and was unable to move while working. The second had abdominal pain in both the flanks whereas the third worker had anorexia, pain and burning in both feet at the time of examination. The results of hematology, electro cardiogram, chest X-ray, routine urine examination and biochemical investigations for these cases were within the normal range, indicating normal liver, kidney and heart functions. Their blood lead levels were markedly elevated . They weAll the three workers did not cooperate for further follow-up for the treatment. Generally, it is difficult to get the cooperation in small-scale units due to various reasons such as lack of education and awareness and loss of wages during the participation. In this case, with great effort, a reasonably good cooperation was obtained.It is observed that the engineering controls are installed in battery oxide and lead sterate plants but these controls are not effective and are not maintained regularly. Because of a lack of proper awareness/education related to lead poisoning and not using the effective personal protective devices, these workers are exposed to lead dust and fumes and do not wear proper and clean clothing during the work.Out of the three workers studied, two stayed in the factory premises where lead oxide was being manufactured. Thus, the workers remain prone to a heath risk for all the 24 h. After the treatment with D-penicillamine, the lead levels are decreased; however, they did not come down to normal levels (< 40 \u03bcg/dL) in two workers . These wIt may be concluded that lead poisoning is an important and preventable health problem that particularly affects the industrial workers working in small units and the children of low socioeconomic status. It is therefore essential to workout a national policy related to this issue taking into account the cost benefit analysis."}
+{"text": "Anemia is a health problem among infants and children. It is often associated with a decrease in some trace elements  and an increase in heavy metals as lead. This study was done to determine the association of blood lead level > 10 \u03bcg/dl, with the increased risk to anemia, also, to investigate the relationship between anemia and changes in blood iron, zinc and copper levels, and measure lead level in drinking water.The study is a cross-sectional performed on 60 children. Venous blood samples were taken from the studied population for estimating hematological parameters as well as iron and ferritin levels. The concentrations of zinc, copper, and lead were measured. The studied population was divided into anemic and non-anemic (control) groups. The anemic group was further classified into mild, moderate and severe anemia. The study subjects were also categorized into low and high blood lead level groups.Approximately 63.33% of children had blood lead levels \u2265 10 \u03bcg/dl. At the blood lead level range of 10-20 \u03bcg/dl, a significant association was found for mild and severe anemia. The blood level of iron and ferritin was found to be significantly lower in high blood lead level and anemic groups than those of the low blood lead level and control groups. Lead level in drinking water was higher than the permissible limit.Lead level \u2265 10 \u03bcg/dl was significantly associated with anemia, decreased iron absorption and hematological parameters affection. High blood lead levels were associated with low serum iron and ferritin. Lead level in drinking water was found to be higher than the permissible limits. Deficiency of certain trace elements generally causes hypochromic microcytic anemia. Iron deficiency not only causes hypochromic microcytic anemia, but also increases the absorption of other elements such as lead (Pb) and cadmium (Cd). Therefore, in patients with hypochromic microcytic anemia, the serum levels of these elements may increase causing deterioration of anemia. Generally, heavy exposure to (Pb and Cd) causes hypochromic microcytic anemia . Iron abLead poisoning has been a significant public health problem for centuries. In children, it is defined as a blood lead level equal to or greater than 10 \u03bcg/dl , it is aHuman exposure to lead occurs primarily through diet, air, drinking water and ingestion of paint chips where absorption increases mainly in persons suffering from iron and calcium deficiency .Environmental lead exposure occurs from automobile exhaust in areas of the world where leaded gasoline is still used. At home, exposure among children may occur either due to ingestion of old leaded chips or pigments and glazes used in pottery .For centuries, lead plumbing has helped in the contamination of drinking water and contributed to elevated blood lead concentrations in children .The mobilization of heavy metals in the environment, due to industrial activities, is a serious concern due to their toxicity in humans and other forms of life . These tCopper as an essential trace element exists in the diet, it is needed to absorb and utilize iron . Zinc isAnemia in children leads to increased morbidity and mortality . AdverseTherefore, this study was done to determine the association of blood lead level > 10 \u03bcg/dl, with the increased risk to anemia compared to levels less than 10 \u03bcg/dl, also, to investigate the relationship between anemia and changes in blood iron(Fe), zinc(Zn) and copper(Cu) levels, and measure lead level in drinking water.This research was carried out on a total of 60 children from the pediatric clinic in Al-Zhraa Univerisity hospital and a special pediatric clinic in a rural area. They were selected by a systematic random sample. Exclusion criteria of cases were children having chronic hemolytic anemia or those suffering from chronic illness associated with anemia. The control group was selected from those attending the out patients clinic for evaluating physical fitness for different sports. Mothers of children were informed about the aim of the study and their consent was obtained. Data related to age, gender, residence, source of drinking water, degree of father and mother's education and their occupation, also, socioeconomic status data was collected from the mothers. According to the WHO definition of anemia based on hemoglobin level less than 11 g/dl, the studied population was divided into anemic and control groups . The aneA venous blood sample was taken from each child and divided into three tubes. The first tube (containing EDTA) used for estimation of hematological parameters using Celttac autoanalyzer, these parameters included the red blood cell count (RBC), hemoglobin (Hb), hematocrit (Hct), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), and red cell distribution width (RDW). The second tube (containing heparin) for estimation of lead, copper and zinc by the atomic absorption spectrophotometer . . Lead level in piped water was found to be 2.9 \u03bcg/dl and 3.6 \u03bcg/dl in the urban and rural areas, respectively. Hand pump, water collected from two separate hand pumps in the rural area, revealed lead levels to be 3.1 \u03bcg/dl and 2.3 \u03bcg/dl.Data was analyzed by SPSS  version 12. Chi-square test was performed to compare individual characteristics and the t-test was performed to compare the hematological parameters between anemic and control groups. Results were expressed as the mean \u00b1 standard deviation (SD). Significant values of P at < 0.05 and < 0.001 were considered. A correlation was performed for the levels of lead, Fe, Cu and Zn in blood versus the different hematological parameters.This study was done on 60 children with ages ranging from 2 to14 years with a mean value of 6.27 \u00b1 3.40 years. According to the blood lead level, ranging between 7 to 20 \u03bcg/dl, approximately 63.33% (n = 38) of children had a blood lead \u226510 \u03bcg/dl (high blood lead level group {HBLL}) and 36.67% (n = 22) had a blood lead level <10 \u03bcg/dl (low blood lead level group {LBLL}), The socioeconomic characteristics were studied among the high and low blood lead level (Table A significantly greater proportion of children with lead levels \u226510 \u03bcg/dl 63.2%) had anemia compared to those with lead levels <10 \u03bcg/dl (27.3%) (Table % had aneThe presence of different categories of anemia among the high (\u226510 \u03bcg/dl) and low (>10 \u03bcg/dl) blood lead level groups was demonstrated in Table Comparison between mean values of different hematological parameters and serum ferritin in anemic and control groups were studied Table . RegardiComparing the results of Cu, Fe and Zn levels between the anemic and control groups revealed a significant decrease in the level of Fe among the anemic than the control group p < 0.001). Whereas no statistically significant difference was seen between both groups for Cu and Zn levels  and ferritin among the low and high blood lead level groups revealed Table  significMore than half of the study children 63.33%) had BLL \u226510 \u03bcg/dl, similar to a study done by Jain et al 3.33% had,18. The Schwartz et al . reporteLead causes anemia by impairing heme synthesis and increasing the rate of red blood cell destruction . On the In the current study high BLL among school children (>6 years old) may be due to usage of crayon in school and high BLL in male children than female children may explain by more hobbies in males.Fe, Cu and Zn are essential elements for the maintenance of life and health. Pb which is a heavy metal, can be harmful to human health. Therefore, the blood level of these elements in children was determined. Because of the presence of high BLL in drinking water, as reported by the WHO, this study was carried out to reveal the relationship between high blood lead levels, trace elements as well as hematological parameters in children.In the present study, the level of iron in the anemic group was found to be significantly lower than the control as was expected, similarly Jain et al . represeIn the present study serum Zn level of the anemic group is insignificantly lower than the control group. There is an antagonism between Zn and Fe absorption from the gastrointestinal tract, as an increase iron concentration in the intestinal lumen may antagonize the uptake of Zn . A studyIn accordance, although the present study revealed the Cu level to be higher in the anemic more than control group yet, this increase was not statistically significant. However, Cu has a role in the absorption of iron. The oxidation of ferrous iron into ferric state is carried by ceruloplasmin. This depletion of Cu could impair iron absorption .In the present study, the serum level of Pb in the anemic group was significantly higher than in the control. A possible explanation is that Fe deficiency increases absorption of Pb from the intestines. Similarly a study carried out in Canada, revealed high BLL in babies with Fe deficiency . Other sThe current results showed that Hb, Hct, MCV, MCH and ferritin values of children with anemia decreased and RDW level increased in comparison to control group.Also, blood lead levels were higher in anemic children. This could be due to that decreasing iron level increases lead absorption that in turn affects heme synthesis, thus negatively affecting hematological parameters . MoreoveIn investigated water samples were considered suitable for drinking according to the EMH . as the In 2003-2004, tap water in Washington, DC, exceeded the Environmental Protection Agency (EPA) regulations. This was because of a change in water disinfection procedures, which increased the water ability to leach lead from connector pipes between water mains and interior plumbing in old houses .In developing countries such as India, control of lead pollution is much slower and more sporadic. Some studies estimated that more than half of children in India have blood lead levels > 10 \u03bcg/dl .The present work revealed an association between blood lead level and low serum iron and ferritin levels. This is similar to several studies reporting higher proportions of children with elevated blood lead levels among those with low iron and ferritin levels -41. ThesOn the contrary Hershko et al , reporteIn the present study, lead levels \u226510 \u03bcg/dl in children were associated with an increased risk of mild and severe anemia, decreasing iron absorption and negatively affecting the hematological parameters. High BLLs were associated with low blood level of iron and ferritin. Lead level in drinking water was high according to the WHO, and this may be one of the leading causes for elevating BLL in children. Lead pollution might be controlled and steps should be taken to reduce the prevalence of childhood anemia.The authors declare that they have no competing interests.AAH contributed to the study design, acquisition of data, analysis and interpretation of data, and drafted the manuscript. MMZ contributed to the study design, acquisition of data. MAA contributed to study design and interpretation of data, and drafted the manuscript. AAM contributed to the revision of the manuscript. RAS contributed to study design. All authors read and approved the final manuscript."}
+{"text": "Blood lead concentrations have been associated with increased risk of cardiovascular, cancer, and all-cause mortality in adults in general population and occupational cohorts. We aimed to determine the association between blood lead, all cause and cause specific mortality in elderly, community residing women.Prospective cohort study of 533 women aged 65\u201387 years enrolled in the Study of Osteoporotic Fractures at 2 US research centers  from 1986\u20131988. Blood lead concentrations were determined by atomic absorption spectrometry. Using blood lead concentration categorized as < 8 \u03bcg/dL (0.384 \u03bcmol/L), and \u2265 8 \u03bcg/dL (0.384 \u03bcmol/L), we determined the relative risk of mortality from all cause, and cause-specific mortality, through Cox proportional hazards regression analysis.p = 0.09). Women with blood lead concentrations \u2265 8 \u03bcg/dL (0.384 \u03bcmol/L), had 59% increased risk of multivariate adjusted all cause mortality  (p = 0.041) especially coronary heart disease (CHD) mortality (p = 0.016), compared to women with blood lead concentrations < 8 \u03bcg/dL(< 0.384 \u03bcmol/L). There was no association of blood lead with stroke, cancer, or non cardiovascular deaths.Mean blood lead concentration was 5.3 \u00b1 2.3 \u03bcg/dL (range 1\u201321) [0.25 \u00b1 0.11 \u03bcmol/L (range 0.05\u20131.008)]. After 12.0 \u00b1 3 years of > 95% complete follow-up, 123 (23%) women who died had slightly higher mean (\u00b1 SD) blood lead 5.56 (\u00b1 3) \u03bcg/dL [0.27(\u00b1 0.14) \u03bcmol/L] than survivors: 5.17(\u00b1 2.0) [0.25(\u00b1 0.1) \u03bcmol/L] (Women with blood lead concentrations of \u2265 8 \u03bcg/dL (0.384 \u03bcmol/L), experienced increased mortality, in particular from CHD as compared to those with lower blood lead concentrations. Lead is a multitargeted toxicant, affecting cardiovascular, renal and nervous systems, and may contribute to morbidity and mortality through its adverse impacts on these systems ,2.An association between lead and mortality has been observed in both occupational and community based cohorts . ResultsEnvironmental exposures to lead have been associated with hypertension and the incidence of clinical cardiovascular endpoints such as coronary heart disease, stroke, and peripheral artery disease . CardiacThe Study of Osteoporotic Fractures (SOF) is a longitudinal cohort study that enrolled 9704 white women from 1986 to 1988 using population-based listings in Baltimore, MD; Minneapolis, MN; Portland, OR; and the Monongahela Valley near Pittsburgh, PA. To be eligible to participate, women had to be aged 65 years or older and ambulatory. The lead ancillary study was conducted in 1990\u20131991 in 533 white women aged 65\u201387 years enrolled in SOF at either the University of Pittsburgh or University of Maryland clinics. The participants in this study of blood lead concentrations represent a convenience sample obtained from two of the clinical centers of the Study of Osteoporotic Fractures.th percentiles of the distribution of blood lead. Thus, the three groups were: low ; medium ; and high . This categorization was determined a priori ; Coronary heart disease (CHD) [ICD-9-CM 410\u2013414]; Stroke [ICD-9-CM 430\u2013438]; cancer [ICD-9-CM codes 140 to 239] and all other deaths.The methods of determining deaths in SOF have been published,21. BrieA 5.0 ml sample of whole blood was drawn into Vacutainer tubes . Blood samples were analyzed at the Clinical Chemistry Laboratory of the University of Maryland, certified for the analysis of lead in blood by the Occupational Safety and Health Administration and Centers for Disease Control and Prevention, and documents a lower limit of detection for lead of 1 \u03bcg/dL. Blood lead concentrations were determined by graphite furnace atomic absorption spectrometry . To determine intralaboratory measurement variability in lead concentration and the stability of samples over 1 year, 100 samples (50 from each clinic) were drawn from randomly selected women during a clinic visit, one year later. The intraclass correlation coefficient for the duplicates was 0.88. Mean values of 4.76 \u03bcg/dL  [0.23(range 0.05\u20130.62 \u03bcmol/L)], and 4.67 \u03bcg/dL  ; medium ; and high . This categorization was determined a priori based on our previous study of blood lead and cognitive functions . A total of 123 (23%) women died over a mean follow up of 12.0 (\u00b1 3.0) years. Women with \u2265 8 \u03bcg/dL(0.384 \u03bcmol/L), blood lead concentration had higher alcohol intake, were more likely to smoke, and had 8% lower total hip BMD  blood lead concentration 5.6 3) \u03bcg/dL, [0.27\u00b1 0.14) \u03bcmol/L] than survivors: 5.17(\u00b1 2.0) [0.25(\u00b1 0.1) \u03bcmol/L] \u03bcg/dL  had a 73% increased risk of dying.  (p = 0.014) compared to women in blood lead < 8 \u03bcg/dL (0.38 \u03bcmol/L). With further adjustment for covariates women with \u2265 8 \u03bcg/dL (0.384 \u03bcmol/L) still had 59% higher risk of all cause mortality  (p = 0.041), compared to women with < 8 \u03bcg/dL (0.38 \u03bcmol/L) of blood lead. Although the multivariate adjusted hazards ratio (95% CI) for CVD mortality for women who had \u2265 8 \u03bcg/dL (\u2265 0.384 \u03bcmol/L) versus the < 8 \u03bcg/dL (< 0.38 \u03bcmol/L) blood lead concentrations was not significant; 1.78, p = 0.089, women in higher lead group experienced 3 fold higher risk of mortality due to coronary heart disease 3.08, p < 0.016. There was no association of blood lead and mortality from stroke, cancer and other causes  . Increasbone lead, a more accurate biomarker of chronic lead exposure than blood lead was associated with ischemic heart disease mortality . Associations between occupational lead exposure and cancers of brain, stomach, kidney and lung have been reported -54. HoweOur results are consistent with this observation as the median value in the \"\u2265 8 \u03bcg/dL\" lead group was 9 \u03bcg/dL 0.43 \u03bcmol/L). A higher risk of cancer deaths was only observed in with blood lead concentration > 20 \u03bcg/dL0.96 \u03bcmol/L) 3 \u03bcmol/L.. In cont \u03bcmol/L 3Bone loss accelerates after menopause and bone demineralization may release bone lead into circulation . Inverse12 as cofactors. Lead and homocysteine both are associated with cardiovascular disease and cognitive dysfunction[Alternatively, osteoporosis and atherosclerosis may result from elevated concentrations of homocysteine, an amino acid whose normal metabolism depends on folate and vitamin Bsfunction. In subjsfunction and centsfunction. Taken tCompared to the rest of SOF participants, the lead study cohort was of comparatively younger age, and had lower proportion with hypertension . The proThere are several strengths to our study: our follow up was more than 95% complete and we adjudicated all mortality events. We followed women for more than12 years after the blood lead measures were obtained. We controlled for a number of covariates and cardiovascular risk factors. However, this study has several limitations; participation was limited to older Caucasian women, and the findings may not apply to men or nonwhite women. We did not determine co-contaminants such as cadmium that might be associated with cardiovascular disease through its known effects on kidney function ,64. TherOur study extends the findings of higher mortality associated with blood lead concentrations from NHANES III surveys to community dwelling older women. An increased mortality risk, especially coronary heart disease was found at blood lead concentrations \u2265 8 \u03bcg/dL (0.384 \u03bcmol/L). Our results add to the existing evidence of adverse affects of lead on health as seen in an older cohort who experienced greater historic environmental lead exposure.BMD: Bone mineral density; CHD: Coronary Heart Disease; CVD: Cardiovascular Disease; DXA: Dual energy X-ray absorptiometry; HR: Hazard Ratio; ICD: International Classification of Diseases, Ninth, revision, Clinical Modification; \u03bcg/dL: microgram per deciliter; NHANES: National Health and Nutritional Examination Survey; SOF: Study of Osteoporotic Fractures; VDR: vitamin D receptor gene.JAC has received research support from Merck & Company, Eli Lilly & Company, Pfizer Pharmaceuticals, and Novartis Pharmaceuticals. She has also received consulting fees from Eli Lilly & Company, and Novartis Pharmaceuticals. She is on the speaker's bureau for Merck and Company. SRC receives research support from Amgen, Pfizer, Novartis, Eli Lilly and Co. and consulting fees or honoraria from Eli Lilly and Co., Zelos, Merck and Co., Novartis, GlaxoSmithKline, Procter & Gamble, and Aventis. NK, JWW, EOT, LAM, MCH, TAH, and SBM had no conflicts.NK carried out the analysis and drafted the manuscript; JAC participated in the conceptual design, draft of the manuscript. SBM conceived the study and performed data acquisition; JWW participated in the analysis plan, and design of the study. EOT, LAM, SRC, MCH, TAH, participated in its design, coordination, and review of the study. All authors read and approved the final manuscript."}
+{"text": "Amongst toxic heavy metals, lead ranks as one of the most serious environmental poisons all over the world. Exposure to lead in the home and the workplace results in health hazards to many adults and children causing economic damage, which is due to the lack of awareness of the ill effects of lead. We report the case of a 22 year old man working in an unorganized lead acid battery manufacturing unit, complaining about a longer history of general body ache, lethargy, fatigue, shoulder joint pain, shaking of hands and wrist drop. Patient had blue line at gingivodental junction. Central nervous system (CNS) examination showed having grade 0 power of extensors of right wrist & fingers. Reflexes: Supinator- absent, Triceps- weak and other deep tendon reflexes- normal. Investigations carried out during the admission showed hemoglobin levels of 8.3 g/dl and blood lead level of 128.3 \u03bcg/dl. The patient was subjected to chelation therapy, which was accompanied by aggressive environmental intervention and was advised not to return to the same environmental exposure situation. After repeated course of chelation therapy he has shown the signs of improvement and is on follow up presently. Lead is a ubiquitous and versatile metal which has been used by mankind for many years. It ranks as one of the most serious environmental poisons amongst the toxic heavy metals all over the world. Mankind has used it for many years because of its wide variety of applications. Human exposure to lead is from numerous sources and a myriad of pathways including air, food, dust, soil and water. The common sources of lead exposure are use of certain products containing lead such as lead soldered cans, traditional practices such as folk remedies, cosmetics, artisan ceramics, environmental emissions containing lead and very importantly through occupations such as production, use and recycling of lead, lead smelting, refining, alloying and casting, lead acid battery manufacture and breaking, printing, jewellery making -5. Many We present a case of twenty-two-year old male admitted to our hospital with the complaints of pain in the upper abdomen, decreased sleep and appetite, general body ache, tiredness, shoulder joint pain, shaking of hands, and wrist drop. On examination he was noted to have basal metabolic index (BMI): 17.2, Pallor: ++, Coarse tremor: ++, BP: 160/100, Pulse: 78/mt, Blue line at gingivodental junction, grade 0 power of extensors of right wrist & fingers; Intrinsic hand muscles- normal, Other limbs- normal power. Reflexes: Supinator- absent, Triceps- weak, Other deep tendon reflexes- normal, Superficial reflexes- normal, Involuntary movement- tremor, Sensory, Cerebellar, Skull & Spine- normal.Relevant history revealed that he had been working in an unorganized lead based manufacturing unit since 6 years. He claimed to be ignorant of the ill effects of lead and used to work without taking any precautions.Investigations carried out during the admission in our hospital showed the following results:Hemoglobin(Hb): 8.3 g/dl(14\u201316 g/dl); Total count(TC): 6100 C/cu m ; Differential count(DC): Neutrophils 77% (40\u201378%), Lymphocytes 21% (20\u201345%), Monocytes 2% (2\u201310%); Erythrocyte sedimentation rate (ESR): 8 mm/hr (0\u20139 mm/hr); Mean corpuscular volume (MSV): 82 fl (76\u201396 fl); Platelet count: 3.1 lac/cu mm(1.5\u20134.0 lac/cu mm); Peripheral Smear: Normocytic hypochromic with no basophilic stippling; Blood urea: 42 mg/dl (15\u201345 mg/dl); Serum creatinine: 0.98 mg/dl (0.6\u20131.2 mg/dl); Random blood sugar: 103 mg/dl (upto 140 mg/dl); Serum Electrolytes: Sodium 136 mEq/L (135\u2013145 mEq/L), Potassium 4.3 mEq/L (3.8\u20135.5 mEq/L), Chloride 101 mEq/L (95\u2013105 mEq/L); Test for rheumatoid arthritis and anti nuclear antibody (ANA) negative thyroid function test: normal; Zinc protoporphyrin(ZPP): 148 \u03bcg/dl(upto 40 \u03bcg/dl) ; Blood lead level(BLL): 128.3 \u03bcg/dl (acceptable range 10 \u03bcg/dl); Other heavy metal screening: below detectable limit.In the present study, the blue line at the gums prompted measurement of blood lead levels, which was markedly elevated. The patient had low hemoglobin and high ZPP levels indicating the lead induced adverse effects on hematopoitic system. The symptoms like lethargy, fatigue, peripheral neuropathy and weakness of forearm extensor muscles indicate the effects on the nervous system. Studies have shown that lead inhibits the enzymes \u03b4-aminolevulinic acid dehydratase (ALAD) and ferrochelatse of the heme synthetic pathway thus preventing conversion of ALA to porphobilinogen and inhibits incorporation of iron into the protoporphyrin ring respectively. This results in reduced heme synthesis and elevated levels of the precursor \u03b4-aminolevulinic acid (ALA), which is a weak gamma-aminobutyric acid (GABA) agonist that decreases GABA release by presynaptic inhibition ,7. Lead The detailed clinical investigation in the present study helped us to diagnose the patient having lead toxicity. Lead poisoning continues to be an environmental and public health hazard of global proportions around the world. Exposure to excessive levels of lead in the home and the workplace impose immense costs, affecting adults and children suffering from adverse health effects and impaired intellectual development. Studies have found that the highest levels of environmental contamination were associated with uncontrolled recycling operations and that the most highly exposed adults are those who work with lead .In the present study, the patient was unaware of the ill effects of lead and was handling lead without taking any precautions; he worked without the use of personal protective equipments like mask, gloves and safety glasses even though they were provided. He ate and smoked in the working place, which was having poor housekeeping practices and minimum engineering control, lacking local and general exhaust ventilation and washing facilities culminating into alarmingly high blood lead levels of 128.3 \u03bcg/dl. According to United States Occupational safety and Health Administration (OSHA) regulation (29 CFR 1910.1025 App B), workers with single BLL of 60 \u03bcg/dl or greater or an average of the last three BLLs or all BLLs over the previous six months at or above 50 \u03bcg/dl must be removed from his or her regular job to a place of significantly lower exposure.The patient was advised to stop his lead related occupation and was subjected to repeated course of chelation therapy using the chelator, D-penicillamine , 25\u201335 mg/kg body weight/day in divided doses for 3 weeks. Chelation therapy is administered in order to increase the rate of excretion of lead in the short term, by 25 to 30 times the normal, which may otherwise take months to years. Chelating agents competitively bind lead, removing it from biologically active molecules, and the complexes formed are excreted from the body. The administration of the chelation to the patient in the present study was accompanied by aggressive environmental intervention, and the patient was not allowed to return to the same environmental exposure situation.th course chelation therapy 32 days after the 3rd course. After repeated course of chelation therapy, he showed some signs of improvement. He responded with an improvement in Hb to 13.2 g/dl. This was accompanied by significant improvement in wrist drop, shaking of hands and tiredness.There are many such unorganized battery manufacturing units operating, where the younger generation have exposed to this toxic heavy metal for many years and lead gets deposited in soft tissues and bones of these individuals making these organs endogenous sources of lead for many years even after these individuals are removed from the ongoing exposure. In the present case the patient was subjected to three courses of chelation therapy with 7 days of gap between the each course. The BLL measured immediately after the each course has shown a decline in the levels. The cessation of chelation therapy for 30 days has increased his BLL. Table Though the chelation therapy, removes lead from the blood and soft tissues, upon discontinuation of treatment, it is redistributed from the bony compartment to the blood . This clDetailed clinical investigation is of prime importance for identifying lead poisoning cases and while treating the lead poisoning cases the chelation therapy must be accompanied by aggressive environmental intervention. The potential health hazards of lead poisoning still exist and are rising due to the lack of education regarding the dangers of working with lead. In a developing country like India where over 80% of used lead is recycled by unorganized sector, who do not comply with any of the government specified regulations. Some of these are as small as a family owned smelting industry. These are neither registered nor visited by any regulating authorities. The lack of a safe workplace and limited awareness among workers in these unorganized industries has resulted in high blood lead levels. Workers in these industries were observed to have poor personal hygiene during and after work; they were observed in the dining area wearing work clothes and observed working without wearing proper respiratory protection, gloves and mask. The employer had failed in providing proper facilities for the workers. There were no proper storage facilities for street clothes and no separate areas were provided for the removal and storage of the lead-contaminated protective work clothing and equipment.The regulatory body should make it mandatory to evaluate and create awareness in the worker about the ill effects of lead and should insist on regular health check up to prevent adverse health effects. This preventable environmental health hazard can be tackled only through proper awareness and education and by implementing national and international policies."}
+{"text": "EHP 116:1261\u20131266; Hopkins et al.][.An estimated 310,000 U.S. children between ages 1 and 5 have elevated blood lead levels despite efforts to reduce lead in the environment. Research in the past decade has begun to focus on factors that could make some children more susceptible to lead poisoning even at low levels of exposure. A new study explores one such possible factor\u2014gene variants that influence lead absorption\u2014linking variants in two iron metabolism genes to higher blood lead levels in children HFE ) gene\u2014HFE C282Y and HFE H63D\u2014predicted blood lead levels 11% higher than those in children not carrying the variants. Moreover, the presence of either HFE variant combined with a variant form of the transferrin (TF ) receptor gene\u2014TF-P570S\u2014predicted blood lead levels 50% higher than in children with none of the variants.When researchers analyzed umbilical cord blood from 422 children in Mexico, they found that the presence of two variants of the hemochromatosis (HFE and TF genes normally regulate iron metabolism, they may also influence blood lead levels because lead\u2014like iron\u2014is a divalent metal. Thus, the two metals can be \u201cmistaken\u201d for each other during metabolic processes. The HFE gene regulates iron-binding proteins, including TF, and variant forms of this gene sometimes induce hemochromatosis, a disease characterized by increased intestinal absorption of iron that contributes to abnormally high iron stores in adulthood.Although the HFE variants might similarly increase absorption of lead, a hypothesis supported by the results of this study. TF interacts with HFE to form a complex that down-regulates iron absorption. However, TF-P570S may interact with the HFE variants in ways that heighten metal absorption rates. Study results showed the TF and HFE variants produced higher lead levels than those predicted by either HFE variant alone.The authors hypothesized that the HFE variants predicted lower blood lead levels in elderly men compared with men without the variants. The contrasting findings, the authors speculate, may reflect age-specific differences in body iron stores and in the variants\u2019 effect on lead metabolism. Among children with low iron body stores and high iron needs, the variants predicted higher blood lead levels. But as iron stores accumulate with age, the variants down-regulated iron and lead absorption, leading to progressive declines in blood lead levels. The study\u2019s key implications are twofold: first, that children with variant iron-metabolizing genes may be especially susceptible to the effects of lead at low exposure levels, and second, that genetic variants may increase risk at one life stage and decrease it at others.Previously published research by these investigators has shown that having the"}
+{"text": "The populations who are most sensitive to lead exposure from various sources are pregnant women and their newborns. Aiming to explore the presence of correlation between maternal and cord blood lead levels and to identify potential predictors that may influence both levels, the present study has been conducted.A cross-sectional study was conducted covering 350 full terms maternal-newborns pairs from Mosul maternity hospitals. Data were obtained directly from women just before delivery by the use of a detailed questionnaire form.\u00ae Blood Lead Testing System and Kits.Maternal and umbilical blood lead levels were estimated using LEADCAREA positive significant correlation was found between maternal and cord blood lead values . By backward stepwise logistic regression analysis the followings emerged as significant potential predictors of high maternal blood lead: low parity, smoking and Hb level <11 gm/dl. Regarding cord blood lead: coffee consumption and high maternal blood lead were significant risk predictors. Milk and milk products consumption, calcium intake and low level of physical activity were significantly operational in the prevention of high maternal blood lead levels. Iron intake and also low level of physical activity were shown as significant protective variables against high cord blood lead values.Study results have provided baseline data needed to be transformed to decision makers to implement measures to eliminate lead from the environment and protect future generation from its deleterious effects. There are numbers of studies published in developing countries that have evaluated maternal influences on umbilical blood lead levels (UBLLs) -4. In IrOfficial permission was obtained from Ninevah Health Office and maternity hospitals administrations that were to be involved in this work. A written consent was taken from participants prior to the interview and blood sample collection.Three maternity hospitals were chosen on the basis of having the largest monthly births and their accessibility for the whole population living in Mosul city. The present study adopted a cross-sectional study design among women who attended the delivery units in the three chosen hospitals. Data were obtained directly from the mothers themselves before delivery, .The followings were the inclusion criteria for the participant:(1) She is 15\u201349 years old.(2) Mosul city resident for more than 3 years.(3) Has a full term single viable pregnancy.(4) Has no gestational diabetes or seizure.(5) Has no psychiatric illness.(6) Delivered by normal vaginal delivery.Especially designed questionnaire form was used to collect information from the participants. This questionnaire has a high reliability (83.5%) and validity (82.1%). It included questions relating to maternal age, parity, coffee and tea consumption during the most recent month of pregnancy, milk and milk products consumption, smoking behavior, cosmetics uses and the degree of physical activity.The last part of the form had questions concerning, history of chronic and acute diseases during current pregnancy & history of taking iron and calcium supplements. Hemoglobin level was taken from the case sheet.Data collection was conducted between October 2006 and May 2007.Analysis of blood lead was performed at the Environmental Health Education and Recourses unit of Mosul College of Medicine.\u00ae Blood Lead Testing System and Lead Care Blood Lead Testing Kits by . This system relied on electrochemistry and a unique sensor to detect lead in the whole blood. The contents of these kits are used specifically with LEADCARE\u00ae Analyzer and Blood Lead Testing System.Blood Lead Levels (BLLs) were estimated by using LEADCAREThree ml of venous maternal blood samples were collected in lead free EDTA tubes and the same volume of umbilical cord blood was also collected immediately after birth from each corresponding newborn baby in EDTA tubes as well.\u00ae System.Fresh whole blood samples were thoroughly mixed in their containing EDTA tubes and accurately measured, 50 \u03bcL samples were transferred and mixed with treatment reagent until it turned brown. An exactly measured 50 \u03bcL blood mixture was then transferred to the kidney shaped active area of the sensor using the 50 \u03bcL pipette that was supplied with the LEADCAREHaving the sensor being properly placed into the sensor holder and its active area being thoroughly covered with the mixture, it was then pushed into the rest of the way into the sensor holder where the analyzer displayed the BLL in \u03bcg/dl after exactly 180 seconds. The range of the test is 1.4\u201365 \u03bcg/dl. \"Hi\" in the display window indicates that BLLs are greater than 65 \u03bcg/dl.Analyses of refrigerated blood mixtures in the treatment reagent tubes were made in weekly batches. Mixtures were allowed to reach room temperature prior to analysis.\u00ae Blood Lead Controls were used to monitor the accuracy and precision of blood lead testing. They are prepared from bovine blood containing metabolized lead and they consist of a low level blood lead control; 6.4 \u00b1 3.0 \u03bcg/dl (Level 1) and a high level blood lead control; 25.9 \u00b1 4.0 \u03bcg/dl (Level 2).LEADCARE\u00ae water with isothizolones (< 0.002%) as preservative. Reconstituted controls were used as would be a patient blood sample and as an internal quality control program.Each control contains 2.0 ml lyophilized bovine whole blood that should be reconstituted with the provided 2.0 ml LEADCAREFor the purpose of data analysis the cut off point used for both maternal blood lead levels (MBLLs) and UBLLs was \u2265 5 \u03bcg/dl . Data weThe geometric mean (GM) of MBLLs at delivery was 3.26 \u00b1 1.91 \u03bcg/dl with a range of 0.50\u201322.39 \u03bcg/dl, The GM of UBLLs was 2.29 \u00b1 2.11 \u03bcg/dl and the range was 0.30\u201322.91 \u03bcg/dl. A highly significant difference was reported between the two GMs (p = 0.000).Using untransformed data; 57 of pairs (16.3%) had an umbilical blood value higher than maternal blood lead.It is worth noting that 5.4% of women had BLLs \u2265 10 \u03bcg/dl and 19.7%had a borderline value of 5\u20139 \u03bcg/dl. On the other hand 5.7% of newborns had BLLs \u2265 10 \u03bcg/dl and 7.7% had value falls within the range of 5\u20139 \u03bcg/dl.Figure The present study shows that women whose BLLs \u2265 5 \u03bcg/dl were more able to give newborns with an average BLLs significantly higher than those whose mothers' BLLs <5 \u03bcg/dl [Additional file Blood lead in Iraq is not routinely measured in any health facility, therefore, there are limited data about the prevalence and predictors of high BLLs in both general population and high risk groups including women in child bearing age (pregnant & non pregnant) and children under five years of age ,6. SchnaThe GM lead value for MBLLs and UBLLs reported in the present study are higher than those recorded by others ,8,9. Thietal.[In the present study MBLLs varied from 0.5\u201322.39 \u03bcg/dl and it is worth saying that 5.4% of the examined women had BLLs \u2265 10 \u03bcg/dl, moreover, 19.7% were with BLLs between 5\u20139 \u03bcg/dl which may be regarded as borderline value. Higher point prevalence (8.5%) was reported by Al-Naemi Moline and Landerigan  reportedIn the present study the UBLLs varied between 0.3\u201322.91 \u03bcg/dl and 5.7% of newborns had a cord blood lead concentration levels \u2265 10 \u03bcg/dl, while 7.7% had borderline values (5\u20139 \u03bcg/dl). Deficits in cognitive and academic skills may occur at BLLs lower than 5 \u03bcg/dl, the lowest BLLs associated with adverse effect on these areas have not been adequately defined .In the present study the GM of MBLLs is significantly higher than that of UBLLs (p = 0.000). This difference in GMs is in agreement with other studies ,9,13,14.In the present study UBLLs are positively correlated with MBLLs . This finding mimics results of other studies ,4. It seetal. [The present work proved that low parity is a significant risk predictor of development of high MBLLs (p = 0.000). Rothenberg etal.  stated detal. . Howeveretal. [During this study Hb <11 g/dl emerged as a significant predictor for MBLLs \u2265 5 \u03bcg/dl (p = 0.007). The same conclusion was reached by Graziano etal. . Health In the present study milk and milk products consumption and calcium supplements intake during the current pregnancy result in low MBLLs and UBLLs in a very highly significant way (p = 0.000 each). The same result was recorded in Mexico City . This maetal. [Low physical activity during pregnancy played a significant protective role against development of high MBLLs and UBLLs (p = 0.031 and p = 0.000) respectively. Harville etal.  in USA fIn the present study coffee consumption did not emerge as a predictor of high MBLLs, however it appears as significant risk predictor for UBLLs \u2265 5 \u03bcg/dl (p = 0.034). A similar result was found in USA . This diAmong the well known advantages of this study are the describing MBLLs and UBLLs and their burden on the study population, and determining their association with variables of interest. This finding can provide direction for potential area for more in deep future study.An important point in this work is the large divers and city wide representative sample with a very high response rate (95.0%) although no information was gained about the non-respondents.An important limitation in this study is the extent of over or under reporting of high BLLs' predictors which could not be determined.\u00ae Blood Lead Testing System by . Although this system is mainly used for screening, but when it was used at a referral clinic/hospital versus the atomic absorption spectroscopy the two methods gave a correlation coefficient of 0.97 [Due to unavailability of atomic absorption spectroscope; BLLs were estimated by using LEADCARE of 0.97 .For the first time in Iraq the present study provides a baseline data on MBLLs and UBLLs. Several local potential predictors emerged that determined BLLs.These findings may be important to consider a prevention strategy. Iron and calcium supplementation could reduce maternal and newborns lead burden. Screening of women at childbearing age for the detection of elevated BLLs is mandatory. Furthermore, conducing studies to examine the effect of different BLLs on the development of children in the local community is a must.BLLs: Blood Lead Levels; GM: Geometric Mean; MBLLs: Maternal Blood Lead Levels; UBLLs: Umbilical Blood Lead LevelsThe authors declare that they have no competing interests.All authors contributed in designing and conducting the present work, analyzing data, and drafting the manuscript. All authors read and approved the final manuscript.The data provide results of backward stepwise logistic regression analysis for predictors of high BLLs among mothers and newborns.Click here for file"}
+{"text": "This lead exposure study was conducted in a total of 452 school children in the age group of 9\u201314 years. Two hundred and ninety-eight exposed children came from the villages situated within a 2.5 km radius of the lead\u2013zinc mine whereas the comparative group children were selected from the villages at least 10 km away from mine. Environmental monitoring study suggested that lead levels in air and water samples near the mining areas were within the Central Pollution Control Board prescribed standards. Lead levels in about 80% of the children were less than 10 \u03bcg/dl. Medical examination of all children did not show any signs related to lead toxicity but central nervous system-related symptoms, as reported by the subjects during medical examination, were found to be higher in the exposed group when compared with the comparative group. The values of physical growth parameters of the exposed group were comparable with that of the comparative group for both girls and boys. Hence, the physical growth of children was found to be unaffected by the observed level of lead exposure. To safeguard the health of the children residing near the mining area, various preventive and control measures were suggested. Lead is ubiquitous in nature. It affects virtually every system in the body. It can damage the nervous system, the renal, and the reproductive systems, cause high blood pressure, and affect growth and development, psychological behavior, and intelligence. Lead exposure in young children is of particular concern because children absorb lead more readily than adults and the developing nervous system of children is particularly vulnerable to the adverse effects of lead. Blood lead levels (Pb-B) as low as 10 \u03bcg/dl (microgram/deciliter) are associated with harmful effects on the children\u2019s learning and behavior.[Lead dust released in the environment during mining and smelting of lead can cause lead exposure to the population living in the vicinity of the mine. Such an open cast mine is situated in Rajasthan State. Hence, a study was undertaken to obtain the base line lead exposure data and its likely health effects on children residing in villages near the mine.This mine is one of the most cost-efficient zinc mines and resource wise, it is estimated that it is the fifth in the world. The mine is an ISO 9001, ISO 14001, and OHSAS 18001 certified unit. The capacity of the mine is 3.75 million MTPA ore production, with 13.54% zinc and 1.97% lead and beneficiation plant to produce zinc and lead concentrates of 53\u201354% and 60\u201365%, respectively. To investigate the lead exposure and its health risk/hazards in children due to the mine, medical surveillance and environmental monitoring were carried out as described below:A total of 452 (exposed \u2013 298 and comparative group \u2013 154) school children in the age group of 9\u201314 years were randomly selected from different villages. The exposed group comprised of the children staying within a 2.5 km radius of the mine and the comparative group included children from villages situated at least 10 km away from the mine. The study covered medical examination along with lead estimation in the blood sample of each subject. Details of personal and general information along with specific medical examination related to lead toxicity/poisoning were recorded in the pre-designed and tested medical proforma. BLL was used as a biomarker of lead exposure in the study.Three milliliters of venous blood was collected taking due precaution in a heparinized vacuette at the school premises for lead estimation. The collected blood vacuettes were stored at \u22124\u00b0C in the deep freezer and were transported to the laboratory in dry ice packs. Two milliliters of whole blood was digested in a wet digestion system  using a mixture of 2 ml of nitric acid (ultra pure) and 0.2 ml of hydrogen peroxide while maintaining the time and temperature. The final volume was made to 5 ml using triple distilled water and centrifuged. The clear solution was injected in the atomic absorption spectrophotometer (AAS) to estimate the lead levels in the bloods.Quality control samples of lead in the blood of different required concentrations were obtained from the Center for Disease Control (CDC), Atlanta, USA. These samples were also run along with the actual analysis of samples to assure the validity of the results.To assess the environmental exposure levels of lead, representative ambient air and drinking water samples were also collected using standard methods from the villages falling within 2.5 km radius of mine and comparative group of villages which were at least 10 km away from mine and their analysis for lead was also carried out using AAS.This will be the first systematic study to know the lead exposure in children residing near the lead producing open cast mine in India.3, which were within the prescribed levels of 1.5\u03bcg/m3 .[Environmental monitoring (air and water samples) was carried out of the same villages from where the study subjects were selected. The lead levels in water samples ranged from 6.3 to 13.3 \u03bcg/L in different villages situated near the mine, which was less than the prescribed level of 50 \u03bcg/L .[BLL is an indicator of current exposure and it reflects a dynamic equilibrium between absorption, distribution, and elimination of lead. BLLs in children were used to know the current level of lead exposure. P < 0.05). Medical examination did not reveal any signs of lead encephalopathy or peripheral neuropathy.Tables 4The results of the present study represent preliminary efforts in generating a database of information on lead exposure to children residing near the mine and also to make an attempt to find out the extent and magnitude of health risk consequent to such exposure, considering the different parameters studied.et al.[et al.[The main positive finding seen was the CNS-related symptoms as reported by the subjects during the medical examination, which was found to be higher in the exposed group compared with the comparative groups. The difference in both groups was observed to be statistically significant; however, symptoms like headache and giddiness were non-specific in nature and cannot be attributed to only lead exposure. The present BLLs observed in the exposed group of children were not that high, which can give rise to classical signs and symptoms of lead toxicity, like lead line on gums, abdominal pain (lead colic), neurological deficit, joint pain, severe vomiting, anemia, etc. in children. It is reported that the effects of lead on the CNS are embedded in a complex process involving biologic, environmental, familial, and socioeconomic factors. Epidemiological studies cannot, by themselves, establish a causal relationship. Causality is not subject to empirical proof, whether in field or in the laboratory. In Indiaet al. reportedet al. found BLl.[et al. also repChildren residing near the mine having poor socio-economic status are considered as a high-risk group to the adverse effect of lead exposure. An additional risk factor is paraoccupational lead exposure to children, which can occur because of their parents working in the lead producing mine. It is reported that BLLs as low as 10 \u03bcg/dl are associated with harmful effects on children\u2019s learning and behavior. The outcLow levels of lead for a longer duration in these children may lead to health risk in the future. Hence, preventive measures and intervention strategies are required to control low-level lead exposure in order to safeguard the children.The following different suggestions/recommendations were given:Engineering control at the source of the dust exposure should be made powerful so that emission levels of lead dust will remain controlled.Periodic medical examination, including biological monitoring of the children residing near the mine should be carried out.Periodic assessment of community environment  near the mine should be carried out.Health education and awareness programs related to lead exposure and health effects should be organized for the villagers residing near the mine.To safeguard the children from health risk due to lead exposure, the mine management was requested to follow the above suggestions/recommendations and create/maintain the environment (community as well as work environment) clean and safe in the mine. This will help in sustaining the clean environment inside and outside the mining areas."}
+{"text": "Early Human Development in August 2009, boys may be even more susceptible than girls to damage related to very low-level lead exposure.As a neurotoxicant, lead is especially harmful to the developing brain, and early exposures can irreversibly impair children\u2019s cognitive and behavioral development. Although a blood lead level of 10 \u03bcg/dL is used as a benchmark for intervention, a growing body of research demonstrates that neurologic effects occur well below this level. Based on research published in Sex-based susceptibility to low-level lead exposure was previously suspected, but this study is the first to document a statistically significant difference. \u201cEntering into this research, we did not expect to find such a strong gender-based difference in response to very low lead levels, but this hypothesis was confirmed by a long series of analyses,\u201d says lead author Wieslaw Jedrychowski, chair of epidemiology and preventive medicine in the College of Medicine at Jagiellonian University in Krakow.The study population included 457 infants born in Krakow between January 2001 and February 2004. For inclusion in the study, mothers had to be nonsmokers aged 18 to 35 years with no history of chronic diseases such as diabetes or hypertension.Upon enrolling in the study, expectant mothers completed a detailed questionnaire that covered demographic characteristics, pregnancy dates, and medical and reproductive history. Interviews during pregnancy and after birth provided information about secondhand tobacco smoke exposure during pregnancy and duration of breastfeeding.At birth a cord blood sample was collected to measure lead concentration, and the Mental Development Index (MDI) of the Bayley Scales of Infant Development\u2014a widely used tool for assessing mental development in young children\u2014was administered to the women\u2019s children at ages 12, 24, and 36 months to assess factors such as problem solving, memory, vocalization, and language. Normal MDI scores are 85 and above, whereas scores below 85 indicate delayed development.Cord blood lead levels ranged from 0.44 to 4.60 \u03bcg/dL, with a median level of 1.21 \u03bcg/dL. Mean blood lead levels were not significantly different between boys and girls, nor were maternal education (an indicator of socioeconomic status), number of siblings, or prenatal and postnatal secondhand smoke exposure. Among boys, but not girls, cord blood lead levels were significantly associated with a lower MDI score at 36 months after controlling for confounding factors. With the median blood lead level (1.21 \u03bcg/dL) delineating low and high exposures, high exposure was associated with a 4.5-point deficit in boys\u2019 MDI scores.The research was very well done according to Herbert Needleman, a professor of psychiatry and pediatrics at the University of Pittsburgh School of Medicine. \u201cFurther,\u201d he says, \u201cI think it\u2019s important because it concerns what other people have shown: that very small amounts of lead are neurotoxic.\u201dA probable explanation for the observed sex-based difference relates to males generally having fewer receptors for estrogen throughout the central nervous system than females, says Jedrychowski, who with his colleagues wrote, \u201cThe consequences of neurotoxicant exposure and the gender differences in the response to toxic exposure can partially depend on the protective effects of estrogen.\u201dAdds Needleman, \u201cBoys are more sensitive to almost all [brain] insults\u2014head injuries and things like that. The basic brain is female; masculinity is \u2018tacked onto it,\u2019 and it\u2019s a more fragile apparatus.\u201d"}
+{"text": "We reviewed the sources of lead in the environments of U.S. children, contributions to children\u2019s blood lead levels, source elimination and control efforts, and existing federal authorities. Our context is the U.S. public health goal to eliminate pediatric elevated blood lead levels (EBLs) by 2010.National, state, and local exposure assessments over the past half century have identified risk factors for EBLs among U.S. children, including age, race, income, age and location of housing, parental occupation, and season.Recent national policies have greatly reduced lead exposure among U.S. children, but even very low exposure levels compromise children\u2019s later intellectual development and lifetime achievement. No threshold for these effects has been demonstrated. Although lead paint and dust may still account for up to 70% of EBLs in U.S. children, the U.S. Centers for Disease Control and Prevention estimates that \u226530% of current EBLs do not have an immediate lead paint source, and numerous studies indicate that lead exposures result from multiple sources. EBLs and even deaths have been associated with inadequately controlled sources including ethnic remedies and goods, consumer products, and food-related items such as ceramics. Lead in public drinking water and in older urban centers remain exposure sources in many areas.Achieving the 2010 goal requires maintaining current efforts, especially programs addressing lead paint, while developing interventions that prevent exposure before children are poisoned. It also requires active collaboration across all levels of government to identify and control all potential sources of lead exposure, as well as primary prevention. Some recent tragedies have evinced a more complicated risk pattern for pediatric lead exposures in the United States than had previously been considered:21 April 2000, New Hampshire: A 2-year-old Sudanese refugee died from exposure to lead paint, the first U.S. child known to die from lead poisoning in 10 years .July 2002, New York City: A 1-year-old\u2019s elevated blood lead level was traced to ceramic dinnerware without visible signs of wear .2 .23 July 2003, Massachusetts: A lead-coated copper wall and roof were identified in a child\u2019s condominium where dust lead levels were 224,377 \u03bcg/ft2004, Oregon: A child was hospitalized after ingesting a necklace made with lead, resulting in voluntary recall of 150 million pieces of children\u2019s jewelry .23 March 2006: Minnesota: A 4-year-old died from lead poisoning after swallowing a charm with 99% lead content received with a purchase of shoes .The implications of these and similar events drove members of core federal agencies to jointly construct a more complete picture of potential lead exposures than had previously been compiled.Lead is corrosion-resistant, dense, ductile, and malleable and has been used since at least 3500 BCE. Atmospheric lead levels increased more than six orders of magnitude over the past six millennia accompanying population and economic growth  Davidso. Blood lThe adverse health effects of lead\u2014including death, insanity, nervous system damage, and sterility\u2014have been reported since the second century BCE . Even loIn 2000, the United States adopted the goal of reducing all exposures to lead and eliminating elevated blood lead levels  in children by 2010 . HoweverScreening children for lead and abating lead paint hazards in homes of children with EBLs must continue. But given ubiquitous lead contamination, merely reducing hazards in residences of children identified with EBLs will not suffice. Childhood lead poisoning prevention programs (CLPPPs) must consider current and past uses of lead as well as behaviors that leave specific populations vulnerable to excessive lead exposures. To be effective, CLPPPs must shift to primary prevention.Deteriorating lead paint and contaminated dust and soil are the primary, but not the only, causes of EBLs among U.S. children. Lead is used in thousands of applications, all of which constitute potential exposure sources . Recent Nonpaint lead exposure sources are insufficiently characterized, and their importance is often underestimated. When a child with an EBL is reported, investigators look for lead paint in places where s/he spends time, exploring alternative lead exposure sources only when no paint hazards are found. Thus, for some children, significant nonpaint sources may be missed. Evidence also suggests that for children with BLLs < 10 \u03bcg/dL, no single exposure source predominates .The United States is the third largest lead producer, producing about 450,000 tons in 2003 . In 2003During the 20th century, leaded gasoline was the predominant source of airborne lead. Today, industrial emissions predominate. In 2001, the U.S. Environmental Protection Agency (EPA) reported that industrial emissions accounted for 78% of air lead, fuel consumption accounted for 10%, and the transportation sector accounted for 12% . In 2004After declining for > 25 years, U.S. air lead levels rose in 2004\u20132006  U.S. EP. The hig3, respectively, versus background levels of 0.007 and 0.018 \u03bcg/m3  are exempt from reporting, fall below reporting quantities, or choose not to report; nonetheless, they can contaminate surrounding communities. For example, at one airport where many airplanes used avgas, average and maximum air lead levels were 0.030 and 0.302 \u03bcg/m18 \u03bcg/m3 . Another18 \u03bcg/m3 .Demolition of old buildings contributes to local air lead levels and can increase BLLs in children .Lead binds tightly to soils, and eight decades of leaded gasoline combustion and past industrial emissions have left a legacy entrained in soil. Peeling lead paint on residences also contaminates soil, especially in distressed neighborhoods. Because of higher traffic levels and denser housing, the soil in urban areas can average 800\u20131,200 \u03bcg/g . Soil frChildren living near mining and smelting sites are at risk for EBLs . StudiesHistorical research to uncover past commercial activities can identify current sources of exposure . For insElevated soil lead levels are found at more than two thirds of Superfund sites in all 50 states . Lead isBLLs can rise 1\u20135 \u03bcg/dL for every 1,000-ppm increase in soil lead .Dusts are composed of fine particles of soil, paint, and industrial or automotive emissions. They accumulate on exposed surfaces and are trapped in clothing and carpet fibers. Ingesting dust particles is the typical route of lead exposure for children . Dust isBLLs can rise 1\u20135 \u03bcg/dL for every 1,000-ppm increase in dust lead .The sources of lead in food may be natural or anthropogenic, and contamination can occur at any point in processing through contact with metal implements, solder, pigments, glazes, or packaging. Lead also enters food from drinking water, serving utensils, and household dust. Dietary exposures in the United States are 1\u20134 \u03bcg lead per day , and havLead in breast milk is related to current maternal exposures and to past exposures mobilized from lead stored in bones . Even loLead is unlikely in source water but contaminates tap water through the corrosion of plumbing materials containing lead . Lead piCases of pediatric lead poisoning have been associated with drinking water . BLLs coChanging or introducing secondary disinfection practices (to kill waterborne pathogens) can affect lead levels in drinking water. After Washington, DC, switched disinfection agents, children in homes with lead service lines did not experience the almost 70% decrease in BLLs > 5 \u03bcg/dL experienced by other children . ChildreLead levels in school drinking water can rise because long periods of nonuse  are followed by heavy consumption . The U.SDrinking water contributes an estimated 10\u201320% of the total lead exposure of the general population ; formulaLead levels in chocolate products exceed those in other foods. In 1980, the market basket Total Diet Study (TDS) by the FDA found lead levels in chocolate milk more than three times those in whole milk, and levels in milk chocolate candy approximated those in canned foods . In the Candy imported from Mexico is found repeatedly with high lead levels. Both candy and wrappers printed with lead ink have been cited . Lead-coFoods and packaging produced outside the United States can contain high lead levels. Several spices , especiaAn assessment of 84 dietary supplements found lead in all, with 11 samples exceeding the tolerable dietary lead intake level . These rThe Dietary Supplement Health and Education Act prevents the FDA from requiring premarket safety approval for supplements; hence, they require neither proof of safety nor efficacy . The FDALeaded crystal contains 24\u201332% lead oxide. Crystal decanters and glasses can release high amounts of lead in a short time, especially with cola . The FDACeramic pottery and other dinnerware containing lead glazes can be important exposure sources. Numerous reports of EBLs associated with homemade or low-fired ceramics from Mexico, southern Europe, North Africa, and the Middle East exist . RelativGlassware with decals or painted surfaces can also contain lead . In 1979The U.S. FDA advised manufacturers and suppliers that lead in soft vinyl lunchboxes  may tranAccording to the Consumer Product Safety Commission (CPSC), lead is the most frequently recalled substance that could result in poisoning. Many products associated with childhood lead poisoning are imported and do not meet U.S. standards . A listiConsumer goods with high lead content are found regularly. One study showed that 94% of plastic bread bags contained lead in the printing ink; a survey of families found that 16% reused bags to package children\u2019s lunches . In MarcA study of toy jewelry found lead concentrations \u2265 50% in 40% of samples ; when wiLead salts are used to stabilize polymers to avoid degradation from heat, sunlight, and wear. Although several studies demonstrate that dangerous lead exposures can occur with normal use of PVC products after extended use or exposure to sunlight, initial evaluation by CPSC found that lead in PVC products posed few risks to children .An investigation of vinyl miniblinds found that they contaminate house dust and contribute significantly to lead toxicity in children . BecauseSince 1977, the water pipe market has more than doubled, and 80% of new drinking water and wastewater pipes are plastic, mostly PVC . Early tArtificial Christmas trees made of PVC also degrade under normal conditions . About 5Synthetic turf is currently used on about 3,500 playing fields throughout the United States . Rubber Candles with a lead metal core contribute to lead in the home . ExposurApproximately 38 million homes had lead-based paint (LBP) in 2000 . Of thosHousing units with LBP hazards are not evenly distributed . In 2000Children in units with LBP are almost 10 times more likely to have an EBL than children in similar housing without lead paint . AddressMean BLLs of children whose housing was abated show a 38% decrease over a 2-year period after lead hazard control . NonetheBetween 1976 and 2002, the National Health and Nutrition Examination Surveys (NHANES) identified a constellation of risk factors for EBLs among children. Previously undocumented risk factors continue to be uncovered in urban areas and within particular subpopulations . NationaChildren\u2019s BLLs peak around 15\u201324 months of age . This agThe NHANES show an association between BLLs and race/ethnicity . In 1976Folk medicines and remedies from many cultures can contain high lead levels . TraditiRefugee, internationally adopted, and recent immigrant children are more likely than U.S.-born children to have EBLs, both on arrival in the country and later . Many foAn increased risk for EBLs has been documented among refugee and immigrant children from Africa, Cuba, China, Russia, Thailand, and other countries . For insChildren with EBLs are more common in communities with many households below the federal poverty level, independent of housing age or proportion of black children . In 1976Income-based disparities of EBLs in children have narrowed. In 1991\u20131994, the percent of children with EBLs was 4.5% in the lowest income group versus 0.7% in the highest income group . By 1999Housing built before the 1978 ban on lead paint is a significant risk factor for exposure. Forty-two percent of children living in housing built before 1946, and 39% of children in housing built between 1946 and 1973 had BLLs \u22655 \u03bcg/dL versus 14% of children in housing built after 1973 .Children 1\u20135 years of age living in the 10 largest U.S. cities accounted for 46% of EBLs reported to the CDC in 2003 but only 7% of the population that age . Usually, EBL cases are clustered within cities. A 2001 study of seven cities found that 50% of children with EBLs lived in 11% of the ZIP codes in those cities .Lead contamination typically is greater in urban versus rural areas . AlthougLead dust from work inadvertently carried by parents settles on surfaces and workers\u2019 clothing, where it can be ingested or inhaled by young children . ChildreMany occupations with potential high lead exposures are exempted from Occupational Safety and Health Administration workplace protections, including transportation workers, most public employees, and self-employed workers in industries such as battery reclamation, automobile repair, pottery and ceramics, and stained glass. Undocumented workers are particularly vulnerable because of limited access to exposure monitoring and protective measures.BLLs are significantly higher in warm weather in both national and local studies . The relHaving a smoker in the house has been associated with higher BLLs in children for 30 years . CotininThe current CDC advisory level for intervention in individual children is 10 \u03bcg/dL . It is nAchieving the Healthy People 2010 objective\u2014to reduce BLLs as much as possible and to eliminate childhood lead poisoning\u2014 will require collaboration by all levels of government. This cannot succeed without enforcing all existing standards, ensuring that ambient lead levels continue to decline, and reversing recent trends of increased lead exposures, such as air lead and imported consumer goods. Lead-based paint in housing remains the most common high-dose source of lead in children\u2019s environments. Reducing lead hazards in housing requiresData to be shared across organizational boundariesLocal and state regulatory requirements for lead-safe housingStrengthened enforcement of existing laws, especially cleanupGreater public and private investment for lead hazard control.Some of the most hazardous residential units may not be eligible for HUD\u2019s Lead Hazard Control program because they are uninsured, have outstanding taxes, have other serious code violations, or because the owner cannot be located. In this case, emergency funds are needed to raze buildings that cannot reasonably be made safe. Evidence that primary prevention is effective is mounting. For example, a project initiated in 1998 by HUD, assisted by the Department of Justice, the CDC, and the U.S. EPA, to enforce Title 1018 of the Toxic Substances Control Act has resulted in commitments to make over 185,000 high-risk properties lead-safe by 2006 .Local CLPPPs remain the frontline in identifying lead exposure sources. As particular lead paint hazards are controlled or eliminated, other lead sources assume greater importance and visibility. The CDC recommends that when children with EBLs are identified, CLPPPs identify all sources of lead in the child\u2019s environment . ResearcCreating lead-safe communities can occur only with the active involvement of all levels of government\u2014local, state, and federal\u2014and will depend on several strategies. Foremost are systems that monitor and evaluate all children\u2019s potential lead exposures. Other keys to institutionalizing primary prevention are requirements for lead-safe housing and work practices, dust- and soil-lead testing after repairs in older housing, identification of all lead sources for children with EBLs, elimination of products with dangerous lead levels, and timely mechanisms to share information about lead sources, including toxic properties, across government agencies.State and local officials should evaluate whether their existing primary prevention efforts sufficiently protect children.Federal agencies should support local and state efforts byMonitoring lead in air, drinking water, food, and consumer productsEnforcing laws that control lead contaminationEducating specific populations about lead and controlling exposuresImproving exposure modeling techniques, accounting for all sources of exposureConducting research and ongoing evaluation of lead poisoning prevention activities.The Healthy People 2010 objective to eliminate BLLs \u2265 10 \u03bcg/dL is within our grasp. The course is clear. We must identify and address all existing lead hazards and be vigilant in preventing new hazards. Recent research describes the enormous societal benefits to be reaped from preventing lead exposure in children , with toIn \u201cSources of Lead Exposure,\u201d the percentages given for types of sources were incorrect in the manuscript originally published online. They have been corrected here."}
+{"text": "EHP 116:618\u2013625; Fox et al.][.The harmful effects of low-level lead exposure on the development of cognitive, auditory, and visual-motor functions in children are well documented, but few studies have focused on the effects of low-level lead exposure specifically on retinal and visual functions. A rodent study reported this month provides new evidence that low levels of gestational lead exposure (GLE) can cause permanent retinal abnormalities in adult offspring and supports existing evidence that prenatal lead exposure can affect retinal development and function in humans even at blood lead levels below 10 \u03bcg/dL, the level of concern identified by the Centers for Disease Control and Prevention Researchers exposed two groups of female rats to lead in drinking water. A GLE group was exposed from 2 weeks before breeding through post-natal day 10 and a postnatal lead exposure (PLE) group from delivery through pup weaning. Each group was divided into four subgroups that were exposed to varying doses of lead . Maternal blood lead levels in the GLE rats were similar to those observed in human mothers whose children had experienced prenatal lead exposure.The researchers included the PLE group for comparison because in previous studies PLE caused rod-selective cell death (apoptosis) and decreased retinal electrical activity as measured by an electroretinogram (ERG). Previous studies have demonstrated that postnatal blood lead levels greater than 20 \u03bcg/dL in lead-exposed humans and animals cause decreased ERG amplitudes , whereas children exposed gestationally or postnatally who had blood lead levels of 6\u201316 \u03bcg/dL exhibited increased ERG amplitudes .In the current study, when offspring in the GLE group reached adulthood, the researchers tested the animals\u2019 rod retinal function using an ERG, then counted the number of rods and cones in the rats\u2019 eyes.  Last, the researchers measured the synthesis of retinal dopamine, a neurotransmitter that regulates several retinal processes, including cell survival and eye growth.Results from the GLE group showed an inverted dose\u2013response curve typical of lead neurotoxicity. In adult offspring, low and moderate levels of GLE produced supernormal scoptic ERGs, increased numbers of rod cells and rod bipolar cells, and decreased dopamine synthesis and release in the absence of retinal injury, potentially heightening the likelihood of late-onset retinal degeneration. High levels of GLE produced opposite results.The authors note that the scotopic supernormal ERG can be a noninvasive biomarker of GLE. They also interpret the inverted dose\u2013response curve as a sign of the retina\u2019s long-term vulnerability to low-level lead exposure during gestation. They acknowledge their data may raise complex issues for risk assessment and indicate that dose-and state-dependent effects are important in neurotoxicity risk assessment."}
+{"text": "Lead is a ubiquitous and versatile metal that has been used by mankind for many years. It is a toxic heavy metal that ranks as one of the most important environmental poisons in the world. Research conducted in recent years has increased public health concern about the toxicity of lead at low doses and has supported a reappraisal of the levels of lead exposure that may be safely tolerated in the workplace. Neuropathy is one complication of lead poisoning. The aim of this study is to describe the phenotypic and electrophysiological profile in five male patients working in a battery factory who developed radial nerve neuropathy due to lead exposure. All patients had elevated blood lead levels that were in the toxic range. The concerned regulatory bodies should make it mandatory for workers to undergo regular health checkups to detect signs of lead poisoning and must ensure that workers are aware about the ill effects of exposure to this metal. Chelation therapy removes lead from the blood and soft tissues and chronic lead exposure often requires repeated courses of treatment. The common causes of neuropathy in India include Hansen's disease, diabetes mellitus, Guillain-Barr\u00e9 syndrome, chronic inflammatory demyelinating neuropathy, genetically-determined neuropathy, and various drugs. ExposurePatients with lead neuropathy present with weakness that primarily involves the wrist and finger extensors, but which could also spread to involve other muscles. PatientsThe aim of this study is to describe the phenotypic and electrophysiological profile of five patients with lead neuropathy.In this retrospective audit, we reviewed the case records of five patients who had been diagnosed with lead neuropathy at the Department of Neurology, National Institute of Mental Health and Neurosciences (NIMHANS), Bangalore, India, during the period from 1992 to 2006. The clinical diagnosis of lead neuropathy was based upon the finding of asymmetric or symmetric distal motor weakness, without sensory symptoms or signs, in the presence of a history suggestive of lead exposure. The diagnosis of lead neuropathy was confirmed by the presence of elevated blood lead levels (considered acceptable up to 9 \u03bcg/dl). For measuring blood levels we used the ESA lead analyzer in the Department of Biochemistry, St. John's Medical College and Hospital, Bangalore, India.Detailed clinical and occupational history, demographic data, observations made during systemic evaluation , and results of standard neurological examination  were recorded. Investigations done included routine urine analysis, complete hemogram, and serum biochemistry, including measurement of blood levels of lead. Bone marrow and iron studies were not carried out to exclude other causes of anemia. Motor  and sensory  nerve conduction studies were carried out in all the patients. The following parameters were recorded: distal latency, amplitude of compound motor action potential (CMAP) and sensory nerve action potential (SNAP), conduction velocity, and F wave persistence and latency. All the data were entered in Microsoft Excel for analysis.Five men were diagnosed to have lead neuropathy. Their ages ranged from 30 to 37 years. There was history of occupational exposure to lead in all cases, i.e., they had been working in battery shops or manufacturing units for a mean duration of 7 years. All of them presented with history of wrist-drop and finger drop. None of the patients had sensory symptoms. The demographic and clinical features are shown in the Except for patient 5, all others had anemia. None of our patients had basophilic stippling in the peripheral blood smear. The blood lead level was elevated 4-12 times above normal. Patients 1 and 2 had lead lines in the gum . UrinaryA 35-year-old gentleman, presented with insidious-onset weakness of the right wrist of 2 months' duration; the weakness of the right wrist had been followed, 15 days later, by similar weakness of the left wrist. There were no sensory symptoms. He had been employed in a battery shop for the last 8 years. On examination, there was pallor and a dark line on the gums. Neurological examination revealed wasting and weakness of the wrist extensors bilaterally (MRC grade: 3/5) . There wThe peripheral nerve conduction parameters are mentioned in . The conThree of the patients35 were t3et al. reported that poisoning is almost always caused by ingestion. Lead is absorbed from the respiratory tract into the circulation and is transported on the surface of the red cell, which carries most of the absorbed lead.[Lead is used in industries such as construction, ceramics, paints, plastics, and metallurgy and hence lead poisoning can be considered a common occupational hazard. Inhalation of inorganic lead in the form of fumes, vapors, and mists is a major form of exposure in the occupational setting. Environmental exposure to toxic lead levels due to soil, food, and water contamination can also occur. The common sources of lead poisoning are fumes from burnt car batteries, ingestion of flaking paint, inhalation of vehicle fumes, consumption of food cooked in cheap aluminum or brass utensils or in \u2018kalai,\u2019 i.e., vessels that are poorly coated with tin adulterated with lead, and application of \u2018kajal\u2019 . Tesink bed lead. There arbed lead.A classical description of lead poisoning has been provided by Van Gogh in his autobiographical letters. The symptoms include initial debilitation; stomatitis, with loss of teeth; recurring abdominal pains; anemia (with a \u2018plumbic\u2019 skin tone); neuropathy of the radial nerve; and a saturnine encephalopathy, with features such as epileptic crises, progressive changes in character and periods of delirium. Lead poiet al. (2001) reported 46 patients with neuropathic features who had been exposed to lead for periods ranging from 8 to 47 years (mean 21.7 years). All of them showed mild sensory and autonomic neuropathic features rather than just the motor neuropathy that is classically attributed to lead toxicity. All of them had distal paraesthesiae, pain, impaired pin-prick sensation, diminished or absent ankle jerks, and autonomic vasomotor or sudomotor disturbances. Reduced vibration sensation and postural hypotension were present in all the 20 patients studied. Motor conduction velocity and CMAP amplitudes were normal, with marginally prolonged distal motor latencies. SNAP amplitudes lay at the lower end of the normal range, and the distal sensory latencies were prolonged.[A typical patient of lead neuropathy presents with symmetric distal upper limb weakness and wasting, especially of the forearm and hand muscles; the extensors of the wrist may be selectively weak. The differential diagnosis includes multifocal motor neuropathy, inclusion-body myositis, specific compressive mononeuropathies, posterior interosseous syndrome, focal forms of motor neuron disease, and hereditary predisposition to pressure palsy. There is axonal type of involvement of the peripheral nerves in the upper limbs. The neurologic manifestations of lead depend on the duration of exposure, in that a shorter duration may predispose them to motor neuropathy, as in our series. Rubens et al. observed that measurement of vibration sensory threshold is a relatively effective tool for detecting lead neuropathy in field studies and that lead might cause sensory neuropathy with an effect threshold corresponding to a 5-years' mean blood lead concentration of 31 \u03bcg/dl. The motor neuropathy associated with subacute poisoning is more likely to be a form of lead-induced porphyria rather than its direct neurotoxic effect. It is proposed that the development of lead neuropathy may depend on inherent factors (like genetic constitution) which determine how it is metabolized in the body. The normal conduction velocity observed in lead neuropathy is in full agreement with the hypothesis that the axonal degeneration is due to the biochemical damage to the perikarya of the anterior horn cells.Neuropathic features develop only when lead levels are more than 70 \u03bcg/dl. However, except in one of our patient (patient 4), blood lead levels were less than 70 \u03bcg/dl. Chuang et al. reported that even in neurologically symptom-free lead workers, motor and sensory conduction velocities are slow and, in addition, electromyographic abnormalities like denervation activity and loss or changes in the motor unit potentials may appear.[Seppalainen y appear.14 There y appear. In anothy appear. Electromy appear. These teAll but one of our patients had anemia; this anemia may have been secondary to the lead toxicity or, on the other hand, it could be that the anemia made them more prone to lead toxicity. Recurrent abdominal pain or constipation is common in lead poisoning. There are instances of patients having undergone surgeries for the abdominal pain. It was eet al. (2001), examination of 151 individuals working with lead showed that 46 of them were affected.[All the patients in our series were ignorant of the ill effects of lead and took no precautions at work to prevent exposure. On exposure at the workplace, management includes removal of the patient from the source of exposure and chelation therapy with EDTA (ethylene diamino tetraacetic acid), BAL (British antilewisite), dimercaptosuccinic acid (DMSA), or D-penicillamine. These compounds attach to lead and are excreted through the renal route. Oral supplementation with calcium, iron, and thiamine has also been tried as part of the treatment. EDTA, penicillamine, and British antilewisite may decrease blood lead levels but may not improve neuropathy. The prognosis depends on the duration and level of exposure. We had follow-up details for one patient and this patient improved by 50% at the end of 4 months. In the series by Ruben"}
+{"text": "To date, most of the research on lead and cognitive functioning in older age has focused on men, despite the fact that women live longer on average and therefore may be more likely to develop dementia over the course of their life span. Now, in a prospective look at a subset of data from the Nurses\u2019 Health Study\u2014which began in 1976 and included 121,700 registered nurses aged 30\u201355 years\u2014researchers report that even low-level cumulative lead exposure may exacerbate cognitive decline in older women The study looked at 587 women (now aged 47\u201374 years) who had undergone bone lead evaluations as part of two studies during the 1990s; to assess long-term exposures, bone lead concentrations were determined at each woman\u2019s mid-tibial shaft (shin bone) and patella (kneecap). All but 6 of those individuals had also provided blood samples for assessment of more recent lead exposure.Trained interviewers conducted telephone interviews an average of 5 years after the lead measurements were taken to obtain cognitive data. The interviewers asked participants to perform a variety of tasks related to memory and verbal abilities.The researchers found a significant positive association between cognitive deficits and higher lead levels in the tibia but not in the patella or blood. Because the type of bone in the tibia is known to provide a longer record of lead exposure than other tissues, the research points to long-term exposure to lead\u2014but not to current or recent exposures\u2014as the most likely source of deterioration in cognitive functioning in this population. One standard deviation increase in lead exposure produced, on average, as much decrement in cognitive functioning as 3 years of aging in the women in the study.Lead may damage brain neurons through a range of mechanisms, including oxidative damage and programmed cell death. As the population of older adults grows, it becomes ever more critical to understand ways to ward off dementia. Clues to this understanding may come from studying subtle decreases in cognitive functioning, which, as several researchers have found, often precedes the development of dementia. If other studies confirm the observed relationship between cumulative lead exposure and impaired cognition, measures to minimize exposure or reduce the body\u2019s lead burden could have a substantial impact on aging-related cognitive impairment."}
+{"text": "EHP 116:355\u2013361; Leasure et al.][.Children with low-level prenatal lead exposure may suffer reduced cognitive function, impaired motor ability, and visual and auditory processing problems. Other effects, such as accelerated age-related functional decline or delayed neurotoxicity, may become apparent in adulthood, though few studies have examined the long-term consequences of exposure. A novel animal model now reveals age-related, male-specific, and nonmonotonic dose\u2013response effects associated with low-level prenatal lead exposure To model gestational lead exposure (GLE), one group of dams received tap water or drinking solutions containing low (27 ppm), moderate (55 ppm), or high (109 ppm) concentrations of lead beginning 2 weeks before mating and continuing until postnatal day 10. To measure postnatal lead exposure (PLE), another group of dams received tap water or water that contained low or moderate levels of lead from birth to weaning. The offspring of both groups were measured at birth and several times throughout the following year for weight and blood lead concentrations.Blood lead levels ranged from 10 \u03bcg/dL or less in low-exposure GLE offspring to 42 \u03bcg/dL in the high-exposure GLE group at post-natal day 10, and from 10 \u03bcg/dL in low-exposure PLE offspring to 27 \u03bcg/dL in the high-exposure PLE group at postnatal day 21. By postnatal day 30 for GLE offspring and postnatal day 60 for PLE offspring, blood lead levels were no different than in controls.At 1 year of age, male and female offspring were assessed for exploratory activity and interlimb balance and coordination. Because human developmental studies have demonstrated that males are at higher risk of deficits related to early lead exposure, additional testing of male offspring included measuring fore-brain and striatal levels of dopamine and its major metabolite, 3,4-dihydroxyphenylacetic acid.Lead exposure did not affect body weight of any PLE mice or of female GLE mice, but there was a significant inverse relationship between lead exposure and body weight for male low-exposure and high-exposure GLE mice . Male GLE mice also exhibited significantly less exploratory activity, with a greater effect again seen in the low-exposure group. This group also had significantly poorer balance and coordination, lower forebrain levels of dopamine, and higher forebrain and striatal levels of 3,4-dihydroxyphenylacetic acid.Multiple endocrine or metabolic mechanisms that occurred during gestational development could explain the late-onset obesity observed at 1 year of age. The diminished exploratory activity may reflect an altered stress response arising from lead-related changes in the hypothalamic\u2013pituitary\u2013adrenal axis and dopaminergic systems. Changes in the forebrain may also have implications for attention deficit/hyperactivity disorder, as abnormalities in the prefrontal cortex appear to underlie the disorder. Multidisciplinary behavioral, biochemical, and molecular studies are needed to test and explain the reported novel findings, which highlight the need for realistic lifetime dose\u2013response assessment of toxicants."}
+{"text": "Reasons for the variability in survival among ALS cases are unknown but may include exposure to environmental neurotoxicants.We aimed to determine whether lead exposure, assessed by measuring blood and bone lead levels, is associated with survival in amyotrophic lateral sclerosis (ALS).We evaluated the relationship of lead exposure to ALS survival in 110 cases from a case\u2013control study conducted in New England in 1993\u20131996 that included measurements of blood and bone lead. We retrieved information on date and cause of death through 31 December 2003 from the National Death Index Plus and the Social Security Administration Death Index. We evaluated the relationship of survival to lead exposure using Cox proportional hazard analysis, with adjustment for age, sex, and smoking.We found mortality data for 100 of 110 cases; 93 of 100 death certificates mentioned ALS. Median survival from diagnosis to death was 28 months. Shorter survival was associated with older age at diagnosis, female sex, bulbar onset, shorter interval between symptom onset and diagnosis, and reduced lung function. Shorter survival from diagnosis to death had a weak inverse association with blood lead  and a stronger inverse association with patella lead  and tibia lead ; similar results were found for survival from symptom onset to death.These results suggest that lead exposure is associated with longer survival in ALS cases and, if confirmed, may shed light on mechanisms involved in disease progression. Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease affecting the motor neurons of the spinal cord and brain. Typically, the disease is rapidly fatal; most individuals die within 2\u20133 years of diagnosis, often from respiratory failure . HoweverSOD1) or other genes associated with familial ALS, although variation in these or other genes may increase susceptibility . Diagnosis of ALS by board-certified neurologists specializing in motor neuron disease was based on World Federation of Neurology El Escorial criteria, that is, on the presence of progressive disease with both upper and lower motor neuron signs . We measured bone lead in tibia and patella using K X-ray fluorescence and blood lead using atomic absorption spectrometry (ALAD) gene using polymerase chain reaction\u2013restriction fragment length polymorphism ?\u201d We also recorded dates of first ALS diagnosis and first experience of related symptoms in this interview. We extracted information on respiratory function [forced vital capacity (FVC)] from medical records and available only for a subset of cases  Plus  through 31 December 2003. We considered five items in identifying matches to NDI Plus data: social security number, birth date , first name, last name, and sex. Seventy-eight individuals were complete matches, with all five items identical. Nineteen were partial matches: either four items were identical, or three items were identical and no more than four digits of the social security number were different. Four poor matches did not meet these criteria, and we found no NDI matches for nine individuals; for 3 of these 13 individuals, death dates were found by searching the records of the Social Security Administration and death certificates were retrieved. Thus, date and cause of death were available for 100 of 110 cases (91%). Comparing the 10 individuals without mortality data with the 100 with data, the former were slightly younger  and more likely to be male (8 of 10 vs. 59 of 100), but blood and bone lead levels in the two groups did not differ. ALS was recorded on the death certificate as either an underlying or a contributing cause of death, for 93 of the 100 cases (93%) for whom we had information on date and cause of death.We used Cox proportional hazard analysis to estimate hazard ratios (HRs) and 95% confidence intervals (CIs) using SAS, version 9.1 . We conducted two parallel analyses using as the dependent variable interval from diagnosis to death or interval from symptom onset to death, both defined based on interview data. The 10 cases without mortality data were assumed to be still living and were censored at the end of follow-up; censored individuals contributed person-time to the denominator up to the time of censoring but no events to the numerator. Sensitivity analyses either censoring these individuals at the date of their interview or excluding them gave results similar to those presented below. We censored 7 individuals whose death certificates made no mention of ALS (5 of whom were exact matches) at their date of death, again allowing them to contribute to the denominator but not the numerator. Results were similar if we assumed that these seven individuals had in fact died of ALS and counted them in the numerator.2([Pb] + 32), where [Pb] is lead concentration  interval between first diagnosis and death for the 100 cases with death certificate information was 28 (6\u2013121) months; the median interval between symptom onset and death was 40 (9\u2013207) months. Personal characteristics were associated with both the diagnosis-to-death and the symptoms-to-death intervals. Older individuals and women survived for a shorter time, whereas those who had ever smoked, had no more than a high school education, or were in the lowest quartile of BMI lived longer, although all results were imprecise . ClinicaBlood and bone lead levels of cases were higher than those of controls in the original case\u2013control study . After aWe evaluated the relationship of ALS survival to each lead variable after stratification by age, sex, or the interval between symptom onset and diagnosis. None of these variables substantially modified the association of ALS survival with blood or tibia lead, but we observed the association with patella lead primarily in individuals > 60 years of age, in men, and in those with an interval of no more than 8 months between symptom onset and diagnosis . Exclusir = 0.4 for blood and patella, 0.4 for blood and tibia, and 0.5 for patella and tibia), so we considered relationships among effects of the three lead variables by modeling them together. For the diagnosis-to-death interval, HRs (95% CIs) were 0.9 (0.8\u20131.1) for blood lead, 0.8 (0.3\u20131.7) for patella lead, and 0.4 (0.2\u20130.9) for tibia lead in a model including all three variables. For the symptoms-to-death interval, HRs were 0.9 (0.8\u20131.0) for blood lead, 0.9 (0.4\u20132.2) for patella lead, and 0.4 (0.2\u20130.9) for tibia lead.Blood and bone lead levels were correlated  compared with wild-type homozygotes . The polymorphism was not associated with either the diagnosis-to-death or the symptoms-to-death interval, nor did it affect the association of any of the three lead variables with survival (data not shown).Blood lead levels were not associated with the In this study, we found that lead exposure was associated with longer survival in ALS cases. Results were similar whether we considered the interval between first diagnosis and death or the interval between symptom onset and death. The strongest association was with tibia lead, although blood and patella lead and self-reported occupational exposure to lead were also related to survival.This observation contrasts with our previous finding that lead exposure was associated with increased risk of ALS , thus suAlternatively, it is possible that factors associated with better survival were also associated with higher lead levels in our study population. For example, men have higher lead levels  and liveA third possible explanation for the apparently paradoxical influence of lead on ALS onset and survival is that one of the two associations might be artifactual. Biases of various kinds can arise in studies of factors that potentially influence both disease incidence and disease progression . For exaPrevious studies have indicated that diagnosed ALS is usually reported on death certificates, although there is some variation between and even within countries. For individuals with ALS who could be traced, ALS was mentioned on the death certificate for 95% of cases in Sweden , 75% in A major strength of the present study is the availability of biological measures of lead exposure. Blood lead is considered to reflect recent exposure, and bone lead to reflect cumulative exposure, especially lead in cortical bone such as tibia, which has a half-life of decades . The strStudy limitations include the small sample size. However, our estimates of the associations of lead with survival were precise, particularly for tibia lead, indicating that our study had sufficient power to address its hypothesis. We had no information on tracheotomy or other treatments that may have prolonged life in some patients, but such treatment is likely to be independent of lead exposure and thus unlikely to account for its relationship with survival. We also lacked information on disability from the ALS Functional Rating Scale or similar instrument. Because cases for the study were drawn from two tertiary care centers, results may not be generalizable to the population as a whole. However, our study was comparable with others in the length of survival as well as factors affecting survival .In conclusion, we found that greater lead exposure was associated with longer survival in ALS cases, independent of other personal and clinical characteristics affecting survival or lead exposure. The relationship with tibia lead in particular was strong and consistent, suggesting a role for cumulative lifetime exposure. These results must be interpreted with caution, given the unexpected nature of the finding and the small size of the study, and await replication. If confirmed, these findings may shed light on mechanisms involved in disease progression and could suggest a basis for therapies that prolong survival."}
+{"text": "Even as the Gulf Coast grapples with possibly its worst environmental catastrophe ever, a silver lining has emerged from the devastation of the stormy summer of 2005: both soil lead levels and children\u2019s blood lead levels fell dramatically across New Orleans, Louisiana, after Hurricanes Katrina and Rita swept in clean sediment over the city\u2019s lead-contaminated soil.Howard Mielke, a research professor at the Tulane/Xavier Center for Bioenvironmental Research, says he and his colleagues \u201ctook advantage of a catastrophic natural event to examine changes in the environment and health.\u201d Along with Sammy Zahran at Colorado State University and colleagues, Mielke measured soil lead levels at 46 New Orleans sites in 2000 and in 2006. The researchers obtained pre- and post-hurricane blood lead data for 13,306 children aged 6 years and younger from the Louisiana Childhood Lead Poisoning Prevention Program.After the hurricanes, only 6 of the 46 sites had soil lead concentrations above 400 mg/kg, compared with 15 of 46 sites before the hurricanes. The 400 mg/kg (ppm) cutoff is the point at which the U.S. Environmental Protection Agency recommends remediation of bare soil in children\u2019s play areas; a cutoff of 1,200 ppm is recommended for other bare soil areas. Median soil lead levels fell 46% (from 328.54 mg/kg to 203.33 mg/kg), and median blood lead declined 33% (from 5.14 \u03bcg/dL to 3.45 \u03bcg/dL). In neighborhoods where soil lead declined by 50% or more, blood lead dropped by 53% on average. Children born after Katrina and Rita had the lowest blood lead levels of all those studied.1\u201cThere\u2019s a tremendous amount of lead in New Orleans\u2019 soil\u2014and all cities,\u201d says Mielke. This toxic reservoir, which accumulated when lead was added to paint and gasoline, is constantly being redistributed by rain, wind, and construction activity. The hurricanes\u2019 blanket of cleaner soil\u2014sediment from Lake Pontchartrain and nearby wetlands that was carried through the city\u2019s breached levees by the storm surge\u2014likely will not persist, predicts Mielke. However, the natural effect of the blanket of sediment is duplicated by soil remediation, in which clean soil with no more than 5 ppm lead is hauled in and deposited on a geotextile barrier. The barrier allows water to pass through but contains the lead and prevents anyone from digging into contaminated soil underneath.Soil is often an underappreciated source of childhood lead exposure in cities, relative to lead paint in homes,3Mielke has worked with New Orleans area child-care centers where soil has contained 500\u20135,000 mg/kg lead. \u201cIf we pay attention to environments where children play in the very early years of life, we may reduce their blood lead levels,\u201d Mielke says.Mielke also thinks the current blood lead level of concern of 10 \u03bcg/dL\u2014the level at which the Centers for Disease Control and Prevention recommends medical intervention\u2014is too high. Studies show that just 2 \u03bcg/dL adversely impacts the heart,"}
+{"text": "The source of the lead, in turn, was determined to be contamination resulting from the reclamation of used lead\u2010acid batteries, a lucrative business in developing countries that often is performed in the open with few pollution controls.In a neighborhood of Dakar, Senegal, 18 children died from an aggressive central nervous system disease between November 2007 and March 2008. Experts from the World Health Organization and local health authorities were called in to investigate the deaths, but cultural prohibitions preempted autopsies of the children. So the researchers examined 32 of the children\u2019s siblings and 23 of the siblings\u2019 mothers along with 18 unrelated local children and 8 unrelated adults. They concluded that the cause of death likely was encephalopathy resulting from severe lead poisoning Since 1995, local people had broken apart batteries from vehicles and appliances and sorted the components in an open sandy area of the neighbhorhood. They sifted through the sand for scraps of valuable lead to sell, even carrying sacks of contaminated sand into their homes. People were probably exposed by inhaling and ingesting lead dust, with children particularly exposed through hand\u2010to\u2010mouth activity and eating the contaminated soil.The developing nervous system of children is particularly vulnerable to the toxic effects of lead. Blood lead concentrations as low as 10 \u03bcg/dL are known to impair neurologic development, resulting in permanent intellectual impairment. However, recent evidence suggests there may be no safe threshold of exposure.Among the 50 children tested, blood lead levels ranged from 39.8 to 613.9 \u03bcg/dL. Seventeen of the 50 children showed neuropsychiatric symptoms including convulsions, irritability, and aggression, and 21 showed gastrointestinal symptoms such as anorexia and vomiting. Adult blood lead levels ranged from 32.5 to 98.9 \u03bcg/dL, and their most commonly reported symptom was gastrointestinal upset.Recycling activity reportedly ended by March 2008 following a public awareness campaign, and the neighborhood soil was partially remediated. Nevertheless, lead concentrations measured in the sandy work area after this time still reached 209,000 mg/kg, and levels inside homes reached 14,000 mg/kg. The U. S. Department of Housing and Urban Development sets 400 mg/kg as for the standard for lead in bare soil in children\u2019s play areas .The lead poisoning in this study was severe enough to catch the attention of health experts, but the global incidence of lead poisoning from battery recycling is unknown. The authors believe many cases go unaddressed in developing countries because local authorities lack resources to recognize, diagnose, and manage lead toxicity. However, they write, lead poisoning can be prevented through measures such as public education and the implementation and enforcement of lead recycling guidelines."}
+{"text": "EHP 117:461\u2013467; Gaitens et al.; EHP 117:468\u2013474; Dixon et al.] has linked even lower blood lead levels with adverse effects.Despite reductions in child blood lead levels, the U.S. Centers for Disease Control and Prevention (CDC) estimates on the basis of 1999\u20132002 data that some 310,000 children still have levels above the agency\u2019s threshold of concern, 10 \u03bcg/dL. Such children are at increased risk for cognitive impairment and behavioral problems. Mounting evidence [e.g., 2, and 4.0% failed the standard for windowsills of 250 \u03bcg/ft2. Income, race/ethnicity, floor condition, windowsill dust lead content, year of home construction, recent renovation, smoking, and survey year all were significant predictors of floor dust lead loading, which was more predictive than windowsill dust lead of elevated blood lead in residents.The current studies examined lead- and housing-related data for a nationally representative group of 2,155 children aged 1\u20135 years, drawn from the National Health and Nutrition Examination Survey (NHANES) from 1999 through 2004. In addition to blood lead data, dust samples had been collected from floors and windowsills in the children\u2019s homes and analyzed for lead content. The study by Gaitens et al. showed that dust lead levels in the great majority of homes met or exceeded federal standards: just 0.16% of homes failed the standard for floors of 40 \u03bcg/ft2) up to the federal standard of 40 \u03bcg/ft2. Based on logistic regression models, the authors estimated that among children living in pre-1978 homes with floor dust lead levels of 12 \u03bcg/ft2, 4.6% would have a blood lead level of at least 10 \u03bcg/dL, whereas 27% would have a level of at least 5 \u03bcg/dL. Because the blood lead and dust lead levels observed in the NHANES data set were relatively low, the researchers verified the models\u2019 predictive capacity by analyzing data from three high-risk populations with higher levels of both blood lead and floor dust lead than those observed in NHANES.Dixon et al. examined blood lead levels for the same 2,155 children and used a linear regression model to predict children\u2019s blood lead given a range of floor dust lead concentrations from very low (0.25 \u03bcg/ftThe studies indicate that most U.S. homes already meet federal standards for floor and windowsill dust lead levels, but also suggest that further tightening of the standards would afford greater protection for today\u2019s children. However, although data for both studies came from a nationally representative sample of children, the homes may not necessarily represent the U.S. housing stock. The authors cite the need for an integrated health and housing survey that is representative of both the population and the housing stock, similar to surveys recently conducted in Europe."}
+{"text": "EHP 117:26\u201331; Ettinger et al.][. Such supplementation could help mitigate the adverse effects of prenatal lead exposure, which include low birth weight, lower intelligence scores, and impaired motor and visual skills.Lead, like calcium, is stored in bones and generally does not circulate throughout the body. But the demands of pregnancy and lactation trigger the release of calcium, which also releases lead into the maternal blood stream. Researchers previously showed that daily calcium supplementation during lactation reduced maternal blood lead by 15\u201320% and lead in breast milk by 5\u201310%. A new study by the same team shows that taking inexpensive calcium supplements daily also reduces blood lead levels during pregnancy The study included 557 women recruited in the first trimester of pregnancy from prenatal clinics in Mexico City. The women were recruited from 2001 to 2003; Mexico completed the phase-out of leaded gasoline in 1997, so women enrolled in the study had been exposed for many years to high environmental lead levels prior to becoming pregnant. In addition, just over one-third of the women used the traditional lead-glazed pottery that is common in Mexico. Half the women received 1,200 mg of calcium daily and the others received placebos.Blood lead levels were checked in the first (baseline), second, and third trimesters of pregnancy. The Mexican women enrolled in the current study had an estimated average dietary calcium intake of 900 mg per day, which parallels national surveys of U.S. women. Blood lead levels declined more in the second trimester than in the third, with reductions averaging 14% and 8%, respectively. Women who were more compliant with the calcium regimen had higher reductions in blood lead relative to the placebo group. The most compliant women\u2014those who took at least 75% of their calcium supplements\u2014showed a 24% drop in blood lead levels over the course of pregnancy, with the greatest reduction (31%) occurring in women who were most compliant and who also cooked, served, or stored food in lead-glazed pottery, and who had the highest bone lead levels. The investigators conclude that calcium supplements should be considered as a low-risk, cost-effective means for lowering fetal lead exposure."}
+{"text": "In Poland, children are exposed to lead from the combustion of leaded gasoline and industrial processes.Since the early 1990s, emission levels have declined, and a ban on leaded petrol is anticipated in 2005. Majorindustrial sources are located in Silesia Province and the copper mining centre (Legnica region). Concernsabout, lead exposure in children date back to the 1980s; mean blood lead levels (BILL)reported in childrenliving near lead smelters in Silesia exceeded 20ug/dl. in the 1990s, mean BLLs were decreasing, both inurban children and those living near lead industry. Lower than the CDC action level of 101ug/dl, they werehowever higher than mean values in children from the other countries, where leaded gasoline had alreadybeen banned. Childhood lead poisoning prevention requires a comprehensive approach, involving differentsectors. Medical prevention focuses on the early detection of exposed child by the blood lead testing andindividual case management. An increasing body of evidence, indicating adverse effects even below thecurrent \u201csafe\u201d level of 101ug/dl, argues for intensification of the primary prevention, which requires legal,economic and technical measures. Public health efforts should contribute to the reduction and elimination ofsources of exposure in child\u2019s environment and public education campaigns."}
+{"text": "Gymnogyps californianus) released into the wild in Arizona ranged widely in Arizona and Utah. Previous studies have shown that the blood lead concentrations of many of the birds rise because of ingestion of spent lead ammunition. Condors were routinely recaptured and treated to reduce their lead levels as necessary but, even so, several died from lead poisoning. We used tracking data from VHF and satellite tags, together with the results of routine testing of blood lead concentrations, to estimate daily changes in blood lead level in relation to the location of each bird. The mean daily increment in blood lead concentration depended upon both the location of the bird and the time of year. Birds that spent time during the deer hunting season in two areas in which deer were shot with lead ammunition (Kaibab Plateau (Arizona) and Zion (Utah)) were especially likely to have high blood lead levels. The influence upon blood lead level of presence in a particular area declined with time elapsed since the bird was last there. We estimated the daily blood lead level for each bird and its influence upon daily mortality rate from lead poisoning. Condors with high blood lead over a protracted period were much more likely to die than birds with low blood lead or short-term elevation. We simulated the effect of ending the existing lead exposure reduction measures at Kaibab Plateau, which encourage the voluntary use of non-lead ammunition and removal of gut piles of deer and elk killed using lead ammunition. The estimated mortality rate due to lead in the absence of this program was sufficiently high that the condor population would be expected to decline rapidly. The extension of the existing lead reduction program to cover Zion (Utah), as well as the Kaibab plateau, would be expected to reduce mortality caused by lead substantially and allow the condor population to increase.California condors ( Gymnogyps californianus) became extinct in the wild in the 1987 when the last wild individual was captured and added to the captive flock, which then consisted of 27 birds. Since 1992, releases of these birds and their captive-bred progeny have re-established wild populations of condors in California, Mexico and around the Grand Canyon in Arizona and Utah. Individual condors in these populations have suffered from lead poisoning caused by ingested ammunition, which is the most frequently diagnosed cause of death among Grand Canyon condors. This holds despite intensive efforts to monitor blood concentrations of lead and to treat birds with high levels using chelating agents The California Condor , Colorado River Corridor, Kaibab Plateau, South Zone and North Zone (Utah). A location was taken to be a roost location if it was obtained later than16.00h. local time. Condors are known to range widely, even within a day Numbers of deer, elk and buffalo reported as killed by hunters in each zone in 2005\u20132007 were obtained from the Arizona Game and Fish Department and the Utah Department of Natural Resources. We estimated the number of carcasses and gut piles potentially contaminated with lead and left in the field for scavengers by using information collected on the proportion of kills made with lead ammunition and the number of lead-killed animals from which gut piles were brought in by hunters for safe disposal. We also assumed that in addition to the number of animals reported as killed with lead bullets, an additional 10% of that number were wounded and died unrecovered soon after, thereby becoming available to condors.t (in days) since ingestion is given by exp(\u22121tk), where 1k is a constant, and (1\u2212exp(\u22121tk)) is the proportion of lead ingested that has moved from the gut to the blood by that time. We also assumed that a constant proportion per unit time of the lead present in the blood was lost to another compartment, such that the amount in the blood would decline by a proportion (1\u2212exp(\u22122k)) per day in the absence of absorption. The quantity of lead in the blood, as a proportion of that ingested, is then given by the functiont). Note that this expression approximates to g(t)\u200a=\u200aexp(\u22122tk) when 1k is much larger than 2k. That is, when absorption from the gut is very rapid, blood lead concentration declines exponentially with time since ingestion. The model is illustrated for a single value of 2k and three values of 1k in We assumed that, with no further ingestion, the relationship between blood lead concentration and time after ingestion of fragments of metallic lead could be described by a simple three compartment model, with one-way movement of lead between successive pairs of compartments. Although this model is a simplification, it has the advantage of requiring the estimation of only two parameters and seems likely to capture the main features of real changes in blood lead. We assumed that a constant proportion of the ingested lead enters the blood from the gut per unit time and that fragments are not expelled from the gut within the period that significant absorption is occurring. Hence, the proportion of the lead ingested that remains in the gut at time t) to explore how the concentration of lead in the blood of an average condor would be expected to change over time, given the possibility of ingestion of lead on more than one day. We assumed that the condor spends some time in areas where there is a high risk each day of ingesting lead and some time in low risk areas. We imagined a large number of condors, all showing the same movement pattern. On each successive day, the average quantity of lead ingested by the birds would, if it was all absorbed immediately, increase the average concentration of lead in the blood by an amount m, which we call the mean daily blood lead increment. In fact, we would expect the component of the concentration of lead in the blood derived from the lead ingested on a given day to be given by m g(t), where t is the time elapsed since that day. How the lead ingested on successive days would influence the total concentration of lead in the blood can be visualised with the aid of the schematic diagrams shown in t)\u200a=\u200aexp(\u22122tk) in this illustration, but the equivalent for the function given by Eq.(1) can easily be envisaged. Consider first a sample of birds that remain in an area with a low risk of ingesting lead (area A). If the average amount of lead ingested per day is small relative to the rate at which it is eliminated from the blood, we would expect that the average blood lead concentration would decline over time (t) was of the form that the blood lead concentration from a given day's ingested lead first increased and then decreased (as in t) and the mean daily blood lead increment for different zones.We next used the function g to calculate E(sv), the expected value of sv, from the observed value fv and provisional starting values of the parameters 1k, 2k and im. The values of the im were assumed to be specific to each zone used by the condors and to be different between the hunting season and outside the hunting season. Hence, there were 10 values of im, two for each of the five zones. For each observation, we then calculated the log-likelihood of observing blood lead level sv, given the expected value E(sv), assuming that observed values were distributed log-normally around the expected mean value with variance s2. We summed these log-likelihoods to give the total log-likelihood of the data under the model. We then used a simplex procedure to find the values of the parameters 1k, 2k, im. and s which maximised the log-likelihood. Because the logic underlying our model does not permit the mean daily blood lead increment to be negative, estimated values of im were constrained to exceed zero using log transformation. Some sv values measured only with the field tester were known to exceed its upper limit of quantification, but the actual values were unknown. These were treated as right-censored observations exceeding the upper limit of quantification in the likelihood calculation It is evident from m from the analysis described above and the observed movements of each bird to reconstruct expected values E(v) of blood lead concentration from Eq.(2) for every day on which each bird was free-ranging. Next, we took a weighted mean of the E(v) on days up to and including each focal day on which the bird was free-ranging. We considered it necessary to use in the model the weighted mean of E(v) on the focal day and a set of previous days, rather than just E(v) on the focal day itself, because it seemed biologically realistic for the probability of death to be determined by a bird's recent history of blood lead concentration. We used a weighting function, so that the weight for a given day it on or previous to the focal day t* was exp(\u2212(t*\u2212it)2/q2), where q is a constant. We used logistic regression to fit the relationship between the daily probability of death from lead poisoning and the weighted mean of E(v) on and prior to each focal day. We used a bisection search to determine the value of the parameter q of the weighting function that maximised the log-likelihood of the data. The data to which the model was fitted comprised all bird-days in 2005\u20132007 on which condors were free-ranging, including the two bird-days on which deaths from lead poisoning of free-living birds occurred and four bird-days on which birds were taken into captivity with high blood lead levels from which they subsequently died. We obtained confidence limits of the parameters of the logistic regression and of q by a bootstrap procedure. We drew a bootstrap sample, with replacement, from the data contributed by the 60 individual condors, with individual birds as bootstrap units. From this sample we estimated the m and k values as described above, reconstructed the E(v), and then estimated q and the logistic regression parameters. We took 1,000 such bootstrap samples and took the central 950 estimates for each parameter as its 95% confidence interval.We wished to estimate the daily probability of a condor dying from lead poisoning as a function of its recent history of movement among zones in a way that would be likely to reflect its exposure to lead. It was not practical to model the daily probability of death from lead poisoning as a function of recent presence in all of the five zones within and outside the hunting season. This is because only eight deaths from lead poisoning were observed in 2005\u20132007 and, of these, two deaths occurred early in 2005 with inadequate data on their prior movement history, leaving only six birds with sufficient information. A model with many parameters cannot be supported by this small sample size. Therefore, we undertook the modeling of mortality in two steps. First, we used the zone- and season-specific estimates of mean daily blood lead increments z . We also wished to allow the probability of movement to be free to vary systematically with time across the whole three year period. We therefore also included a quadratic function relating the logit probability of movement to the time, in years y elapsed since 31 December 2004. The expression used wasf are constants. We estimated the parameters of this logistic regression model using a maximum-likelihood method.We wished to use information on movement patterns to simulate condor mortality from lead intoxication in the absence of intervention to remove condors from the wild and to treat those with high blood lead levels. Clearly, we could not use the observed movement pattern directly for this because runs of days in particular zones that would otherwise have occurred were disrupted by capture and removal from the wild. We therefore made a statistical model, based upon the observed sequences of movement among zones, to describe the probability that a condor present in a given zone on one day (the origin zone) would move to another specified zone (the destination zone) on the next day, rather than remaining in the origin zone or moving elsewhere. Inspection of the data on observed and interpolated roost locations for 2005\u20132007 indicated that there was an annual cycle in the use made of the different zones. Hence, we fitted a model in which the logit of the daily probability of a condor moving between two specified zones was a sinusoidal function of time of year We used a Monte Carlo process, together with the statistical model of movements among zones described above, to simulate movements of condors among zones for the three-year period 2005\u20132007. For each of 10,000 simulated condors, we generated a random number on each successive day. We used it and the probabilities for that day of movement from the origin zone to each of the four destination zones, obtained from Eq.(3), to determine which zone each bird moved to, or whether it remained within the origin zone. The origin zone on the first simulated day was selected by generating a random number and using the observed proportions of known locations of birds on 1 January 2005 to allocate the bird to a starting zone. We then ran the model for one year using 2005 dates as a burn-in procedure and then continued to run the model for a further three years, starting again from 1 January 2005; only this latter period being used further. We summarized the simulated movements by calculating the proportion of simulated condors in each zone on each day of the three-year period.t), with maximum-likelihood estimates of its parameters, and by adding the mean daily blood lead increment expected for the zone and season, again using the maximum-likelihood estimates. We calculated the geometric mean and the variance of the simulated blood lead concentrations on each day. The variance was obtained by adding together the variance of the modeled blood lead levels calculated across simulated individuals and fitted value of the residual variance s2 from the model of blood lead concentration in relation to zone (see above). Proportions of simulated condors in different categories of blood lead concentration on each day were then calculated from the geometric mean and variance. Categories were defined according to Franson et al.For each simulated condor, we also estimated its expected blood lead concentration on each day by allowing the lead present on the previous day to change according to the function g(v) for the focal day and previous days and the weighting function, with the maximum-likelihood value of q. We then used the maximum-likelihood values of the parameters of the logistic regression relating the daily probability of death to weighted blood lead level to calculate the expected probability of death. A random number between zero and one was generated and, if it was less than the expected value of the probability of death, the condor was simulated to have died from lead poisoning. The simulation for that bird was then terminated. The procedure was repeated for all 10,000 simulated condors. From the set of simulations, we calculated the proportion of the cohort of birds present on 1 January 2005 that had not yet died from lead poisoning on each successive day until the end of 2007. This gave a simulated survivorship curve, ignoring mortality from other causes. We also obtained the proportion of birds simulated as not having died from lead intoxication at the end of the three years. We raised this proportion to the power 1/3 and then subtracted the result from one to give the simulated average annual mortality rate from lead poisoning.We also used the Monte Carlo model of condor movements and blood lead levels, described above, to estimate the mortality rate caused by lead intoxication. On each successive day of the simulated sequence, we calculated the weighted mean expected blood lead level, using values of E that relates blood lead concentration to time since ingestion. The one-parameter version of g(t) gave a higher log-likelihood and we therefore selected it for reasons of parsimony. The maximum-likelihood value of the parameter 2k was 0.0408 (95% confidence limits 0.0286\u20130.0581). This function describes an exponential decline in blood lead concentration with a half-life of 17.0 days (95% confidence limits 11.9\u201324.2 days).We fitted the model summarized in Eq.(2) to the 322 pairs of blood lead measurements derived from 60 condors, as described above. We used both the one-parameter and two-parameter forms of the function g(m from the fitted model summarized in Eq.(2), with the one-parameter version of g(t), are shown in r\u200a=\u200a0.708) and deviations from the expected values were approximately uniform across the range of expected values  for most zones and seasons, but strikingly higher (>14 \u00b5g dL\u22121 d\u22121) in the Kaibab and North zones during the hunting season. The daily blood lead increment was much lower outside the hunting season than within it for both the Kaibab and North zones, with the difference between hunting and non-hunting seasons being smaller and inconsistent in direction for the other zones  with similar effectiveness to the existing program in the Kaibab zone. To do this, we used the value of Our analysis of changes in blood lead concentration between release and recapture reveals a striking tendency for condors to run a high risk of acquiring elevated blood lead concentrations when they visited the Kaibab and North zones during the hunting seasons for deer and elk in 2005\u20132007. These two zones are those in which the largest numbers of these quarry species were hunted. A previous analysis Changes in blood lead levels were affected by the location of the condors over a considerable period prior to sampling. The results were consistent with ingestion of lead being followed, in the absence of further ingestion, by a progressive exponential diminution in its concentration in the blood, with a half-life of 17 days. This pattern is broadly similar to that found in a previous study of captive condors with initially high levels of lead in the blood The daily death rate from lead intoxication was highest if blood lead levels, simulated using observed movements and the model of lead acquisition and depletion, remained high over a period exceeding one hundred days. Short periods with similarly high blood lead resulted in a lower death rate per day. We think it likely that this reflects a cumulative effect of protracted high blood lead levels on organ function. Condors that visited the Kaibab and North zones less frequently during the hunting season, and which therefore were not simulated as acquiring such high concentrations for such a long period, were much less likely to die from lead intoxication. The Kaibab and North zones were probably especially attractive to condors during the hunting season because of the large quantity of remains of hunted deer and elk available as food there, compared with other parts of the study area.We used a previously published population model Our simulations indicated a large effect of the existing program to reduce exposure of condors to lead from carcasses and gut piles of deer and elk killed using lead ammunition. At present, this program only covers the Kaibab zone. A simulation of the likely mortality rate due to lead if this program was not in place indicates a very high death rate. A previously published population model Simulation of the extension of the existing lead reduction program to cover the North zone (Utah), as well as the Kaibab Plateau, indicates that this would reduce mortality caused by lead intoxication substantially. With this level of mortality due to lead, the population model indicates that the condor population would increase unless reproduction was at the \u201cmost likely\u201d level and adult mortality not caused by lead was at the worst-case (upper) end of the likely range . Hence, Poisoning caused by ingestion of spent lead ammunition is a widespread hazard to many species of wild birds"}
+{"text": "When it comes to industrial lead processing, The Doe Run Company\u2019s smelter is in a class by itself. Perched on the banks of the Mississippi River in Herculaneum, Missouri, the smelter\u2019s blast furnaces convert vast amounts of lower-grade ore into more than 125,000 tons of nearly pure commercial-grade lead every year. In operation since 1982, this is both the nation\u2019s largest primary lead smelter and its largest point source for lead emissions, with just over 59 tons of lead released to the air in 2005, according to the most recent figures from the National Emissions Inventory of the U.S. Environmental Protection Agency (EPA). By comparison, that year\u2019s next-highest emitter\u2014a Missouri lead recycling facility also operated by Doe Run\u2014released 12.4 tons.3 to 0.15 \u03bcg/m3.Doe Run\u2019s smelter in Herculaneum may be the nation\u2019s largest point source for air lead emissions, but it\u2019s not the only one. The National Emissions Inventory, whose next release is expected 31 December 2010, lists 200 facilities emitting between one-half and 1 ton of the metal annually and 139 facilities emitting more than 1 ton. These facilities, which include smelters, battery recyclers, metal foundries, power plants, and airports, represent new and ongoing sources of lead air pollution that will soon draw additional scrutiny from the EPA. Among them, only one\u2014Doe Run\u2019s Herculaneum smelter\u2014put its surrounding community out of compliance under the original National Ambient Air Quality Standard  for lead under the Clean Air Act. That will soon change, however, for in 2008, the EPA dropped the lead NAAQS for the first time in 30 years, from 1.5 \u03bcg/mStates have until 2017 to meet the new standard. But if 2005\u20132007 emissions data hold, up to 18 additional locations will be out of attainment with the new lead NAAQS, including communities in Alabama, Colorado, Florida, Illinois, Indiana, Minnesota, Missouri, New Jersey, Ohio, Pennsylvania, Tennessee, and Texas. Meanwhile, the emergence of new nonattainment areas puts a spotlight on point sources, or identifiable sources of concentrated emissions, which\u2014in the EPA\u2019s view\u2014account for the dominant share of lead air risks in the United States today. \u201cIt\u2019s appropriate to infer that point sources\u2014especially now with the removal of lead from gas\u2014are the main routes of exposure to lead in outdoor air, at least in this country,\u201d says Lewis Weinstock, group leader of the EPA Ambient Air Monitoring Group.That view puts the EPA squarely at odds with the lead industry. David Weinberg, a lawyer with Battery Council International (BCI), a trade group in Washington, DC, argues that \u201clegacy\u201d contamination from old leaded gas and house paint contributes more to elevated blood lead than point-source emissions do. Exposure to legacy lead occurs both by ingesting contaminated soils and by inhaling resuspended road dusts and soils. \u201cWe\u2019re making tremendous strides controlling industrial lead emissions with closed-loop cycles,\u201d Weinberg says. \u201cAnd as you lower ambient levels of concern, historic sources\u2014i.e., residual paint and gas contamination\u2014become increasingly important.\u201dall of these sources,\u201d he says, \u201cbecause even the smallest exposures to lead are now understood to cause damage to the developing brains of young children.\u201dPhilip J. Landrigan, a pediatrician and lead researcher at Mount Sinai School of Medicine, points out, however, that the dominant source of exposure for a particular child depends on where the child lives. \u201cIt is very important to document lead emissions from It\u2019s impossible to know all the locations that will be put out of attainment under the new standard. That\u2019s because in many parts of the country, the lead monitoring network isn\u2019t developed enough to measure compliance with it, Weinstock says.During the network\u2019s peak activity, in 1980, more than 900 monitors were positioned near point sources, along roadsides, and in urban locations. Like large vacuum cleaners, the samplers used in the monitoring network trap airborne lead in filters, which are then removed and analyzed. Readings are taken every 6 days, with ambient air levels calculated as rolling 3-month averages, yielding 12 averages per year . After the phaseout of leaded gas began in 1976, the amount of lead in air fell sharply, Weinstock says, and the EPA reduced its monitoring network accordingly. By 1998, the number of active monitors had dwindled to 290, and today roughly 130 are operational, mostly near point sources, according to agency spokeswoman Cathy Milbourn.Federal Register.Now the EPA proposes to expand its network with new monitors placed near point sources to assess NAAQS compliance, and also at the agency\u2019s 80 NCore stations, which monitor multiple airborne pollutant levels for research rather than regulatory purposes. If approved, the new monitors would begin operating in 2011. As part of this new strategy, the EPA also proposes to rescind an earlier decision to phase in 100 monitors in cities with populations of more than 500,000 people. Details of the proposed new monitoring strategy were described in the 30 December 2009 http://www.cdc.gov/nceh/lead/) show that in 1998, nearly 3.5 million children had blood lead levels exceeding 10 \u03bcg/dL (the action level at which intervention is recommended), compared with about 250,000 today.This change in emphasis reflects declines in childhood blood lead coinciding with the reduction in leaded gas. National surveillance data collected by the Centers for Disease Control and Prevention and published on its Lead website  revealed that 28% of 118 young children tested had blood lead levels exceeding 10 \u03bcg/dL\u2014far higher than the national average for that year of 7.6% and the Missouri state average of 8%. Among children living closest to the plant, 45% had blood lead exceeding 10 \u03bcg/dL. The most recent data from the MDHSS, for 2006\u20132008, showed no evidence of blood lead levels above 10 \u03bcg/dL in any child tested in Herculaneum\u2014including those living in high-risk areas.Multiple factors account for this change, says MDHSS environmental specialist Jonathan Garoutte. Prodded by federal, state and local agencies, as well as the community itself\u2014Doe Run bought out properties within a half-mile radius of the plant, redirected truck traffic away from local neighborhoods, and remediated yards where lead levels of up to 33,100 ppm had once been detected. Moreover, Doe Run spokeswoman Tammy Stankey says that with process controls annual lead emissions from the smelter fell to 22.4 tons in 2008 (a 62% reduction over 2005 emissions), as reported to the EPA Toxics Release Inventory.Yet in October 2009, the EPA reported that more than a third of 372 soil samples taken within a mile of the smelter were contaminated with lead at levels above the agency\u2019s 400-ppm threshold for remediating play areas. Most of those properties had already undergone EPA-ordered lead remediation during the last decade, but \u201c[w]hile Doe Run has taken some steps in recent years to reduce lead emissions, those efforts clearly fall short of what was necessary,\u201d said acting EPA regional administrator William Rice in a 26 October 2009 press release.Relationships between point-source emissions and exposure aren\u2019t always obvious, and it can be challenging to directly connect them to elevated blood lead in children. The new lead NAAQS was calculated with models that relate what\u2019s in the air to what ends up in children\u2019s blood by way of their exposures to soil, house dust, and other media. When the first NAAQS was derived in 1978, leaded gas was ubiquitous, and the EPA determined that most exposure to the toxicant came from breathing exhaust fumes. Today, however, in developed countries that don\u2019t use leaded gas, the dominant exposure route to lead air emissions has shifted to incidental ingestion of lead particles that drift to the ground.In many places, point sources merely add to legacy contamination, and it can be difficult to distinguish this new fraction from what was already there, according to Howard Mielke, a professor at the Tulane University/Xavier Center for Bioenvironmental Research. Scientists hope to \u201cfingerprint\u201d lead isotopes to identify originating sources of lead pollution, Mielke says, but these research efforts are still preliminary.Industry groups, meanwhile, insist that most lead-poisoned children live in poor, urban neighborhoods where legacy sources account for the greatest risk. In a 4 August 2008 letter to the EPA in response to the agency\u2019s proposal to strengthen the lead NAAQS, Timothy J. Lafond, chair of BCI\u2019s Environment Committee, argued it\u2019s pointless to go after industrial sources when lead threats to children occur mainly in high-poverty areas. Quoting a technical report supplied on contract to BCI by the Menlo Park, California\u2013based consulting firm Exponent, he wrote, \u201c\u2018there is practically no relationship between the emission rate and maximum monthly lead concentrations\u2019 at sites other than the Herculaneum smelter.\u201d The better approach, Lafond wrote, would be to concentrate air monitors in high-poverty areas, which he says could be easily located with census data.Legacy lead can remain in soil for hundreds of years, posing ongoing threats to children, Mielke acknowledges. And those contaminated soils can be resuspended in the air, especially during hot summer months, he says, posing threats that cause blood lead levels to vary on a climatic basis. Mielke has analyzed data from the Louisiana Childhood Lead Poisoning Prevention Program in conjunction with high-resolution soil sampling by census tracts. \u201cWe tend to see levels in soil from poor, inner-city neighborhoods that range between 500 and 1,000 ppm,\u201d he says. \u201cAnd those are the levels that seem to correlate with blood lead concentrations beyond 10 \u03bcg/dL.\u201dMarie Lynn Miranda, director of the Children\u2019s Environmental Health Initiative at Duke University, adds that lead risks to the urban poor generally occur where homes were built before the regulations phasing out leaded gas and house paint. And in general, she says, the older urban neighborhoods tend to be found in northern regions of the United States. However, she adds, there are exceptions, New Orleans among them.Mielke\u2019s research shows that leaded gas is still a surprisingly important source of urban contamination. \u201cYou can calculate how much lead would have been generated in a half-mile radius around a major intersection with a hundred thousand cars per day, and it\u2019s like having a secondary smelter in there,\u201d he says.All this suggests that at least in urban locations\u2014and particularly during the late summer\u2014inhalation could play a greater role in exposure than might otherwise be assumed. But that assumption brings up other uncertainties, Mielke says, such as differences relating to ingestion and inhalation among younger and older children, who might not engage in as much hand-to-mouth activity. \u201cIt\u2019s very complex, and sadly, we\u2019re using children to figure all this out,\u201d Mielke says.Given the threats posed by legacy contamination, Weinberg stresses the EPA and state agencies should focus on areas where lead risks are highest, rather than targeting point-source emissions. Indeed, says Kar, \u201cLegacy pollution can and is being addressed under different programs such as lead hazard reduction programs and Superfund, in addition to the Clean Air Act. It\u2019s just not being addressed enough.\u201dKar points out the EPA\u2019s regulatory mandate under the Clean Air Act is primarily focused on targeting sources of new pollution, although the act does consider legacy contamination that contributes to future violations of air pollution standards\u2014for example, resuspended soil dust at a lead-polluted site. \u201cThe contribution of such resuspension is not excluded when violations of the NAAQS are determined, and strategies may need to be developed to prevent such ambient air pollution,\u201d he says.Weinstock emphasizes that companies can try to avoid point-source monitoring with their own dispersion models. If those models show air levels won\u2019t exceed 50% of the lead NAAQS, he says, monitoring requirements can be waived by the responsible agency , but only with the EPA\u2019s permission.The bright spot in all this is that on average, blood lead levels appear to be falling nationwide. Yet that benefit isn\u2019t always shared equitably with inner-city children, who still bear the brunt of ongoing lead pollution. Moreover, when one considers how small a dose lead is believed to harm a child\u2019s brain\u2014evidence now suggesting that in fact there is no safe threshold of exposure\u2014emissions measured by the ton should give anyone pause."}
+{"text": "This article describes the personal experience and perspective of the authors, who had primary responsibility for drafting the initial health-based regulation limiting lead content of gasoline during the early 1970s while employed by the U.S. Environmental Protection Agency (EPA).Information used by the U.S. EPA in developing the initial health-based regulation limiting lead content of gasoline in December 1973 and studies documenting the impact of that and subsequent actions.Among the lessons learned from this experience is the importance of having input from independent scientists to the regulatory decision-making process. This also demonstrates the critical role of independent peer-reviewed research, such as that supported by the National Institutes of Health, as well as research conducted by scientists from the Centers for Disease Control and Prevention, in delineating the consequences of lead exposure in the population.Removal of lead from gasoline in the United States has been described as one of the great public health achievements of the 20th century, but it almost did not happen. The experience of the authors in developing this regulation may be helpful to others involved in developing health-based regulatory policy in the future.The initial U.S. EPA health-based regulation to remove lead from gasoline is clearly an example where science successfully affected public policy. The leadership of the U.S. EPA at that time deserves much credit for establishing an atmosphere in which this was possible. Removal of lead from gasoline in the United States has been described as one of the great public health achievements of the 20th century , but it The initial health-based regulation to reduce lead content in gasoline was promulgated by the U.S. Environmental Protection Agency (EPA) in 1973 . This waWe, the authors, had the opportunity and privilege to play major roles in developing the rationale for and drafting the initial federal health-based regulation to remove lead from gasoline. This took place while we were both employed by the U.S. EPA during 1971\u20131975.In the early 1970s, 200,000 tons of lead was emitted from automobiles in the United States each year, mostly in urban areas. Lead was added to gasoline to reduce engine knock in high-compression engines, which otherwise would have required higher-octane gasoline. The oil and lead industries, including manufacturers of gasoline lead additives, had successfully thwarted government efforts to limit lead in gasoline for 50 years .The oil and lead industries used various strategies to forestall regulation of lead in gasoline. For example, when workers involved in the initial manufacture of gasoline lead additives suffered severe lead poisoning and even deaths, the lead industry blamed the victims for failing to follow good work practices. Another strategy employed by the lead industry was to use their public relations capabilities to advertise the benefits of their products to the general public while casting doubt on the possibility of harm associated with use of these products . This waAs a result, the lead industry was in a position to impede the free flow of scientific information related to the hazards of lead in gasoline, including restrictions on the ability to publish this information without prior approval . ConsequSilent Spring  for all new automobiles with catalytic converters . Second,In the early 1970s, we experienced considerable resistance to removal of lead from gasoline, not only by industry but also by government and public health scientists. Many scientists asserted that lead in gasoline caused no health effects and referred to a large number of studies supporting that position. Concerns were also raised about the adverse impact the regulation would have on companies that manufactured lead additives and on the oil company refineries. It was further postulated that removing lead would cause gas prices to skyrocket.These concerns were being voiced against the backdrop of the 1973 gasoline shortage caused by the Arab oil embargo. Cars lined up for blocks waiting to gas up, and in some parts of the country one could only go to the gas station on an even- or an odd-numbered day. The argument was made that the lead regulations would exacerbate the oil shortage by requiring more oil to replace the octane lost by removing lead. With the gas shortage dominating the news, we were informed by certain senior executives that removal of lead from gasoline was politically impossible. Consequently, it was argued, if eliminating lead emissions was necessary, this could be achieved by retrofitting lead traps on automobiles. This alternative turned out not to be feasible for legal and technical reasons .Resistance to removal of lead from gasoline also resulted in a series of efforts to discredit or influence us. In one instance, industry representatives held meetings with the U.S. EPA administrator in an attempt to discredit Bridbord. Another time, Bridbord was required to provide 2 days of sworn testimony as part of a civil action brought by the major manufacturer of gasoline lead additives against the U.S. EPA in Richmond, Virginia. This discovery deposition was designed to uncover information to be used by the lead industry in future legal action against the agency and to call into question the qualifications of Bridbord. In another incident early in 1972, a lobbyist for a major manufacturer of lead additives offered Hanson employment at a considerable increase in salary. In an effort to convince the U.S. EPA not to issue the health-based regulation, the industry even sent a delegation to try to convince the U.S. EPA administrator that the lead regulation was not necessary because they alleged lead was an essential mineral required for optimum growth and development.Our youth was also used against us. Our inexperience was cited as a reason for rejecting the lead regulatory proposals at public hearings, during congressional testimonies, and then again during subsequent legal challenges. At one congressional hearing, Hanson was specifically requested by a Texas congressman to state his age for the record.Finally, even more attention was focused on this issue because this was the first major regulation that the newly formed U.S. EPA moved forward on a nationwide basis.The U.S. EPA originally proposed a health-based regulation for lead in gasoline on 23 February 1972 . Hanson This proposed regulation for lead in gasoline was based upon the document \u201cHealth Hazards of Lead\u201d principally authored by Carl Shy, a senior physician scientist at the U.S. EPA in North Carolina , 1972b. 3, which were common in many urban areas, were a contributing factor in the number of persons with blood leads exceeding 40 \u03bcg/dL. Automobile exhausts were the predominant contributor to these elevated air lead levels in urban areas. As a result, U.S. EPA proposed a regulation to keep air lead below this level by limiting lead in gasoline  filed a motion in the U.S. Court of Appeals for the U.S. EPA to make a decision on the health-based regulation. As a result, the U.S. Court of Appeals on 28 October 1973 ordered the U.S. EPA to make a determination within 30 days whether to regulate lead in gasoline for health reasons NRDC v.. We bothAs a result, the U.S. EPA promulgated the initial health-based regulation on 6 December 1973, concluding that automobile lead emissions endanger public health  based upIn the 1950s and 1960s, the clinical presentation of lead poisoning in children was associated primarily with lead paint exposure, and major efforts were being made to address the lead paint exposure problem during the 1960s and 1970s. Lead poisoning in children was characterized by overt signs and symptoms, including acute and chronic encephalopathy, peripheral neuropathy, nephropathy, anemia, abdominal pain, and X-ray evidence of lead-containing paint chips in the abdomen. These conditions were associated with blood lead levels in the 60\u201380 \u03bcg/dL range or higher. At higher blood lead levels, severe mental retardation and even death were known to occur. Although there was concern that less severe but still significant effects were occurring at lower blood lead levels, the evidence for lower level effects at that time was not well established. Consequently, there was skepticism in the public health community about efforts to limit lead exposure from gasoline when the problem appeared to be primarily exposure to lead paint in deteriorating housing. There was, in fact, considerable concern that efforts to address lead in gasoline would draw attention and resources away from efforts to address the lead paint problem.In the early 1970s, the prevailing belief continued to be that the major concern with lead was exposure of children to lead-based paint. During this period, however, there was also increasing evidence of a more generalized contamination of the environment caused by lead emissions from motor vehicles. This was characterized not only by ambient air lead levels but also by high levels of lead in dirt and dust measured in the thousands of parts per million levels. Although the most severe cases of lead overexposure were found among children living in housing with deteriorating lead paint, there also was a more widespread blood lead elevation in the general population, particularly in children living close to heavily trafficked urban roads but not necessarily living in deteriorating housing . This re3. This was because the existing air lead\u2013blood lead correlation studies did not control for the multiple sources of lead exposure in the general population and did not account for lead in dirt and dust, which was an important source of exposure for children. In modifying its position, the U.S. EPA considered airborne lead to be an important contributor to lead body burden in both children and adults, and especially in children, through ingestion of dirt and dust contaminated by lead from motor vehicle exhausts.The U.S. EPA decided not to link the final regulation to the originally proposed air lead level of 2 \u03bcg/m3 in 1978 and later revised this standard to 0.15 \u03bcg/m3 in 2008  for what was anticipated to be an independent scientific assessment of airborne lead . HoweverOne of the scientists who first called attention to the risks posed by lead in gasoline was Clair Patterson, a highly respected geochemist at the California Institute of Technology. Patterson was among the most prominent scientists to raise concern about the need to reduce lead emissions from gasoline. Research conducted by Patterson documented the great buildup of lead in the environment and in people because of industrial activity in general, and combustion of gasoline containing lead additives in particular . The U.SStudies by Philip Landrigan and colleagues at the CDC were particularly informative to U.S. EPA in documenting the hazards from exposure to elevated levels of lead in dirt around stationary lead sources, in particular, the El Paso lead smelter . This stSubsequent studies by Herbert Needleman and colleagues documented the adverse consequences of low-level lead exposure in children on intelligence and behavior . FurtherFederal Register and widely circulated in the scientific community requesting responses to seven questions , part of the Department of Health, Education, and Welfare (DHEW). As a result of this reorganization, many U.S. PHS staff retired before or shortly after being transferred to the U.S. EPA, leaving a vacuum at the U.S. EPA that was filled by younger people such as ourselves. This created jealousies and unhappiness among remaining U.S. PHS and U.S. EPA staff. This was one of the reasons that DHEW, the department that traditionally addressed air pollution, was so actively opposed to a health-based regulation.In addition, DHEW initially questioned whether the U.S. EPA even had the authority to regulate lead in gasoline. The fact that DHEW had to share health protection responsibilities with the U.S. EPA may be one of the reasons for the consistently strong negative views on this regulation taken by officials in the Office of the Assistant Secretary for Health. On one occasion, we met with the assistant secretary for health, who was skeptical about the need for this regulation. U.S. EPA administrator William Ruckelshaus sent DHEW secretary Elliot Richardson a letter requesting comments on the above-mentioned seven questions. The responses were not very supportive. In a communication to Senator John Tunney, Richardson was especially critical of the U.S. EPA taking action to remove lead from gasoline based upon health considerations, stating that \u201cthere is no firm evidence at this time that lead derived from combusted gasoline is harmful to the health of the general public\u201d . HoweverRuckelshaus and Richardson, based upon advice from their respective staff, had differing views about the need for a health-based standard. Richardson and Ruckelshaus subsequently became the U.S. Attorney General and U.S. Deputy Attorney General, respectively, who were later fired by President Nixon for failing to dismiss the Watergate prosecutor. They obviously had great respect for each other even though they had different perspectives with regard to lead in gasoline.Industrial opponents to removal of lead from gasoline were very adept at taking advantage of the differing views related to the health impact of lead in gasoline and cultivating support from scientists most concerned with the problem of lead in paint. This was also one of the reasons why leadership at DHEW disagreed with and actively opposed the health rationale used by the U.S. EPA to remove lead from gasoline. DHEW and other federal agencies, such as the Department of Transportation and Department of Commerce, vigorously opposed a health-based regulation at the level of the Office of Management and Budget (OMB).An important person at OMB who, after considering all of the evidence, agreed with the U.S. EPA position was John Sawhill, deputy director of the OMB. If it were not for Sawhill\u2019s support, the U.S. EPA health-based regulation for lead in gasoline would have stalled and might never have been promulgated. Sawhill was able to support the U.S. EPA position because of the very thorough research and analyses that had been completed by U.S. EPA staff addressing the criticisms and questions raised about the proposed regulations. This information enabled us to answer and rebut all questions and charges lodged by representatives of the other federal agencies that were against the regulation. Sawhill later became director of the Nature Conservancy.Environmental Health Perspectives . A subsequent appeal heard en banc  on 30 May 1975 resulted in a decision to affirm the regulation on 19 March 1976 (Ethyl Corp. v. U.S. EPA 1976). The Supreme Court ultimately did not agree to hear an appeal of this decision, in effect upholding the determination of the lower court, allowing the lead phase-down regulation to take effect in 1976.After promulgation of the 1973 U.S. EPA health-based lead in gasoline regulation, there were a number of legal challenges, which included attacks on the authors\u2019 background and qualifications. The initial challenge by the lead industry, heard by three justices in the U.S. Court of Appeals on 9 September 1974, resulted in this regulation being set aside on 28 January 1975  from the period 1976\u20131980 to the period 1999\u20132002 . EvidencThe regulation that we both worked on represented the first successful effort by the federal government to regulate lead in gasoline since questions were raised about this 50 years earlier . RemovalAs blood lead levels in children have decreased, the blood lead level of concern for children has also decreased from 40 \u03bcg/dL in the early 1970s to the current level of 10 \u03bcg/dL. It would not have been possible to identify these lower level effects until after the gasoline lead phase-out had begun. This is because before this time, virtually all children in the U.S. had blood levels exceeding the 10-\u03bcg/dL level. With continuing research, questions have been raised regarding whether blood leads even at or below 10 \u03bcg/dL are harmful to children .The effort to remove lead from gasoline provides several additional observations. First, the ability of the U.S. EPA to take this regulatory action was greatly facilitated by research conducted by government and independent scientists not supported by industry. This illustrates the crucial importance of independent peer-reviewed research to better understand the health consequences of lead exposure in the population. This support was primarily provided by the NIEHS, NICHD, and CDC.New England Journal of Medicine that the medical and public health communities more fully appreciated the hazards posed by lead, including airborne and dust-fall lead in general and lead in gasoline in particular (Second, it takes a long time before new information affects medical and public health practice. It was not until the results of this research began to appear in high-impact scientific journals such as the rticular , 1990.Third is the importance of basing regulatory decisions on a broad foundation of scientific studies so that legal challenges are not easily able to attack the credibility of a single or a limited number of studies or individuals. This was a consideration in the U.S. EPA not tying the final health-based regulation to a specific air lead level, which would have required relying on the Goldsmith-Hexter regression equation, an approach that had been criticized both during the first public hearing and by independent scientists in response to the seven questions outlined in Fourth, development of a health-based standard to remove lead from gasoline would not have been possible without the support of the U.S. EPA leadership. This support was essential in providing us the time and opportunity to build the strongest case for the removal of lead from gasoline to protect public health under the Clean Air Act authority. Leadership support was provided by the U.S. EPA administrators, acting administrators, and deputy administrators William Ruckelshaus, Russell Train, Robert Fri, and John Quarles, along with assistant administrators Robert Sansom and Stanley Greenfield. Other U.S. EPA health officials who provided invaluable support in developing the health justification for this action were Vaun Newill, Robert Horton, John Buckley, Carl Shy, and John \u201cJack\u201d Finklea.Fifth, in the early 1970s, scientists at U.S. EPA were free to examine and evaluate the growing body of scientific evidence as the basis for the initial health-based regulation. At no time was there ever internal U.S. EPA political pressure to change scientific interpretations or conclusions. The initial U.S. EPA health-based regulation to remove lead from gasoline is clearly an example where science successfully affected public policy. The leadership of the U.S. EPA at that time deserves much credit for establishing an atmosphere in which this was possible.Sixth is the critical role played by non-governmental organizations, such as the NRDC, in influencing regulatory policies. David Schoenbrod from the NRDC deserves major credit for the role that the NRDC played in legally challenging the U.S. EPA to take regulatory action to remove lead from gasoline.Seventh, we were given the opportunity to succeed because we were expected to fail. One of the reasons we did not receive more opposition from skeptics within the U.S. EPA was that very few people there believed we could succeed, so they just left us alone. One high-placed U.S. EPA official openly stated that with the lines at the gas pumps and the strong industry opposition, we did not have a chance and that we were merely sacrificial lambs. This was further supported by the fact that Hanson was sent to OMB alone to defend the second proposed lead regulation in front of representatives of the various federal agencies in much higher positions than Hanson. He later learned that he was sent alone, as a relatively low-level agency representative, because many expected this effort to fail.Finally, in retrospect, our youth and inexperience also helped us to succeed. We were too young to know that regulating lead in gasoline was impossible. Our youthful dedication, hard work, and competent analyses overcame obstacles that were much more formidable than we recognized. The two authors of this paper were recognized for their contributions to the lead regulation at an unusually young age as recipients of Silver Medals for Superior Service by the U.S. EPA, the second highest award given by the agency.We both consider ourselves privileged to have had the opportunity to contribute to this action, which has had such a beneficial impact in the United States as well as in many other countries.It is beyond the scope of this article to recognize all of the other persons who over the years have made important contributions to reduction of lead exposure, not only from gasoline but also from other sources, particularly lead in paint and food. A more comprehensive account of the contributions of these individuals can be found in Members of the task force who contributed to the third U.S. EPA health document, in addition to John Buckley and Kenneth Bridbord, included Douglas Hammer, Robert Horton, Marty Kanarek, Wellington Moore, Magnus Piscator, Lawrence Plumlee, Steven Reznek, Richard Rhoden, and Jerry Stara .Members of the committee who contributed to the 1975 DHEW report on lead exposure from automobile emissions in addition to Hans Falk included Terri Damstra, Kathryn Mahaffey, Warren Piver, and Herbert Posner .New England Journal of Medicine by Jane The initial lead in gasoline phase-down and subsequent U.S. EPA regulations would not have been possible without significant support from the scientific community. Based upon the personal knowledge of the authors, these individuals include, but are not limited to, scientists such as Herbert Needleman, Sergio Piomelli, and Ellen Silbergeld, as well as health officials at other federal and state agencies, such as Philip Landrigan, Vernon Houk, Edward Baker, and Henry Falk at CDC; Jane Lin-Fu at DHEW; John Goldsmith from the California State Health Department; and David Rall, Director of NIEHS. The three papers published in the Regulations once promulgated must be upheld and enforced to do their job. Joel Schwartz, who followed us at the U.S. EPA, deserves major credit for his role in preventing the regulation that we worked on from being undone during the antiregulatory era of the 1980s and for conducting the analyses that ultimately formed the basis for total elimination of lead in gasoline in the United States. These analyses included the data in Subsequent to our own involvement, both Joel Schwartz and Ellen Silbergeld were recipients of MacArthur Awards for their important work on lead . HerbertOne person who is widely recognized for her contributions in reducing dietary lead exposure is Kathryn Mahaffey while at the U.S. Food and Drug Administration . Kathryn"}
+{"text": "But a surprising number of children still have blood lead levels that may place them at risk for a variety of cognitive, emotional, and behavioral problems. The good news is that boosting current efforts to protect U.S. children from one major source of lead\u2014the house paint used prior to a 1978 ban, which still appears in many homes\u2014may pay for itself many times over According to National Health and Nutritional Examination Survey data from 2003 to 2006, an estimated 25% of the 28 million U.S. children aged 6 years and younger have blood lead levels between 2 and 10 \u03bcg/dL, a range in which persistent cognitive damage is known to occur. Another 200,000 children are estimated to have levels over 10 \u03bcg/dL.Using data from published studies, the author performed a cost\u2013benefit analysis of the effects of controlling children\u2019s exposure to lead paint. She calculated that controlling lead paint in the approximately 1 million worst-case housing units would cost between $1.2 billion and $11 billion, depending on many factors including local costs of lead abatement. But the benefits to be derived from controlling lead hazards could range from $181 billion to $269 billion. For example, abatement could save $11\u201353 billion in immediate medical treatment and $30\u2013146 million in special education costs. Reducing the incidence of attention deficit/hyperactivity disorder (ADHD) related to lead paint exposure might save $267 million; and because both ADHD and lead exposure have been associated with criminal behavior, crime-related costs could shrink by $1.7 billion with efforts to eliminate and contain lead-laden paint.The author concludes that every dollar spent to limit U.S. children\u2019s exposure to lead paint\u2014such as through paint stripping, replacement, and covering with a special encapsulant coating\u2014could net $17\u2013221. By comparison, vaccination against the most common childhood diseases is estimated to save $5.30\u201316.50 for every dollar spent on immunizations.The author noted that the cost savings from better lead mitigation could be even higher than estimated in the current study. For one thing, the calculations of potential benefit pertain only to children under age 6. Yet getting rid of lead paint would benefit other segments of the population as well. Also, the analysis excluded many potential costs of lead exposure, including future health care expenses and the indirect costs of criminal activity.U.S. public health and housing policies have been slow to address the lingering problems related to lead paint, the author asserts. Given the huge projected savings and income in terms of health care, crime prevention, education, lifetime earnings, and tax revenues, she writes, the time for proactive and universal lead control has never been better."}
+{"text": "It\u2019s no wonder, then, that lead levels generally peak at age 2 years, which is when health officials recommend children be tested for elevated blood lead. But new research shows that 5- to 6-year-olds may be particularly vulnerable to the cognitive and behavioral effects of lead and should be tested as well if such problems are apparent Previous studies have suggested that IQ scores at ages 5\u20137 years are more strongly associated with concurrent blood lead concentrations than with concentrations measured at age 2. However, children\u2019s blood lead concentrations during infancy are strongly associated with concentrations at older ages\u2014meaning, for instance, a highly exposed toddler still tends to be highly exposed at age 6. This \u201cserial correlation\u201d makes it difficult to determine whether lead has a cumulative effect or whether effects of lead differ according to age.In the current study, researchers analyzed blood lead concentration data for 462 children who participated in either the Cincinnati Lead Study, which enrolled children from 1979 to 1984, or the Rochester Longitudinal Study, which enrolled children from 1994 to 1995. In both studies the children\u2019s blood lead was measured every year from infancy to age 6. The children also took IQ tests around age 6.To study effects of lead at different ages while accounting for correlations in lead levels over time, the researchers estimated effects of the ratio of the child\u2019s blood lead at age 2 relative to his or her blood lead at each subsequent age (3\u20136 years). As the ratio of age 6:age 2 blood lead increased, IQs declined even after controlling for average lead exposure at all ages as well as a range of other covariates. In addition, children who had relatively higher lead exposure at age 5 or 6 compared with age 2 had significantly higher arrest rates for criminal behavior in adulthood than other children.The results suggest that blood lead testing and efforts to reduce exposure should continue as children reach school age. Moreover, lead testing of school-age children with cognitive or behavioral problems may help identify underlying causes of difficulties teachers or parents are seeing."}
+{"text": "Environ Health Perspect 118:259\u2013264 (2010)].Scinicariello et al. have reported two text errors in their article \u201cModification by ALAD of the Association between Blood Lead and Blood Pressure in the U.S. Population: Results from the Third National Health and Nutrition Examination Survey\u201d [First, in the third paragraph of their article (p. 259), the sentence summarizing results of a study of Korean lead smelter workers should have been as follows:n = 798; mean BLL = 32.0 \u03bcg/dL) found that the ALAD polymorphism did not change the association between blood lead and hypertension at occupational exposure levels compared with ALAD1 homozygous carriers .A study conducted among Korean lead smelter workers  was incorrect. The corrected sentence is as follows:ALAD, BLL, and BP\u2014one conducted among occupationally exposed workers  and the other conducted at lower lead exposure level \u2014found no association of ALAD polymorphism and BP outcomes.Two previous studies on The authors apologize for the errors."}
+{"text": "Prior studies revealed associations of environmental lead exposure with risks of hypertension and elevated blood pressure.We examined the effect of blood lead levels on blood pressure and the incidence of pregnancy-induced hypertension (PIH) in the second and third trimesters of pregnancy.One thousand seventeen pregnant women were enrolled in two French municipalities between 2003 and 2005 for the EDEN  cohort study. Blood lead concentrations were measured by atomic absorption spectrometry in mothers between 24 and 28 weeks of gestation.p = 0.02). Adjustment for potential confounder effects slightly attenuated but did not eliminate the significant association between blood lead levels and the risk of PIH . We also observed geographic differences in lead exposure and in the incidence of PIH and found significant correlations between blood lead levels and unadjusted as well as adjusted systolic and diastolic blood pressures after 24 weeks of gestation.PIH was diagnosed in 106 subjects (10.9%). Age, parity, weight gain, alcohol, smoking habits, and calcium supplementation were comparable between hypertensive and nonhypertensive women. Lead levels were significantly higher in PIH cases  than in normotensive patients (1.9 \u00b1 1.2 \u03bcg/dL; These findings confirm the relationship between blood lead levels at mid-pregnancy and blood pressure and suggest that environmental lead exposure may play an etiologic role in PIH. Lead is one of the most extensively studied reproductive toxicants. Several epidemiologic studies have demonstrated a positive association between blood lead levels and blood pressure among nonpregnant adults . The eviPIH is characterized by an increase in systolic blood pressure (SBP \u2265 140 mmHg) and/or diastolic blood pressure (DBP \u2265 90 mmHg) after 20 weeks of gestation. This disorder can be complicated by proteinuria, a condition corresponding to preeclampsia. PIH is encountered in 10% of pregnancies and is an important cause of morbidity for both mother and fetus .Environmental factors may have a role in this disease occurrence. Although some studies failed to find a relationship between lead concentrations in cord blood and preeclampsia , severalBlood lead levels increase during pregnancy, from 24 weeks of gestation until delivery, because of increased gastrointestinal absorption and because of an increase in bone turnover in this period . SeveralIn the present study, we examined the relationship between PIH and circulating blood lead, cadmium, manganese, and selenium concentrations in a nonselected population of pregnant women.\u2032 Enfant) mother\u2013child cohort study counting 2,002 participants . The number of subjects needed for the study was based on a 10% prevalence of PIH and an estimated relative risk of PIH occurrence of 2. No other factors influenced the inclusion process.The study population included the first 1,017 pregnant women enrolled in the EDEN  and Nancy (eastern France) were enrolled if they were able to read and write French and were not planning to move out of the region. We also excluded women who had multiple gestations or a history of diabetes. Among women who fulfilled these criteria, 55% agreed to participate. The study was approved by the Ethic Committee of Bic\u00eatre Hospital (November 2002). All partici pants provided informed consent consistent with policies of the INSERM institutional review board. We collected maternal blood samples between 24 and 28 weeks of gestation, just after the recruitment was validated by the study midwife. We determined blood lead, cadmium, and manganese concentrations by electrothermal atomic-absorption spectrometry  with Zeeman background correction as previously described . We measGestational age was based on last menstrual period and/or ultrasound-based estimated date of conception. We divided pregnancy into three periods: P1, before 24 weeks; P2, between 24 and 36 weeks; and P3, after 36 weeks of gestation. This choice was mainly founded on scientific data regarding the incidence of PIH in the second half of pregnancy and its frequency with increasing gestational age .We measured maternal blood pressure during routine monthly visits, with the subject in supine position, using a standard mercury sphygmomanometer.One set of measures was taken by the study midwife between 24 and 28 weeks using a different (semiautomated) device, with two measurements averaged to determine the values for that visit.Measurements taken within each period of gestation  were averaged to determine the values for SBP and DBP assigned to each period.Women were classified as having PIH based on SBP \u2265 140 mmHg and/or DBP \u2265 90 mmHg measured during at least two visits after the 22nd week of gestation, such that the elevated measures could have occurred during or across any of the three periods, at any point after 22 weeks. Consequently, no diagnosis of PIH was made before 24 weeks.We gathered medical and reproductive histories, clinical follow-up, and delivery data from obstetric records. Additional risk factors for PIH were obtained using the study questionnaires presented by trained interviewers to subjects during a structured interview. These included basic socioeconomic information, educational level, and cigarette and alcohol use before and during pregnancy. Dietary information on consumption of coffee and tea and intake of calcium, vitamins, or iron supplements was also recorded.We evaluated socioeconomic status by the household monthly income and categorized it into three levels . We also divided education status into two levels . For the analysis of main effects, all variables (except for hematocrit) were categorized.Statistical data analysis was performed using SAS software, version 9.1.3 . We evaluated variables for normality and for outliers. Because of skewed distributions, lead, cadmium, manganese, and selenium blood levels were transformed into their decimal logarithms and subsequent geometric means were calculated.t-tests as appropriate. Cochran-Armitage was used for trend analysis.Continuous variables were summarized by calculating the mean \u00b1 SD. Comparisons of means or proportions were performed by chi-square or Student p-value < 0.05 was considered to indicate statistical significance.We obtained adjusted odds ratios (ORs) by means of multivariable logistic regression analysis with PIH as the dependent variable. We based selection criteria for variables on the literature regarding risk factors of PIH. Besides all elements measured, adjustment variables included maternal age, parity, hematocrit, body mass index (BMI), pregnancy weight gain, gestational diabetes, educational level, socioeconomic status, geographic residence (maternity ward), and smoking status and alcohol consumption before and during pregnancy. Although we used stepwise procedure to ascertain percentage of variance attributable to selected variables, relevant risk factors were forced into the final model. We tested interaction terms between blood lead levels (as a continuous variable) and other maternal variables with a significance level reduced to 0.005 (according to the Bonferroni method). Otherwise, Pearson partial correlations were calculated between blood lead levels and SBP and DBP during the three periods of pregnancy.Among the 1,017 women in the study population, we excluded 31 records (3.0%) because of insufficient sample volumes or analytical problems in metal measurements, and 15 records (1.5%) because of chronic hypertension under treatment before pregnancy. This left a study group of 971 pregnant women. Mothers\u2019 mean age was 29.3 \u00b1 4.9 years. PIH occurred in 106 (10.9%) women and was complicated by proteinuria (preeclampsia) in 20 (2.1%) cases.p < 0.001) and a higher hematocrit level . They presented more frequently with gestational diabetes  and premature delivery . The incidence of PIH was significantly higher in Nancy than in Poitiers . PIH was also negatively associated with birth weight. There were very few missing covariate data (< 3.8% in the PIH group and < 5.2% among women without PIH for most of the variables studied).In p = 0.02). Mean manganese concentration was slightly higher in PIH women but did not reach significance. Cadmium and selenium blood concentrations were comparable between groups  was significantly higher than that of normotensive women . The unadjusted OR of PIH associated with an increase of 1 \u03bcg/dL in maternal blood lead levels was 3.5 .The frequency of PIH was lowest among women whose blood lead concentrations were in the lowest quartile (7.7%) and was significantly greater in the second (10.7%), third (11.1%), and fourth exposure quartiles  slightly attenuated but did not eliminate the significant association between blood lead levels and the risk of PIH . Adjusten = 20) attenuated the association between blood lead levels and PIH .Furthermore, excluding women with preeclampsia (p = 0.003). Adjusted OR for PIH was increased to 4.6  in multiparous compared with 2.9  in nulliparous women. There was no interaction between parity and blood lead (p = 0.46).When stratified by parity , blood lr = 0.08; p = 0.03) and DBP  after 24 weeks of gestation (P2), and this correlation remained significant after 36 weeks (P3). Log-transformed blood lead at mid-pregnancy was significantly correlated with both SBP  may be related to the magnitude of lead exposure because we discovered a weaker association between blood lead and PIH when excluding women with preeclampsia. This finding further supports the likelihood of a dose\u2013response relation between blood lead and hypertension.Our analysis of correlations of SBP at P2/P3 and DBP at P2/P3 with blood lead concentrations was consistent with that of previous studies on essential hypertension . Recent Manganese blood level was not significantly associated with PIH in this study, although there was some evidence of a possible weak association. The underlying mechanisms of manganese-induced hypertension are probably independent from gestational age. The decrease in blood manganese with intrauterine growth restriction might obscure any other pathologic effect . CadmiumHematocrit levels are usually elevated in pregnancy hypertensive disorders . This maBMI was strongly associated with PIH. This finding is consistent with that of previous reports . A dose\u2013Age and parity were not significant covariates in this study. Although a trend of increasing blood pressure with age is usually reported for DBP, the restricted age range (18\u201345 years) and the limited number of women > 40 years of age in the present study may have reduced our ability to highlight an age effect on PIH.As to parity, high levels of blood lead observed in multiparous women of this study may have contributed to an increase in the frequency of PIH in this group, thus reducing the difference usually observed in the incidence of PIH and preeclampsia depending on parity. Moreover, data obtained from systematic ambulatory monitoring in a large sample of normotensive pregnant women indicate the lack of differences in blood pressure according to parity .p < 0.001). Thus, a major difference in the incidence of PIH between these two regions might have been their history of environmental exposure to chemical pollutants. Blood lead level primarily reflects recent exposure, although a part of lead in blood may originate from lead stored in bone, particularly during pregnancy  revealed higher blood lead levels in Nancy (2.0 \u00b1 1.3 \u03bcg/dL) than in Poitiers (1.8 \u00b1 1.1 \u03bcg/dL; regnancy . Becauseregnancy .The main sources of measurement errors of blood pressure are the inaccuracy of meas urement methods and the intraindividual variability of blood pressure. We attempted to minimize these effects by averaging all blood pressure measurements available in the obstetric files.Although the association between blood lead levels and PIH persisted in the multivariate analysis, it is also possible that it reflects residual confounding due to unmeasured confounders. Geographic residence is a general covariate, and residual confounding by this variable cannot be ruled out. However, if this residual confounding explained the association found in the multivariate analysis, it is likely that an interaction between geographic residence and blood lead levels would have been observed. Moreover, blood lead concentration may be a better estimate of maternal environmental exposure than external indicators, and its use as a continuous variable in the regression model limits the risk of residual confounding.PIH remains a multifactor disease with unclear etiology, which could compromise maternal reproductive and newborn outcomes. We identified a significant association between maternal blood lead levels in mid-pregnancy and blood pressure. Our findings suggest that lead may have an etiologic role in PIH, even at low levels of environmental exposure, and thus incite public health organizations to revise the upper limit of \u201cacceptable\u201d blood lead levels in pregnant women, which is currently at 10 \u03bcg/dL."}
+{"text": "Essential tremor (ET) is one of the most common neurologic disorders. Aside from underlying susceptibility genes, recent studies have also begun to focus on environmental toxic factors. Yet there remains a paucity of information on such factors, making studies of environmental factors important. A recent study in New York City found blood lead concentrations to be elevated in ET cases compared with matched controls. Chronic exposure to lead produces cerebellar damage, and this could predispose individuals to develop ET.The aim of this study was to determine whether the elevation in blood lead concentrations observed in a single study in New York was similarly present in ET cases sampled from a completely different geographic region.Blood lead concentrations were measured in 105 ET cases and 105 controls at Mersin University, Mersin, Turkey.p < 0.001). In an unadjusted logistic regression model, blood lead concentration was associated with diagnosis: odds ratio (OR) = 4.01; 95% confidence interval (CI), 2.53\u20136.37; p < 0.001 . This association was more robust when cases were compared with a subsample of controls who did not share the same home environment . In adjusted models, results were similar.The median blood lead concentration was 2.7 \u03bcg/dL in ET cases compared with 1.5 \u03bcg/dL in controls (These data replicate those of a previous study in New York and demonstrate an association between the environmental toxicant lead and a common neurologic disorder. Essential tremor (ET) is very common, with a prevalence of 4% in the adult population over 39 years of age and 8.7% in adults over 79 years of age . Geneticn = 105). Once selected, cases were asked to enroll in a study of \u201cenvironmental risk factors for tremor.\u201d Ninety-two (87.6%) cases agreed to be enrolled and 13 declined enrollment; 13 replacement cases were selected based on their digit code, bringing the number of cases up to 105. Most controls were the spouses of the cases [n = 69 (65.7%) of 105]. When spouses were not available (18 spouses had died and 18 either refused or could not come to the university), a relative was then selected who lived in the same district in Mersin and was closest in age to the case . Eleven (10.5%) controls declined enrollment, so additional controls had to be selected to obtain the targeted number of 105 controls. Before enrollment, the Mersin University Institutional Review Board approved all study procedures, and written informed consent was obtained at the time of enrollment. Enrollment began on 12 February 2003 and ended on 15 December 2004.In the Mersin University Hospital Movement Disorder Unit database, 250 ET cases are registered. Each case had a unique registration code and received a diagnosis of ET from their treating neurologist in that unit based on the presence of moderate amplitude action tremor of the arms or head tremor in the absence of other etiologies, such as Parkinson disease. Sample size calculations necessitated 105 cases and 105 controls. Cases who had a final registration code digit of 0, 3, 6, or 9 were first selected for enrollment, resulting in 80 potential enrollees. Then, cases with a final digit code of 2, 5, or 7 were selected, resulting in additional potential enrollees , who administered clinical questionnaires and performed a videotaped examination. Data were collected on age, sex, education, cigarette smoking (yes vs. no), cigarette pack-years, ethanol use (yes vs. no), and medication use. ET cases were asked whether they had a first-degree relative with ET. Current occupation was coded into 10 categories . Data onFor all participants, the tester videotaped a tremor examination that included one test to elicit postural tremor (sustained arm extension) and five tests to elicit kinetic tremor , 2005a. On the same day as the clinical questionnaires and videotaped examination, 10-mL blood samples were collected in lead-free stoppered pyrex tubes containing 100 units of heparin. Six milliliters of this heparinized blood was hemolysed with Triton X-100  and analyzed according to the method described by 10 blood lead and then repeated using blood lead. The results were similar. Results were presented using blood lead because nontransformed data can be expressed in units of micrograms per deciliter, which is a more easily understandable unit of measure. When examining group differences in blood lead concentration, we compared medians using a nonparametric approach (Mann-Whitney test). To assess associations between blood lead concentration and other continuous variables  we used Spearman\u2019s correlation coefficients. To evaluate differences between categorical variables, chi-square tests were used. To assess group differences in normally distributed continuous variables, we used the Student\u2019s t-test.Statistical analyses were performed using SPSS, version 13.0 . Blood lead concentrations were not normally distributed. Each analysis was first performed using logA priori, the main analysis was to test the association between blood lead concentration (independent variable) and diagnosis . We began with an unadjusted model and then individually considered variables that were suspected to confound the lead\u2013diagnosis association or were known to be associated with blood lead concentration . ET cases had a mean \u00b1 SD total tremor score of 18.0 \u00b1 6.2 and mean disease duration of 9.6 \u00b1 10.4  years; 68 (64.8%) reported having a family history of ET , 31 (29.5%) had head tremor on examination, and 56 (53.3%) were taking medication to treat tremor. Controls had a mean total tremor score of 1.0 \u00b1 2.9 and none had ET; 8 (7.6%) had a family history of ET. ET cases and control subjects were similar in terms of age and other demographic variables . Data onz = 1.52; p = 0.13). Among controls, blood lead concentration was not significantly associated with age , sex , education , cigarette smoking , cigarette pack-years , or ethanol use . The median blood lead concentration among retired controls (1.3 \u03bcg/dL) was marginally lower than that of nonretirees .Spouse controls and nonspouse controls had marginally different blood lead concentrations, with spouse controls having marginally higher blood lead concentrations than controls who did not share the same home environment with the cases , sex , cigarette smoking , cigarette pack-years , or ethanol use . Among cases, blood lead concentration was marginally associated with education . The median blood lead concentration was the same in retired and nonretired cases .Among cases, blood lead concentration was not significantly associated with age . The mean (\u00b1 SD) blood lead concentrations were 3.2 \u00b1 1.9 \u03bcg/dL (range = 0.8\u20139.4 \u03bcg/dL) for cases and 1.6 \u00b1 0.8 \u03bcg/dL (range = 0.7\u20138.0 \u03bcg/dL) for controls. The median blood lead concentration in ET cases (2.7 \u03bcg/dL) was higher than that of spouse controls  and non-spouse controls  (The median blood lead concentration in ET cases was 2.7 \u03bcg/dL compared with 1.5 \u03bcg/dL in controls (Mann-Whitney < 0.001) .p < 0.001  (p < 0.001). Adding current occupation (retired vs. nonretired) to the model did not change the results. This association was more robust when ET cases were compared with nonspouse controls  than with spouse controls .In an unadjusted logistic regression model, blood lead concentration was associated with diagnosis (control vs. ET case): odds ratio (OR) = 4.01; 95% confidence interval (CI), 2.53\u20136.37; s of ET) . In a ses of ET) . In a mor = 0.48; p < 0.001) in the entire sample. This correlation was likely a reflection of the difference between cases and controls because it was not present in analyses restricted to ET cases . The correlation between blood lead concentration and tremor duration in ET cases was not significant , especially after adjusting for age . ET cases were stratified based on whether each case currently took medication for ET, had a family history of ET, or had head tremor, but there were no differences with respect to median blood lead concentrations.We found a correlation between tremor severity  and blood lead concentration ; in these analyses, each 1-\u03bcg/dL increase in blood lead concentration was associated with an 8-fold increased odds of having ET.The present results are similar to those of the New York study , 2005a ip = 0.008) in individuals with both a \u03b4-amino-levulinic acid dehydratase-2 allele and an elevated blood lead concentration.Blood lead concentrations in ET cases were higher than those observed in both types of controls. These data suggest that the increased blood lead concentration in these ET cases is robust. It is not clear whether the difference between cases and controls is due to increased environmental exposure or genetic differences in lead metabolism. Previous work in New York suggests that lead metabolism may be altered in ET cases compared with control subjects; in that study , the oddAlthough the blood lead concentration differed between ET cases and controls, as in the previous study in New York , 2005a, Humans may be exposed both to inorganic and organic forms of lead from a variety of occupational and nonoccupational sources . In humaThe present analyses were cross-sectional. The data do not directly address the issue of whether higher blood lead concentrations preceded or followed the diagnosis of ET. Prospective studies are needed to assess causality by assessing whether a higher pre-disease blood lead concentration is associated with an increased risk of developing incident ET. One possibility is that higher blood lead concentrations result in ET, with a possible mechanism being lead-induced cerebellar damage. Another possibility is the converse, namely, that having ET results in higher blood lead concentrations, although the potential mechanisms for such a relationship are not readily apparent. A final possibility is that some common underlying factor  leads both to ET and to elevated blood lead concentrations.Our study had additional limitations. First, our occupational assessment was limited to current occupation rather than lifetime occupation. However, in the previous report , which uIn summary, data in the present study replicate those of a previous study conducted in New York , 2005a a"}
+{"text": "Between November 2007 and March 2008, 18 children died from a rapidly progressive central nervous system disease of unexplained origin in a community involved in the recycling of used lead-acid batteries (ULAB) in the suburbs of Dakar, Senegal. We investigated the cause of these deaths.Because autopsies were not possible, the investigation centered on clinical and laboratory assessments performed on 32 siblings of deceased children and 23 mothers and on 18 children and 8 adults living in the same area, complemented by environmental health investigations.All 81 individuals investigated were poisoned with lead, some of them severely. The blood lead level of the 50 children tested ranged from 39.8 to 613.9 \u03bcg/dL with a mean of 129.5 \u03bcg/dL. Seventeen children showed severe neurologic features of toxicity. Homes and soil in surrounding areas were heavily contaminated with lead  as a result of informal ULAB recycling.Our investigations revealed a mass lead intoxication that occurred through inhalation and ingestion of soil and dust heavily contaminated with lead as a result of informal and unsafe ULAB recycling. Circumstantial evidence suggested that most or all of the 18 deaths were due to encephalopathy resulting from severe lead intoxication. Findings also suggest that most habitants of the contaminated area, estimated at 950, are also likely to be poisoned. This highlights the severe health risks posed by informal ULAB recycling, in particular in developing countries, and emphasizes the need to strengthen national and international efforts to address this global public health problem. Lead is a toxic metal whose widespread use has caused extensive environmental contamination and health problems in many parts of the world. Lead exposure accounts for \u201calmost 1% of the global burden of disease, with the highest burden in developing regions\u201d . MeasureBetween November 2007 and March 2008, a cluster of 18 deaths caused by a severe and rapidly progressive central nervous system disease of unexplained origin was identified in young children living in the NGagne Diaw neighborhood of Thiaroye sur Mer, in the suburbs of Dakar, Senegal. Local health authorities conducted initial investigations to identify the cause of the outbreak. Differential diagnoses included cholera, meningitis, and cerebral malaria, as these conditions are prevalent at that time of the year; however, investigations disproved these diagnoses. Lead intoxication was then considered because the mothers of some of the children were engaged in the recycling of used lead-acid batteries (ULAB) and the recovery of lead particles from contaminated sand taken from the battery breaking areas. Initial investigations conducted by the Dakar Poisons Centre detected very high blood lead levels in 71 siblings and mothers of the deceased children. Concerned about these findings, the Senegalese Ministry of Health requested the assistance of the World Health Organization (WHO) in investigating and responding to this incident. In this article we describe this investigation.Because autopsies and postmortem testing on the 18 deceased children were not possible for sociocultural reasons, the investigation centered first on the examination of siblings of the deceased children, and their mothers. In a second step, another group of children and adults, living in the same community but unrelated to the deceased children, were also investigated to evaluate the extent of lead intoxication in the area. Environmental health investigations were conducted in parallel to assess environmental contamination and exposure pathways.All siblings of the 18 deceased children and all of the siblings\u2019 mothers (exact number unknown) were invited by the local health authorities to participate in the study. A total of 32 siblings and 23 siblings\u2019 mothers agreed to participate. A second group of 18 children and 8 adults was selected with the assistance of local community leaders using the following selection criteria: They were not related to the deceased children, they were living in the NGagne Diaw neighborhood, and their age and sex had to be equally distributed. It was not possible to match study groups. All study participants or their representatives gave written consent to participate in the study. The study was approved by the Senegalese national ethics committee.We considered all 18 children from the NGagne Diaw neighborhood who died from a rapidly progressive central nervous system disease of unexplained origin between November 2007 and March 2008 to be possible victims of lead intoxication.For the purpose of this study, we defined \u201cchildren\u201d as \u2264 19 years of age, which corresponds to the WHO definition of \u201cchild\u201d and \u201cadolescent.\u201dThe following data were recorded for all 81 individuals investigated: name, age, sex, clinical and neurologic evaluation, medical and occupational histories, global positioning system (GPS) coordinates of their place of residence, and results of laboratory analysis.We collected epidemiologic and medical information on the 18 children who died between November 2007 and March 2008 from local medical staff or mothers. Data included name, age, sex, name of mother, date and place of death, signs and symptoms, course of illness, and GPS  coordinates of the place of residence.All 81 individuals selected were given a clinical neurologic examination, and their medical and occupational histories were taken. Clinical examinations included a physical examination; measure ment of height, weight, systolic blood pressure, and pulse rate; and abdominal examination. Neurologic investigations included assessment of mental status, motor and sensory systems, and tendon reflexes.We collected two venous blood samples for each individual. Particular care was taken to prevent external contamination of specimens, including through the meticulous cleaning of venipuncture site. One sample was collected in an EDTA tube for lead analysis. Another sample was collected in a dry tube and analyzed for full blood count, serum iron, creatinine, and transaminases. Lead was analyzed by graphite furnace atomic absorption spectrometry using a PerkinElmer AA600 spectrometer  by the centralized certified Pasteur Cerba laboratory . Depending on the lead concentration, blood samples were diluted 5, 10, or 20 times with a diluent and matrix modifier. Other biochemical analyses were performed by the BIO-24 laboratory . The full blood count was conducted with a Sysmex XT 2000i/1800i analyzer . Serum iron, creatinine, and transaminases were measured with a Cobas Integra 6000 analyzer  using colorimetry, enzymatic colorimetry, and kinetic ultraviolet methods, respectively.We interviewed local residents, authorities, and medical personnel to gain a better understanding of the context in which the cluster of deaths occurred and the way ULAB recycling practices were conducted before the deaths. Questionnaire-supported interviews of the parents or relatives of 4 deceased children and 10 children with confirmed high blood lead levels were conducted to assess exposure pathways to lead, both during the period when deaths occurred and at the time of our investigation.in situ without sample preparation with a portable X-ray fluorescence analyzer InnovX Alpha  using soil mode. This allows the determination of lead concentration over a surface area of approximately 1 cm2 to a depth of approximately 5 mm, which corresponds to the surface soil most accessible to humans. A total of 194 outdoor and 40 indoor concentrations were measured. Lead concentrations of outdoor soil, consisting principally of sand, were measured systematically every 30\u201350 m along the streets and communal areas throughout the area where the 18 deaths occurred, and every 50\u2013100 m outside of this area. Additional measurements were conducted in areas of particular interest, such as sites where intensive recycling had taken place and areas where children were seen playing with the sandy soil. Indoor concentrations were measured in various locations inside four houses, including on the floor, on furniture, and on bed sheets and mattresses. All GPS coordinates were recorded.We measured environmental lead concentrations Epidemiologic, clinical, and laboratory data are presented in The 81 individuals  examined as part of the outbreak investigation, comprising 32 siblings of the deceased children, 23 mothers of the siblings (polygamy accounts for the fact that the number of mothers of siblings is greater than that of deceased children), and another 18 children and 8 adults, were all living in the area where the 18 children died. In total there were 50 children 3 months to 19 years of age, and 31 adults 20\u201364 years of age.The 18 children  who died between November 2007 and March 2008 were between 1 and 6 years of age, lived in the NGagne Diaw neighborhood of Thiaroye sur Mer, and suffered from a rapidly progressive central nervous system disease of unexplained origin. Among the 50 children we investigated, we found a high incidence of gastrointestinal (42%) and neuropsychiatric (34%) disorders. The most frequent neuro-psychiatric disorders were irritability, anxiety, sleep disturbance, and frequent crying, reported in 14% of children. Behavioral and sociability disorders were reported in 12% of the children, predominantly in those under 5 years of age. These disorders included aggression, anxiety in playing with other children, and clinginess to the mother. Older children complained of headache. Almost one-third (32%) of children suffered from anorexia or, in the case of small children, difficulty eating. Three children  refused all food and would only breast-feed. Other gastrointestinal symptoms included colic (18%) and vomiting (10%). We found a history of hospitalization for one or more episodes of convulsions of unexplained cause between September 2007 and June 2008 in 24% of the children overall and in 34% of those who were siblings of the deceased children. The majority of episodes of convulsions  occurred between December 2007 and March 2008, during the same period when the deaths were observed.Of the 31 adults examined, the most frequently reported symptoms were gastrointestinal upset (19%), including epigastric pain and colic, and neuro psychiatric disorders (10%) such as irritability, anxiety, and headache.Limited clinical information was available on the 18 children who died before an epidemic was suspected. Information provided by local doctors, parents, or relatives indicated that the children had developed acute gastrointestinal illness, including vomiting, bloody diarrhea, and colic, which progressed within hours to days to irritability, convulsions, reduced level of consciousness, coma, and death.On physical examination, 6 (12%) of the 50 investigated children showed apathy, somnolence, or lethargy. Nine (18%) had a positive Babinski sign, reduced rotular reflexes, and altered muscle tone (hyper-tonia or hypotonia). Among the 28 children < 5 years of age, 6 (21%) showed either delayed psychomotor development or regression. Four children showed a significant degree of regression, with loss of sphincter control, loss of ability to walk, and loss of acquired speech. Many children showed low weight and height for their age, but no physical signs of malnutrition were observed. All children had normal blood pressure. No gum or dental abnormalities attributable to lead exposure were observed.The only abnormalities found on physical examination of the adults were a positive Babinski sign and absent rotular reflexes in 3 of the 23 siblings\u2019 mothers.Most (80%) of the 50 children investigated were anemic, and half of those had microcytic anemia characterized by alterations of the hemoglobin, hematocrit, and globular volume. Iron deficiency was observed in only 7 children (14%). Of the adults, 13% had anemia, with 10% having microcytic anemia. Anemia was associated with iron deficiency in all adults.Most (58%) of the children showed a slight to moderate elevation of hepatic enzymes [AST (aspartate amino-transferase) and ALT ]. Three children showed a slight increase in creatinine concentration, indicating that kidney function might have been slightly affected. Five adults had a slight to moderate elevation of hepatic enzymes (AST and ALT), only one woman (42 years of age) had an increased creatinine concentration.In children, the mean (\u00b1 SD) blood lead concentration was 138.0 \u00b1 60.4 \u03bcg/dL  for the 32 siblings of deceased children and 114.3 \u00b1 132.5 \u03bcg/dL  for the 18 children who were unrelated to the deceased children. In adults, the mean (\u00b1 SD) blood lead concentration was 55.3 \u00b1 19.8 \u03bcg/dL  for the mothers of the 23 siblings, and 55.9 \u00b1 17.8 \u03bcg/dL  for the 8 adults who were not related to the deceased children. The blood lead levels measured in all investigated children were mapped, together with additional environmental data and geographic distribution of the deceased children, and are shown in 2 (visible in http://dx.doi.org/)]. Lead particulate soil was then packed into bags ] and sold to a local scrap dealer. A large number of people gradually became involved in this lucrative activity. Toward the end of 2007, the usual buyer stopped coming to NGagne Diaw neighborhood. However, the battery breaking and lead extraction activities did not stop, and the population started to store contaminated soil inside their homes, sometimes even under their beds. Lead recuperation from ULAB and soil in Thiaroye sur Mer is reported to have stopped in March 2008 after a public awareness campaign about the hazards of lead. By that time, however, the contaminated sandy soil had been extensively dispersed throughout the neighborhood, including inside a large number of homes. In March 2008, the Senegalese authorities undertook partial decontamination activities by removing 300 tons of lead-contaminated soil and sacks of lead ingots from the ULAB breaking area and from people\u2019s homes and by covering part of the area with clean sand.Informal lead recycling from ULAB has taken place in NGagne Diaw since 1995, concentrated in an open, sandy area of about 40,000 min situ in June 2008 in 56 indoor locations revealed lead concentrations up to 14,000 mg/kg inside houses, in particular on floors and mattresses. Measurements performed in another 194 outdoor locations throughout the NGagne Diaw neighborhood revealed soil lead concentrations up to 209,000 mg/kg in the large open, sandy area where ULAB recycling activities had taken place since 1995. Concentrations up to 182,000 mg/kg were measured in residential areas, even in some areas that had been covered with clean sand in March 2008. Bags of soil containing up to 302,000 mg/kg were found throughout the community . The soil lead concentrations were significantly lower outside the areas where soil sieving and lead extraction activities had taken place, indicating that the lead contamination was geographically limited.Measurements performed The main lead exposure pathway was most likely through inhalation and/or ingestion of the heavily contaminated sandy soil and dust in suspension. This occurred during the period that recycling was being carried out and continued after recycling was stopped because of the high level of residual contamination. Young children were particularly exposed by ingestion through hand-to-mouth behavior and some pica while playing outdoors on contaminated soil or with the lead-rich soil stored inside their homes. This was corroborated during the field investigations when numerous children were observed playing with and ingesting the contaminated sandy soil, indicating that exposure was still ongoing at the time of our investigation .Lead is a cumulative toxicant that affects multiple body systems, including the neurologic, hematologic, gastrointestinal, cardiovascular, and renal systems. The toxic effects of lead range from abdominal pain, loss of appetite, vomiting, and anemia to irritability, ataxia, stupor, coma, seizures, and death. Children are particularly vulnerable to the neurotoxic effects of lead because a greater proportion of systemically circulating lead enters their brains, and the developing nervous system is more susceptible to the toxic effects of lead than the mature brain. In addition, children are more likely to be exposed to environmental sources because of their hand-to-mouth behavior and the higher absorption of ingested lead in the gastrointestinal tract (up to 50%) compared with adults (20\u201330%) . ChildreOur clinical and laboratory investigations revealed that all 81 individuals studied were poisoned, often severely, with lead. This group included persons who had no direct link with the deceased children and individuals who were never involved in lead recycling or sieving activities. Of the 50 children investigated, 17 showed signs and symptoms of severe chronic lead poisoning, in particular neurologic, developmental, and behavioral disorders. Four children < 5 years of age showed severe regression of psychomotor development. Almost all of the children (94%) had blood lead levels > 45 \u03bcg/dL, requiring chelation therapy to limit short- and long-term neurodevelopmental and health consequences. Moreover, 41 children (82%) had life-threatening blood lead levels > 70 \u03bcg/dL, therefore requiring urgent medical treatment. The highest blood level, which was measured by a centralized certified laboratory, was 613.9 \u03bcg/dL in a 20-month-old boy. To the best of our knowledge, this is the highest blood lead level ever recorded in a living child of this age. Remarkably, this child did not show overt signs of encephalopathy, although he was underweight, apathetic, anorexic, and anemic, and at the time of our investigation would only take breast milk. Although this child\u2019s mother was not herself involved in lead recycling, sieving of soil was performed outside her house, and lead-enriched soil was stored in her home by other residents. These results suggest that other habitants of the affected area\u2014estimated at 950, including about 460 children < 19 years of age\u2014are also likely to be poisoned with lead. Among these persons, young children and those yet to be born are of particular concern because of their special vulnerability.Lead concentrations as high as 302,000 mg/kg were measured in outdoor soil, whereas concentrations up to 14,000 mg/kg (on a mattress) were detected indoors. These values exceed guidelines from France and the United States for residential areas set at 400 mg/kg by several orders of magnitude . These rOur environmental health investigations suggested that the individuals studied had been exposed through inhalation and/or ingestion of the heavily contaminated sandy soil or the dust in suspension. Exposure occurred during the period when recycling was being carried out and continued after recycling was stopped because of the high level of residual contamination. This is supported by the geographic overlap between the areas of high environmental lead contamination and the locations of the homes of the deceased children and of those with high blood lead levels . The extThe severity of this incident, in terms of environmental contamination and consequent intoxication of a community, is unusual and arose from the particular way in which the informal recycling was carried out in NGagne Diaw. This involved not only the breaking up and melting of metallic lead from ULAB but also the transport, sieving, and storage of lead particles, which were released into the sandy soil during battery recycling. This particular type of activity, which amounted to the recycling of third-hand lead waste, has rarely been observed, even in the developing world.We were not able to include a control group in the investigation because of the high degree of local sensitivity about the incident. In addition, the investigation was carried out in the context of an emergency response and focused on an initial assessment with a view to identifying the immediate management needs and making recommendations for further action. However, background levels of blood lead among Senegalese children were estimated in 2006 by The diagnosis of the 18 children who died between October 2007 and March 2008 could not be confirmed because medical documentation of the cases was limited; blood samples were not collected for lead analysis; and post mortem investigations could not be conducted for sociocultural reasons. It is notable, however, that 11 of the 32 siblings investigated were hospitalized for convulsions during that time period. In June 2008 the mean blood lead level of the 32 siblings was 138.0 \u03bcg/dL. Circumstantial evidence, including the high blood lead levels in siblings and heavy environmental contamination, together with the verbal descriptions of the course of illness provided by family members and physicians, suggests that most, if not all, of the 18 cases of fatal neurologic illness reported between October 2007 and March 2008 were due to encephalopathy resulting from severe lead intoxication .in situ X-ray fluorescence methodology used allowed the real-time estimation of lead contamination throughout the contaminated area. Although this method is subject to some inaccuracy arising from various factors such as soil hetero genicity, lack of sample preparation, and instrument imprecision, this is acceptable in view of the extremely high levels measured and the purpose of these measurements  of worldwide lead consumption and generates large quantities of lead waste in virtually every country , 2009b. Lead intoxication is a preventable environmental illness, and efforts must be taken at all levels to protect populations. Relevant national interventions include the implementation and enforcement of regulations, legislation, and international guidelines and conventions governing the use and recycling of lead and lead-based products; public education about the health hazards of lead; and promotion of environmentally sound ULAB recycling . At the"}
+{"text": "This cross-sectional study investigated the relationship between the aminolevulinate dehydrogenase (ALAD) genotype and blood lead levels among 101 Japanese workers. Blood lead concentration measurement, biomarkers, and genotyping were performed. The minor allele frequency (MAF) for ALAD (ALAD2) was 0.08. Although the blood lead level in the subjects with heterozygous GC genotype was significantly higher than those with homozygous GG genotype, there were no significant differences for hemoglobin, hematocrit, serum and urinary ALA levels among genotypes. ALAD2 genotype was significantly associated with the blood lead concentration, even in the environmental lead exposed subjects. Further confirmation with a large sample size is needed. Lead toEstimation of the health risks associated with low-level exposures to lead has important implications with respect to its regulation. Health-based guidelines limiting occupational and environmental exposures to lead have become more stringent and are now thought to protect most of population against major adverse health effects. Recently the United States Centers for Disease Control and Prevention also recommended the reduction of lead concentrations <10 \u03bcg/dL to prevent lead toxicity for children under 6 years old . HoweverPolymorphisms of the ALAD gene have been associated with the accumulation of lead in the blood, bone, and internal organs , and migThe objective of this study examined the relationship between ALAD1, ALAD2 genotypes and blood lead level among workers who were not occupationally exposed to lead.2.2.1.2 (mean \u00b1 SD), respectively.We explained this study to Japanese healthy workers from a Japanese chemical industry company located in Kanagawa prefecture, and received a written informed consent from each participant. A total of 101 healthy workers  were subjected to medical examination and genotyping. Among these, 41 men were engaged in logistics and the rest of them were engaged in office work. The mean age, and body mass index (BMI) were 43.4\u00b111.9 years and 23.4\u00b14.13 kg/m2.2.2).Age and smoking status were self-reported. The medical and occupational histories were established by interview. Height, weight, systolic and diastolic blood pressures were measured by trained staff nurses. BMI was calculated as weight by height square , aspartate aminotransferase (AST), alanine aminotransferase (ALT), gamma-glutamyl transpeptidase (\u03b3-GTP), blood urea nitrogen (BUN), serum creatinine (Cr), serum uric acid (UA), blood lead concentration, and biomarkers for lead exposure .Blood lead concentration was measured by flameless atomic absorption spectrophotometry (Hitachi Z-9000) with Zeeman effect background correction. To determine delta-aminolevulinic acid levels (sALA in serum and uALA in urine) and Zinc protoporphyrin (Znpp) in blood, we used a type L-6200 HPLC . Using this apparatus, stopped-flow HPLC was applied to determine these parameters using a reverse phase column after a simple pretreatment. The highest fluorescent intensity was obtained when the pretreated sample was doubly diluted with 100 mM sodium acetate (pH 5.0), and the sample (60 \u03bcL) was introduced into the condensing coil at a temperature of 98 \u00b0C, then 50% acetylacetone in 25% ethanol was added, followed by secondary mixing with 10% formaldehyde solution. The detection limit was 2 \u03bcg/L, which was 2.5 times higher than that achievable by conventional method. Relative standard deviations of 10 blood samples calculated from 4 determinations per sample for 1 week were within 5%. Haemoglobin was determined by the cyanomethaemoglobin method.2.3.The peripheral blood from all participants were drawn, and genotyping for the ALAD polymorphism  was performed by polymerase chain reaction (PCR) and the single nucleotide primer extension (SNuPe) methods. The blood was pretreated with Ampdirect , which could eliminate the DNA extraction process and amplify the genomic DNA directly from the whole blood. PCR primers 5\u2019 - GGCCTCAGTCTTCCCTCCTA -3\u2019 (sense) and 5\u2019 -ACCTCTCCACCTCCCGAGTA -3\u2019 (antisense) as well as two versions of SNuPe primers (5\u2019 - CCACACAGGTATGGTGTGAA -3\u2019 and 5\u2019 -CCACACAGGTACGGTGTGAA -3\u2019) were designed with DNASIS Pro Ver.2.0 , since there is another SNP site 9-bp upstream of the ALAD1-2 polymorphism. Then, mixed SNuPe primer (5\u2019 -CCACACAGGTAYGGTGTGAA -3\u2019) was made. The PCR reactions began with preheating at 80 \u00b0C for 15 minutes, followed by denaturing at 94 \u00b0C for 4.5 minutes and 40 cycles of denaturing at 94 \u00b0C for 30 seconds, annealing at 60 \u00b0C for 1 minute, extension at 72 \u00b0C for 1 minute, with a final extension at 72 \u00b0C for 7 minutes. We then carried out the SNuPe method. The reactions included 25 cycles of denaturing at 94 \u00b0C for 10 seconds, annealing at 53 \u00b0C for 5 seconds, and extension at 60 \u00b0C for 10 seconds. We analyzed the products by using ABI 7700 (Amersham Biosciences Corp.). As for genotyping accuracy, we compared the genotyping results by SNuPe method as well as conventional RFLP, and the agreement rate was 100% except one, which was not determined due to the lack of residual sample.2.4.2 test. The mean value of biomarkers for lead exposure between two genotypes of ALAD gene was compared by using Student\u2019s t-test. All P value \u22640.05 was considered as statistical significant.All values were shown by mean and Standard deviation (SD) except the value mentioned with the Geometric mean (GSD). We compared the mean value of all basic characteristic, clinical, biochemical variables including blood lead level between GG and GC genotypes by Student's t-test or \u03c73.et al. [Our study showed that the mean white blood cell count in GC genotype was significantly higher than that in GG genotype , but Shaet al.  found noet al. [et al. [The recent study found that the frequency of GG genotype of ALAD was 83.2 %, and that of GC genotype of ALAD was 16.8 % in this non-occupationally lead exposed Japanese population. There was no CC homozygous genotype in this Japanese general population. The frequency distribution of genotype was in Hardy\u2013Weinberg equilibrium. The International HapMap Project, and Kelada et al.  also rep [et al.  that rep [et al. ,21. This [et al. .4.This is the first descriptive report of the association between ALAD2 genotype and blood lead levels among non-occupationally lead exposed Japanese subjects, although there were some limitations such as lack of data for alcohol consumption and ALAD activity level. The present findings as well as lead toxicity complications will be examined in further longitudinal studies."}
+{"text": "Background: Early menopause has been associated with many adverse health outcomes, including increased risk of cardiovascular disease morbidity and mortality. Lead has been found to be adversely associated with female reproductive function, but whether exposures experienced by the general population are associated with altered age at menopause has not been explored.Objective: Our goal was to assess the association between cumulative lead exposure and age at natural menopause.Methods: Self-reported menopausal status and bone lead concentration measured with K-shell X-ray fluorescence\u2014a biomarker of cumulative lead exposure\u2014were obtained from 434 women participants in the Nurses\u2019 Health Study.p-trend = 0.006). Although the number of cases was small (n = 23), the odds ratio for early menopause (< 45 years of age) was 5.30  for women in the highest tertile of tibia lead compared with those in the lowest tertile (p-trend = 0.006). There was no association between patella or blood lead and age at menopause.Results: The mean (\u00b1 SD) age at natural menopause was 50.8 \u00b1 3.6 years. Higher tibia lead level was associated with younger age at menopause. In adjusted analyses, the average age of menopause for women in the highest tertile of tibia lead was 1.21 years younger  than for women in the lowest tertile (Conclusions: Our results support an association between low-level cumulative lead exposure and an earlier age at menopause. These data suggest that low-level lead exposure may contribute to menopause-related health outcomes in older women through effects on age at menopause.http://dx.doi.org/10.1289/ehp.1206399Citation: Eum KD, Weisskopf MG, Nie LH, Hu H, Korrick SA. 2014. Cumulative lead exposure and age at menopause in the Nurses\u2019 Health Study Cohort. Environ Health Perspect 122:229\u2013234;\u2002 Early menopause has been associated with several adverse health outcomes including loss of bone mineral density  and cardin vitro and human epidemiological studies. Although experimental studies have usually used high exposures and/or exposure routes not reflective of human ones, they have found lead-associated disruption of gonadal function and reproductive hormone production with prenatal as well as later life exposures .Study population. The NHS is an ongoing prospective cohort study initiated in 1976 when 121,700 female registered nurses, 30 to 55 years of age and living in 11 U.S. states, completed a questionnaire on their medical history and health-related behaviors  were invited to participate as controls from 1990 through 1994, and women who first reported a diagnosis of hypertension between 1990 and 1994 were invited to participate as cases. Controls were frequency matched to cases by 5-year age groups. In total, between 1993 and 1995, 301 NHS participants (101 hypertension cases and 200 controls) agreed to participate and underwent study evaluation, including measurement of their lead levels.The NHS participants in our analyses consisted of a subgroup living in the greater Boston area and assessed in two sequential studies of lead exposure and chronic disease risk in women. In both studies, lead in blood as well as in tibia and patella bone was measured. The first NHS subgroup consisted of 301 women participating in a nested case\u2013control study of lead exposure and hypertension . For thaThe women in the second Boston-area NHS subgroup were originally recruited for a cohort study of lead exposure and bone density . SimilarWe used lead exposure measures, questionnaire, and health information collected in these two Boston area substudies and in the biennial main NHS questionnaires for the current analysis.Age at menopause. Menopausal status was determined on the first NHS questionnaire in 1976 and then again on each biennial questionnaire by asking whether the participants\u2019 menstrual periods had ceased permanently and, if so, at what age and for what reason . Of the 621 women with lead measurements, 610 had data on age at menopause. Of those women, 449 reported natural menopause, 154 surgical menopause, and seven were missing data on menopause type. Among the 449 with natural menopause, we excluded 15 with missing covariate data, leaving 434 for the current analysis. Thirty-three women reported menopause having occurred between 1957 and 1976, before the first NHS questionnaire. The remaining 401 women underwent menopause between 1976 and 2003. We defined early menopause as natural menopause occurring before 45 years of age  of the Brigham and Women\u2019s Hospital for measurement of lead content in their bone by K-shell X-ray fluorescence (KXRF), a noninvasive technique for measuring skeletal lead content that can measure very low lead concentrations . A technical description and validity specifications of this instrument have been published elsewhere . In 1999Whole blood samples were collected in trace-metal-free tubes (with EDTA), and lead levels were analyzed using graphite furnace atomic absorption with Zeeman background-correction . After every 20 samples, the instrument was calibrated with National Institute of Standards and Technology (NIST) Standard Reference Material (SRM) 955a, lead in blood . To test internal reliability, 10% of samples were run in duplicate; at least 10% of the samples were controls and 10% were blanks. To test external validity, reference samples from the U.S. Centers for Disease Control and Prevention  were measured. Coefficients of variation ranged from 8% for lead concentrations of 10\u201330 \u03bcg/dL to 1% for higher concentrations. The limit of detection (LOD) was 1 \u03bcg/dL; values below the LOD were assigned a value of 0.71 \u03bcg/dL (1 \u03bcg/dL divided by the square root of 2).Statistical analysis. We used ordinary least-squares linear regression to analyze age at menopause as a continuous dependent variable. We used logistic regression to estimate odds ratios (ORs) and 95% CIs for early menopause. We conducted analyses for blood, patella and tibia bone lead biomarkers (separately) categorized into tertiles for models for age at menopause as a continuous variable and early menopause. For trend analyses, we fit models using a single continuous lead biomarker term created by assigning to each woman the median value of her lead biomarker tertile, which reduces the influence of extreme values. In addition, we also report results of trend analyses based on categorizing lead in quintiles. Analyses were adjusted for age at menarche (years), year of birth, substudy group, age at bone lead measurement (years), age at bone lead measurement squared, months of oral contraceptive use, parity , and pack-years of smoking assessed at the time of menopause. In sensitivity analyses, we further adjusted for alcohol consumption  and BMI  at the time of menopause because these are not consistently associated with menopause. Because age at menopause may affect the use of postmenopausal hormone replacement therapy (HRT), we did not adjust for HRT in our primary analyses. However, we did secondary sensitivity analyses adjusted for HRT use . In addition, to limit the possibility that lead released from bone after menopause affected bone lead concentrations differentially with respect to age at menopause, we performed a sensitivity analysis restricted to women whose bone lead was measured > 5 years after menopause. The 5-year cut point was chosen to approximate the time when the most rapid menopausal bone loss has ended (as ended . Only 28The mean (\u00b1 SD) age at bone lead measurement was 61.1 \u00b1 5.9 years (59.4 \u00b1 7.1 years in the hypertension substudy and 62.4 \u00b1 4.3 years in the bone density substudy). The mean age at menopause was 50.8 \u00b1 3.6 years. Of the 434 women in our analyses, 28 were premenopausal at bone lead measurement, with a mean of 3.5 \u00b1 1.7 years between their bone lead measurement and menopause. The remaining women were postmenopausal at bone lead measurement, with a mean time between menopause and subsequent lead measurement of 11.3 \u00b1 6.3 years. Overall the median concentrations of tibia, patella, and blood lead were 10 \u03bcg/g , 12 \u03bcg/g , and 3 \u03bcg/dL , respectively. The distributions of bone lead concentrations by participant characteristics are shown in p-trend = 0.006). An IQR (11 \u03bcg/g) increase in tibia lead concentration was associated with an age 0.89 year younger  at menopause. The analysis of trend using quintiles of tibia lead was also significant (p = 0.05). A smooth plot of the adjusted association between tibia lead and age at menopause suggested that the inverse association flattens out somewhat at higher tibia levels  had an OR of 5.30  compared with women in the lowest tertile (n = 3 cases). The analysis of trend using quintiles of tibia lead was also significant (p = 0.02). For an IQR (11 \u03bcg/g) increase in tibia lead concentration, the OR for early menopause was 3.68 . As with analyses of continuous age at menopause, no association was seen for early menopause with blood or patella lead (When age at menopause was dichotomized as early (< 45 years of age) or not, higher tibia lead was associated with early menopause . Women illa lead .n = 401). The association between tibia lead and age at menopause also was similar to the main analysis when we restricted the model to women whose bone lead was measured > 5 years after menopause . However, we did not perform this sensitivity analysis for early menopause because of insufficient numbers of cases. The null association of patella lead with menopause was unchanged when restricted to women who were > 5 years after menopause at their bone lead measurement. No sensitivity analyses were performed for the remaining null findings using blood and patella lead measures.Associations between tibia lead and age at menopause  and early menopause  were similar to those for the main analysis when we additionally adjusted for BMI and alcohol consumption, or for hormone replacement therapy, or when we restricted the analyses to women who were premenopausal in 1976  comparable to measures in older adult women from the general U.S. population .Nonsurgical menopause is triggered by the decline in the number and function of ovarian follicles during the programmed process of ovarian follicle atresia . From atin vitro studies suggest that lead may affect the female reproductive system in several ways that could contribute to earlier menopause [in vitro study of human ovarian granulosa cells collected from women undergoing in vitro fertilization, cells grown on media that contained lead acetate accumulated lead, which was accompanied by lower levels of p450 aromatase messenger RNA, cytochrome p450 aromatase, and estrogen receptor \u03b2 proteins than untreated cells , lead levels were associated with altered serum follicle-stimulating hormone (FSH) concentrations among premenopausal women ; howeverp = 0.001) younger than among a group of 99 community controls with no known occupational lead exposures. However, the company\u2019s preferential hiring of women for smelter jobs who were unable to have children creates a selection bias\u2014one that likely explains the early age at natural menopause, 43.7 years on average among the lead workers\u2014that limits the validity of these results. Exposures in the second study, a cross-sectional analysis of NHANES data, are applicable to the general population, but the directionality of the observed association of higher blood lead (2\u201322 \u03bcg/dL) with increased odds of natural menopause among 45- to 55-year-old women is uncertain . Because our bone lead measures were made over a relatively short time interval, women with an earlier age at menopause had more years since menopause at the time of their bone lead measurements than women with later menopause. Although the effect of menopause on bone lead concentration has not been examined empirically, if menopause-related bone loss causes relatively higher bone lead concentration with more time since menopause, this could account for our findings. However, this seems unlikely at face value, but in any case menopause-related bone loss occurs primarily in trabecular (patella) bone rather than cortical (tibia) bone . TherefoIn our study, blood and patella lead likely predominantly reflect postmenopausal lead exposure given their respective half-lives of months to years, and the fact that blood collection and bone lead measurements were done well after most study women were postmenopausal. Thus, a possible explanation for the null blood and patella results is that effects of lead on age at menopause are driven by long-term, premenopausal lead exposures that are reflected better by tibia lead because of its longer half-life (on the order of decades) .In conclusion, this study on the association between bone lead, a measure of long-term lead exposure, and age at menopause suggests that cumulative exposure to lead in a nonoccupationally exposed group is associated with an earlier age at menopause. Given the relation between earlier menopause and many subsequent health problems, these results suggest a pathway by which lead may contribute to the burden of chronic disease in older women. The success in reducing external lead exposures in the United States may mean that women entering menopause today are at less risk of lead-associated earlier age at menopause than we observed, but the possibility remains that further reductions in lead levels could still improve the health of women as they age.(94 KB) PDFClick here for additional data file."}
+{"text": "Background: The role of environmental exposure to lead as a risk factor for chronic kidney disease (CKD) and its progression remains controversial, and most studies have been limited by a lack of direct glomerular filtration rate (GFR) measurement.Objective: We evaluated the association between lead exposure and GFR in children with CKD.Methods: In this cross-sectional study, we examined the association between blood lead levels (BLLs) and GFR measured by the plasma disappearance of iohexol among 391 participants in the Chronic Kidney Disease in Children (CKiD) prospective cohort study.2, respectively. The average percent change in GFR for each 1-\u00b5g/dL increase in BLL was \u20132.1 . In analyses stratified by CKD diagnosis, the association between BLL and GFR was stronger among children with glomerular disease underlying CKD; in this group, each 1-\u00b5g/dL increase in BLL was associated with a \u201312.1  percent change in GFR. In analyses stratified by anemia status, each 1-\u00b5g/dL increase in BLL among those with and without anemia was associated with a \u20130.3  and \u20134.6  percent change in GFR, respectively.Results: Median BLL and GFR were 1.2 \u00b5g/dL and 44.4 mL/min per 1.73 mConclusions: There was no significant association between BLL and directly measured GFR in this relatively large cohort of children with CKD, although associations were observed in some subgroups. Longitudinal analyses are needed to examine the temporal relationship between lead and GFR decline, and to further examine the impact of underlying cause of CKD and anemia/hemoglobin status among patients with CKD. Although lead levels have decreased in the general population over the past few decades, lead remains a widespread environmental toxicant [Centers for Disease Control and Prevention (CDC) 2009]. Lead is associated with numerous adverse health effects, including kidney disease [Agency for Toxic Substances and Disease Registry (ATSDR) 2007]. High chronic lead exposure (blood levels > 70\u201380 \u00b5g/dL) is an established cause of nephropathy in adults and children . At leadFurthermore, most studies of the association between lead and CKD evaluated glomerular filtration rate (GFR) using estimating equations based on serum creatinine or cystatin C . These eThe ongoing National Institutes of Health\u2013sponsored Chronic Kidney Disease in Children (CKiD) prospective cohort study has a primary aim of characterizing traditional and nontraditional risk factors for CKD progression . CKiD diStudy setting, design, and population. The CKiD study is a prospective cohort study to identify risk factors for CKD progression . Of 211 children completing year 4 visits, 201 had lead levels available (collected between January 2008 and December 2009).n = 456, contributing 583 lead measurements). We excluded participants who were missing data on Hispanic ethnicity (n = 7), body mass index (BMI) (n = 21), proteinuria (n = 24), income relative to the poverty level (n = 36), and hemoglobin (n = 10), leading to a final sample size of 391 participants contributing 485 lead measurements.For the present cross-sectional analysis, we included all participants with blood lead levels from years 2 and/or 4 of the study . Samples were analyzed on an Element XR inductively coupled plasma mass spectrometer  using standardized protocols including confirmation that storage materials were not contaminated with background lead. No samples were below the analytical limit of detection (< 0.1 \u00b5g/dL). Accuracy was assessed using National Institute of Standards and Technology  standard reference materials (SRMs). Analyses using SRMs reflecting blood lead levels of 1.6 \u00b5g/dL and 25.3 \u00b5g/dL had percent relative standard deviations (%RSDs) of 4.6 and 5.5, respectively. We assessed reproducibility by a) analyzing replicate samples at intervals throughout the same analytic run, b) analyzing samples in triplicate in the same run, and c) analyzing replicate samples in separate runs. Percent RSD for all reproducibility determinations was < 2.5%.GFR. GFR was measured at years 2 and 4 of the CKiD study based on plasma disappearance curves of iohexol . Iohexol (5 mL) was administered intravenously and blood samples were obtained at four time points at 10, 30, 120, and 300 min after infusion based on pilot data (lot data . Of the lot data :0.64 \u00d7 (30/blood urea nitrogen)0.202,eGFR = 40.7 \u00d7 (height/serum creatinine)with height in meters, and serum creatinine and blood urea nitrogen in milligrams per deciliter. GFR estimated by the \u201cbedside CKiD\u201d equation [eGFR = 41.3(height/serum creatinine)]  was alsoOther variables. BMI was calculated as weight in kilograms divided by height in meters squared. BMI percentiles were calculated based on the CDC\u2019s BMI-for-age sex-specific growth charts, and participants were categorized as obese if their BMI was at the 95th percentile or higher  for blood lead levels and GFR were calculated for the entire study population. p-Values were determined using the median command in Stata which performs a nonparametric K-sample test on the equality of the medians and provides a Pearson chi-square test statistic. Linear regression was used to estimate associations between blood lead levels and GFR. Non-independence between measures from the same person (n = 94 with two measurements) was accounted for using robust standard errors. As a sensitivity analysis, models were rerun using linear mixed effect models in SAS and showed similar results (data not shown). Lead exposure, the explanatory variable in the linear regression model, was modeled as an untransformed continuous variable or as a natural log (ln)\u2013transformed continuous variable. Because inferences based on ln-transformed lead were comparable (data not shown), results are reported for lead modeled as an untransformed variable for ease of interpretation. GFR was ln-transformed because it was not normally distributed. Continuous covariates  were centered at the median.z-score (continuous), and poverty (yes/no). Second, the model was further adjusted for CKD diagnosis (glomerular or nonglomerular) and urine protein to creatinine ratio (continuous). Finally, the model was further adjusted for ln-transformed blood cadmium level (continuous). The estimated percent change in GFR associated with a 1-\u00b5g/dL increase in blood lead was approximated by 100 \u00d7 \u03b2, where \u03b2 is the coefficient for blood lead from the linear regression model of ln-GFR. For ease of interpretation, the main result is also reported for GFR as an untransformed dependent variable (with units of milliliters per minute per 1.73 m2). To accomplish this, the beta and intercept from the original ln-tranformed GFR model are exponentiated, and thus the estimate corresponds to the change in GFR in milliliters per minute per 1.73 m2 for an individual who is female, white, not Hispanic, not impoverished, not diagnosed with glomerular CKD, and of median age, BMI z-score, urine protein to creatinine ratio, and ln-transformed blood cadmium level (the reference category of each variable). Hypertension (yes/no) and blood pressure variables (systolic/diastolic blood pressure z-scores/percentiles) were also evaluated as covariates but were not included in the fully adjusted final model because they did not influence the magnitude of the association between lead and GFR (data not shown) (Linear regression models were fitted with increasing degrees of adjustment. First we adjusted for age (continuous), sex, race , Hispanic ethnicity, BMI t shown) . AnalyseTo evaluate possible nonlinear associations between blood lead level and ln-GFR, a linear\u2013linear spline regression analysis in fully adjusted models was examined with the cut point (1 \u00b5g/dL) selected post hoc to maximize the differences in the slopes of the linear segments above and below the cut point.p-Values for interaction are the Wald p-values for cross-product (interaction) terms between lead and each participant characteristic. In addition, we estimated associations stratified by anemia status, with and without hemoglobin adjustment.In secondary analyses, models were stratified by the participant characteristics presented in All statistical analyses were two-sided. The threshold for statistical significance for all analyses was set to 0.05. Data analyses were performed using Stata versions 11.0 and 12.0  and SAS version 9.1  statistical software.2 , and the median GFR was 44.4  mL/min per 1.73 m2 . Blood lp = 0.29) after adjustment ; the corresponding estimate for a lead level < 1 \u00b5g/dL was 15.9 . In analyses estimating GFR by the bedside CKiD GFR estimating equation instead of using iohexol GFR, each 1-\u00b5g/dL increase in blood lead level was associated with a percent change in GFR of \u20132.5 .In linear regression analysis, each 1-\u00b5g/dL increase in blood lead level was associated with an average percent change in GFR of \u20132.1 .Analyses stratified by sex, age, race, Hispanic ethnicity, obesity, poverty, and proteinuria subgroups showed associations similar to that found in the overall study population . The assp = 0.02) and \u20130.7  in those with glomerular and nonglomerular CKD diagnoses, respectively (p for interaction by CKD diagnosis = 0.03). The geometric means for blood lead level and GFR adjusted for age, sex and race, by glomerular and nonglomerular diagnosis category, were 1.0 and 1.3 \u00b5g/dL , and 45.6 and 43.0 mL/min per 1.73 m2 (p = 0.33), respectively. The mean urine protein to creatinine ratios were 1.7 and 0.9 in children with glomerular and nonglomerular causes of CKD (p < 0.001). Final models were adjusted for proteinuria to exclude proteinuria as an explanatory factor for these findings. In addition, fully adjusted models stratified by proteinuria status showed no evidence of a difference in the association between lead and GFR based on the presence or absence of proteinuria (p = 0.53 for interaction) (data not shown). Among children with glomerular causes of CKD, 20% were hypertensive versus 13% of those with nonglomerular causes (p = 0.1). Sensitivity analyses including hypertension (n = 467) or anemia status (n = 485) in the final stratified model revealed similar results (data not shown).In analyses stratified by CKD diagnosis, each 1-\u00b5g/dL increase in blood lead level was associated with a percent change in GFR of \u201312.1 . Inclusion of ln-transformed hemoglobin in the fully adjusted model (corresponding to model 3 in p = 0.04) for every 1-\u00b5g/dL increase in blood lead level. In analyses stratified by anemia status  hemoglobin level was 12.6 g/dL (11.7\u201313.6 g/dL). The mean, 5th, and 95th percentiles for hemoglobin were 12.6, 10.2, and 15.2 g/dL, respectively. The Spearman correlation coefficient between lead and hemoglobin was 0.12 . In analyses stratified by CKD diagnosis, the association between blood lead level and GFR was stronger among children with glomerular disease underlying CKD; in this group, each 1-\u00b5g/dL increase in blood lead was associated with a \u201312.1  percent change in GFR. In analyses stratified by anemia status, the association was stronger among participants who were not anemic and not being treated for anemia; each 1-\u00b5g/dL increase in blood lead was associated with a \u20134.6  percent change in GFR.Blood lead levels in the CKiD cohort are similar to those measured around the same time period in a nationally representative sample of similarly aged children participating in the 2007\u20132008 National Health and Nutrition Examination Survey (NHANES) and thus representative of current levels of exposure from the environment . Mean bl2 found a decrease in creatinine-estimated GFR per doubling of blood lead of \u20131.0  mL/min per 1.73 m2   .2, respectively).In our study population, the negative association between blood lead and GFR was stronger in children with CKD attributed to glomerular causes. Most cross-sectional studies examining the impact of lead on the kidney have not examined a population with known CKD, so examining a differential impact by CKD diagnosis has not been possible. The few previous studies of CKD patients have adjusted estimated associations for CKD diagnosis, including a \u201cchronic glomerulonephritis\u201d category, and have not reported results of stratified analyses . GlomeruAdding hemoglobin to the fully adjusted model strengthened the negative association between blood lead levels and GFR. In analyses stratified by anemia status, the association was stronger and reached statistical significance among those participants who were not anemic. Median lead levels were similar between anemic and nonanemic participants. Median GFR was higher among those without anemia, as would be expected given the well described relationship between GFR and hemoglobin among those with CKD . Becausein vitro studies has elucidated multiple cellular and molecular mechanisms showing that lead exposure results in oxidative stress and inflammation. Chronic lead exposure results in decreased nitric oxide and impaired nitric oxide signaling, alterations in vasoactive prostaglandins, alterations in the renin\u2013angiotensin system, and alteration of multiple molecules involved in endothelial and vascular function in vitro and in vivo in rats , it not possible to know whether the level of blood lead is attributable to acute or chronic exposure, or rather is reflecting the slow elimination kinetics of lead in bone, the main reservoir of lead in the body (ATSDR 2007). Thus, a single blood lead level may not accurately portray either the duration or degree of exposure . AdditioIn contrast to most studies examining the association of lead levels with GFR, our study benefited from direct GFR measurements. Despite the limited precision and accuracy of GFR estimating equations, our study found similar results using measured GFR and the bedside CKiD GFR estimating equation which incorporates creatinine and height , supportThis study of a relatively large cohort of children with CKD and blood lead levels representative of current environmental levels of exposure did not find a significant association between lead and directly measured GFR. A negative association between lead and GFR was observed among children with CKD caused by glomerular disease, and among children who were not anemic. These findings, including the impact of anemia/hemoglobin adjustment on blood lead levels and associated outcomes, particularly in populations with CKD, deserve further investigation."}
+{"text": "It is well known that children < 7 years of age are uniquely susceptible to lead poisoning because of their constant hand-to-mouth behaviors, their immature central nervous systems, and their rapidly developing bodies , 1998. AHowever, there has also been a rapid development of automobile and information industries and an increased demand for lead-acid batteries in China during the last decade. China has also experienced a significant expansion in galena mining, lead smelting, battery production and recycling, e-waste disassembly and recycling, metal processing, production of lead-containing chemicals, cable manufacturing, and production of wire rope. In addition, there has been a substantial increase in the number of small family businesses that use lead-containing products. Although an overall decline in children\u2019s blood lead levels has been observed over in years, children\u2019s exposure to lead is still common in many Chinese cities.Industrial pollution is clearly one of the most important causes of lead poisoning among children in China. However, other significant sources of exposure may cause lead poisoning in children. For example, young children may ingest or swallow toys or other items or prescribed medicines containing lead. Some lead compounds, including lead tetraoxide (red lead), lead monoxide (yellow lead), and basic lead carbonate are used in folk remedies for convulsions and carbuncles and as astringents. Many cases of clinical lead poisoning are caused by topical or oral administration of lead-containing compounds in the treatment of vitiligo, eczema, epilepsy, diarrhea, cough, asthma, oral diseases, and intestinal parasites. In some areas of China, newborns or infants are still treated with red or yellow lead powder for skin care, either with lead powder alone or powder mixed with commercially available talcum powder. Lead poisoning in children can also be caused by using lead powder to treat mouth ulcers. Sometimes cooking wine or water stored in lead-containing pots is used to prepare food or reconstitute milk power, which can result in significant exposure to lead.At the present time, blood lead screening is the only effective way to identify lead-poisoned children. Every year, tens of thousands children are screened in China, and a considerable number of children with elevated blood lead and lead poisoning are identified. However, screening for blood lead level occurs typically in response to requests from parents and not as part of an overall examination. Thus, a large number of children may have lead poisoning that is undetected, and therefore they do not receive timely diagnosis and treatment. Unfortunately, pediatricians can misdiagnose or overlook cases of lead poisoning because they lack training in the prevention and treatment of childhood lead poisoning.At the present time, a number of policies and measures could be implemented to promote the prevention and control of childhood lead poisoning in China. Regulatory policies need to be put in place to reduce lead emissions from numerous lead-related industries. There is a need to develop new and renewable energy sources, including wind, solar, water, and nuclear power; reduce coal consumption; and attenuate air pollution from the thermo-power\u2013generation process. There is a need to improve quality control systems for blood lead screening and blood lead testing; promote nationwide implementation of unified blood lead testing techniques and methods; and increase the overall implementation of blood lead testing in primary health care settings. Every child \u2264 6 years of age should have the opportunity to receive blood lead testing. For children living in lead-contaminated areas, special screening programs should also be developed. Finally, the public and pediatricians in China need to be educated about the prevention and treatment of childhood lead poisoning.The experience of China, the United States, and other countries supports the idea that childhood lead poisoning is preventable. Although significant improvement has occurred in China over the last 20 years, many challenges remain. Coordinated and sustained efforts will be required to lessen the impact of exposure to lead on Chinese children now and in the future."}
+{"text": "Now researchers have identified a link between relatively low levels of these metals and hormone markers of delayed onset of puberty in girls A team of scientists led by researchers at the National Institute of Child Health and Human Development used blood samples collected from girls aged 6\u201311 years as part of the nationally representative Third National Health and Nutrition Examination Survey, conducted by the Centers for Disease Control and Prevention (CDC) between 1988 and 1994. The team measured concentrations of two reproductive hormones\u2014inhibin B and luteinizing hormone\u2014that serve as markers of hypothalamic, pituitary, and gonadal functioning.Associations with lead were estimated for luteinizing hormone in 671 girls and inhibin B in 655 girls. Most of the girls whose hormones were measured had blood lead levels below the CDC\u2019s 10-\u03bcg/dL action level. The median blood lead level was 2.5 \u03bcg/dL, and less than 20% of the girls had blood lead levels exceeding 5 \u03bcg/dL. The median urinary cadmium concentration was 0.12 ng/mL (the authors considered levels over 0.27 ng/mL to be high). Non-Hispanic black girls had higher age-adjusted levels of both lead and cadmium than non-Hispanic whites or Mexican Americans.The researchers found no significant associations with luteinizing hormone. However, girls aged 10 or 11 with blood lead levels of 5 \u03bcg/dL or higher were 75% less likely than girls with blood lead under 1 \u03bcg/dL to have levels of inhibin B greater than 35 pg/mL, a level typically deemed consistent with puberty by the limited research in this area. The researchers also found proportionately lower levels of inhibin B in girls who had relatively high levels of both cadmium and lead, compared with girls who had only high lead. Moreover, after adjusting for age, inhibin B levels were lowest for iron-deficient girls with blood lead levels of 1 \u03bcg/dL or higher, suggesting that lead may be particularly toxic for girls with iron deficiency.The authors conclude that lead may suppress the production of hormones associated with puberty, especially in concert with cadmium. They stress that, on a national scale, changes in the timing of onset and/or progression of puberty can have considerable public health and social implications for both boys and girls. For instance, relatively late-maturing girls are at risk for diminished bone strength and fragility fractures later in life. The hormone alterations linked to lead and cadmium exposure in the study also could have other as-yet unknown effects."}
+{"text": "EHP 120(4):601\u2013607; Dooyema et al.]. The culprit: lead in gold ore processed using artisanal techniques. Chelation therapy for hundreds of children, soil replacement, and an education campaign to discourage processing ore inside homes may now have radically reduced child mortality in the hardest-hit villages, but the long-term effect of lead poisoning on the surviving children remains to be seen.Childhood lead poisoning on a scale unheard of for decades has been detected in rural northwestern Nigeria [The outbreak surfaced in the spring of 2010 when health professionals noticed abnormally high rates of child illness and death among young children in 4 villages of Zamfara State. Blood tests on 8 children returned blood lead levels (BLLs) of 168\u2013370 mg/dL, at least 16 times the level of concern set by the U.S. Centers for Disease Control and Prevention (CDC). The Nigerian authorities quickly assembled an international team to identify the source of the exposure and to respond, focusing on the 2 worst-affected villages.Blood samples were collected from 59% of children under age 5. Of these, 97% had BLLs of at least 45 mg/dL, the threshold at which the CDC recommends chelation therapy. The BLLs of 85% surpassed the portable sampling devices\u2019 maximum detection limit of 65 mg/dL.A survey of the villagers revealed that 25% of all children under age 5 had died in the previous year, most of them in the half-year before the study. This translates to a mortality rate of 255/1,000 live births, compared with a national average of 157/1,000. The problem was the lead-contaminated gold ore being processed in many of the family compounds. Two-thirds of these families had started the activity within the last year.Soil samples were collected from nearly all the family compounds where processing occurred, with 85% showing heavy lead contamination. The worst reached 250 times the U.S. Environmental Protection Agency safety limit of 400 ppm for play areas. Similarly, water lead concentrations far exceeded U.S. recommendations.Not every child\u2019s blood could be tested, and a lack of medical data for the deceased meant their deaths could not be definitively linked to lead poisoning. Further, the locally recruited survey staff had limited training in administering questionnaires and collecting environmental samples, which may have affected the results. Nonetheless, the evidence clearly suggests these villages were hit by lead poisoning due to artisanal processing of contaminated gold ore."}
+{"text": "The angles around the Hg atom vary from 100.31\u2005(15) to 152.65\u2005(4)\u00b0. Two additional Hg\u22efO inter\u00adactions [2.739\u2005(1) and 2.905\u2005(1)\u2005\u00c5] complete the coordination sphere about the HgII atom.In the title complex, [HgBr DOI: 10.1107/S1600536812028085/gg2082Isup2.hklStructure factors: contains datablock(s) I. DOI:  crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:"}
+{"text": "Serine proteinases have been recognized as playing an important role in inflammation via proteinase activated receptors (PARs). However, little is known about the influence of serine proteinases and PARs on TNF secretion from highly purified T cells. We challenged T cells from human peripheral blood with serine proteinases and agonist peptides of PARs and measured the levels of TNF in culture supernatants by ELISA. The results showed that thrombin and trypsin, but not tryptase, stimulated approximately up to 2.5-fold increase in TNF release from T cells following 16 h incubation. Proteinase inhibitors and PAR-1 antagonist SCH 79797 almost completely abolished thrombin- and trypsin-induced TNF release from T cells. Agonist peptides of PAR-1, but not PAR-2 induced TNF release from T cells. Moreover, trypsin- and thrombin-induced upregulated expression of TNF was observed in CD4+, IL-4+, or CD25+ T cells, but not in IFN+ or IL-17+ T cells. The signaling pathways MAPK/ERK and PI3K/Akt are involved in the thrombin- and trypsin-induced TNF release from T cells. In conclusion, thrombin and trypsin can induce TNF release from IL-4+ and CD25+ T cells through activation of PAR-1 and therefore contribute to regulation of immune response and inflammation of the body.  Proteinase-activated receptors (PARs) belong to a family of G-protein-coupled receptors with seven transmembrane domains activated via proteolytic cleavage by serine proteinases . A totalPARs are expressed by various cells involved in inflammatory and immunological responses, such as vascular endothelial cells, epithelial cells, mast cells, T cells, monocyte, eosinophils, and neutrophils , 11. In TNF is a major proinflammatory cytokine that is thought to be important in the pathogenesis of asthma , food al\u223c10,000\u2009BAEE\u2009U/mg protein), soybean trypsin inhibitor (SBTI), and bovine serum albumin  were purchased from Sigma . Recombinant hirudin and human neutrophil elastase  were obtained from Calbiochem . Recombinant human Lung \u03b2 tryptase  was from Promega . SCH 79797 was from Tocris Cookson . Agonist peptides of PARs, and their reverse forms, and PAR-2 antagonist peptide FSLLRY-NH2 were synthesized in CL Bio-Scientific Inc. . The sequences of the active and reverse peptides were PAR-1, SFLLR-NH2 and RLLFS-NH2, TFLLRN-NH2 and NRLLFT-NH2; PAR-2, SLIGKV-NH2 and VKGILS-NH2 as well as trans cinnamoyl (tc)-LIGRLO-NH2 and tc-OLRGIL-NH2; PAR-3, TFRGAP-NH2 and PAGRFT-NH2. RPMI 1640 and newborn calf serum (NCS) were obtained from GIBCO . Ficoll-Paque Plus was from Amersham Biosciences . PE-conjugated mouse anti-human CD3 monoclonal antibody, PE-conjugated goat-anti rabbit IgG, and TNF OptEIA ELISA kits were purchased from BD PharMingen . TRIzol reagent and SYBR Green I Stain were purchased from Invitrogen . Cellular activation of signaling kits for extracellular signal-regulated kinase (ERK), 2-(2-diamino)-3-methoxyphenyl-4H-1-benzopyran-4-one (PD98059), Akt, PI3K, and P38 2-(4-morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002) was purchased from Cell Signaling Technology . ExScript RT reagent kit and SYBR Premix Ex Taq  were obtained from TaKaRa . Rabbit anti-human PAR-1 and rabbit anti-huamn PAR-2 polyclonal antibodies were purchased from Santa Cruz Biotechnology . FITC-conjugated mouse anti-human CD4 monoclonal, PE-conjugated mouse anti-human CD8 monoclonal, Percp-cy5.5-conjugated mouse anti-human TNF monoclonal, FITC-conjugated mouse anti-human IFN monoclonal, PE-conjugated mouse anti-human IL-4 monoclonal, APC-conjugated mouse anti-human CD25 monoclonal, and APC-conjugated mouse anti-human IL-17 monoclonal antibodies were purchased from eBioscience. Lymphocyte Isolation Kit I was from Miltenyi Biotec . All other reagents were of analytic grade and obtained from Sigma .Human thrombin, trypsin  by a MACS system with T Cell Isolation Kit I according to the manufacturer's protocol. In brief, PBMCs were isolated from fresh blood donated by healthy volunteers, 100\u2009mL from each individual per visit. The informed consent from each volunteer and agreement with the ethical committee of the First Affiliated Hospital of Nanjing Medical University were obtained. After being separated from red blood cells by Ficoll-Paque density gradient, PBMCs were collected and incubated with microbead-linked anti-CD3 monoclonal antibody for 15\u2009min at 8\u00b0C. CD3+ T cells were separated from other cells by passing through a magnetic cell separation system. For purity analysis, the cells were resuspended in PBS and incubated with PE-conjugated monoclonal antibody against human CD3 for 1\u2009h. The purity of T cells was consistently more than 95% and cell viability was more than 98%. The purified CD3+ T cells were then used for the further cell challenge tests.5cells/well in RPMI 1640 medium containing 10% NCS at 37\u00b0C for 2\u2009h with 5% CO2, respectively. The culture supernatants were then removed and cells were washed twice with fresh serum-free RPMI 1640 medium at 300\u2009g for 10\u2009min. For challenge experiments, cells were exposed to various doses of thrombin , trypsin , tryptase , and elastase  with or without their inhibitors; and to agonist peptides of PAR-1, PAR-2 and PAR-3  and their reverse peptides, respectively, for 16\u2009h before the culture, supernatants were harvested and stored at \u221240\u00b0C till use. The cell pellet was used for flow cytometry analysis.T cells were cultured in 24-well culture plates at a density of 5 \u00d7 10\u03bcL of 2 \u00d7 SYBR green Master Mix, 1\u2009\u03bcL of 10\u2009\u03bcM of primers, 1\u2009\u03bcL of the cDNA, to a total volume of 25\u2009\u03bcL. The thermal cycling conditions included an initial denaturation step at 50\u00b0C for 2\u2009min, 95\u00b0C for 10\u2009min; 40 cycles at 95\u00b0C for 15\u2009s, annealing temperatures at 60\u00b0C for 30\u2009s, and extension at 72\u00b0C for 30\u2009s.Quantitative expression of TNF mRNAs in T cells was determined by real-time PCR following the manufacture's protocol. Briefly, after synthesizing cDNA from the total RNA by using ExScriptTM RT reagent kit, real-time PCR was performed by using SYBR Premix Ex Taq on the ABI Prism 7000 Sequence Detection System . Each reaction contains 12.5\u2009\u03b2-actin were 5\u2032-CCCCAGGGACCTCTCTCTAATC-3\u2032 (forward) and 5\u2032-GGTTTGCTACAACATGGGCTACA-3\u2032 (reverse); 5\u2032-AGGGGCCGGACTCGTCATACT-3\u2032 (forward), and 5\u2032-GGCGGCAACACCATGTACCCT-3\u2032 (reverse), respectively.The sequences of PCR primers for TNF and \u03b2-actin expression. The gene specific threshold cycle (Ct) for each sample (\u0394Ct) was corrected by subtracting the Ct for the housekeeping gene \u03b2-actin. Untreated controls were chosen as the reference samples, and the \u0394Ct for all experimental samples was subtracted by the \u0394Ct for the control samples (\u0394\u0394Ct). The magnitude change of test gene mRNA was expressed as 2 \u2212 \u0394\u0394Ct. Each measurement of a sample was conducted in duplicate.Consequently, at the end of the PCR cycles, specificities of the amplification products were controlled by dissociation curve analysis. Expression of mRNA in each sample was finally determined after correction with \u03bcM of PD98059, 20\u2009\u03bcM of LY294002, or medium alone for 30\u2009min before adding thrombin 3.0\u2009\u03bcg/mL, trypsin 0.3\u2009\u03bcg/mL, or medium alone for 30\u2009min, 2\u2009h, or 6\u2009h. The cells were lysed in a buffer containing 20\u2009mM of Tris-HCl (pH 7.4), 137\u2009mM of NaCl, 10% glycerol, 1% Triton X-100, 2\u2009mM of EDTA, 25\u2009mM of \u03b2-glycerophosphate, 2\u2009mM of sodium pyrophosphate, and 0.5\u2009mM of dithiothreitol at 4\u00b0C for 30\u2009min. Cell debris was removed by centrifugation of the lysate at 12,000\u2009\u00d7g for 10\u2009min. The supernatants were mixed with equal volumes of 2x sodium dodecyl sulphate (SDS) sample buffer and heated to 100\u00b0C for 10\u2009min. An equal volume of sample was fractionated by SDS-PAGE on a 10% acrylamide gel and transferred onto polyvinylidene difluoride (PVDF) membranes with a Bio-Rad transfer system, according to the manufacturer's instructions. After blocking nonspecific binding sites with 5% BSA in TBST  for 1\u2009h, membranes were probed with phospho-ERK1/2, phospho-Akt, phospho-p38, or phospho-PI3k antibodies at 4\u00b0C overnight, followed by incubation with HRP-conjugated secondary antibodies. Immunoreactive bands were visualized by using enhanced chemiluminescence reagents according to the manufacturer's protocol. Densitometry analysis of immunoblots was carried out using Quantity One software .T cells were preincubated with 50\u2009The levels of TNF in culture supernatants were measured with OptEIA ELISA kits according to the manufacturer's instructions. The plates were read on a plate reader  with the Softmax data analysis program. The minimum detectable concentration of TNF was 2.2\u2009pg/mL.\u03bcg/mL, trypsin 0.3\u2009\u03bcg/mL, or medium alone for 16\u2009h. For PAR1 and PAR2 staining, cells were incubated with rabbit anti-human PAR1 or PAR2 antibodies at 37\u00b0C for 1\u2009h. After washing, cells were incubated with PE-conjugated goat anti-rabbit IgG antibody 37\u00b0C for 45\u2009min. After washing, cells were analyzed on a fluorescence-activated cell sorting (FACS) arial flow cytometer with CellDevia software .To test the PAR1 and 2 expressions after treatment of trypsin and thrombin, isolated T cells were pelleted by centrifugation at 450\u2009g for 10\u2009min after cells were stimulated with thrombin 3.0\u2009\u03bcL of BD Cytofix/Cytoperm solution and incubated for 20\u2009min at 4\u00b0C. Cells were then incubated with fluorescence labeled anti-human CD4, CD8, CD25, TNF, IFN, IL-4, and IL-17 monoclonal antibodies or isotope control, respectively  at 4\u00b0C for 30\u2009min. After washing, cells were analyzed on a fluorescence-activated cell sorting (FACS) Arial flow cytometer with CellDevia software .To test the secretion of TNF from subtypes of T cells, isolated T cells were pelleted by centrifugation at 450\u2009g for 10\u2009min and then fixed and permeabilized by using a cell fixation/permeabilization kit (BD Pharmingen). Briefly, thoroughly resuspended cells were added in 100\u2009t-test. P < 0.05 was taken as statistically significant. All statistics were performed with SPSS 13.0 for window .The results were shown as mean \u00b1 SEM. Differences between groups were tested for significance using the Student's \u03bcg/mL provoked TNF release from T cells following 16\u2009h incubation period in a dose-dependent manner. Approximately up to 2.5-fold increase in TNF release was observed when T cells were incubated with thrombin for 16\u2009h. At 6\u2009h following incubation, data (not shown) on both basal and induced TNF release from T cells were inconsistent. This is most likely due to the limitation of the assay sensitivity and relatively low secretion of TNF. PAR-1 agonist peptides, SFLLR-NH2 at the concentration of 100\u2009\u03bcM and TFLLRN-NH2 at the concentration of 5\u2009\u03bcM, induced a significant release of TNF at 16\u2009h following incubation. However, RLLFS-NH2, a reverse peptide of SFLLR-NH2, and NRLLFT-NH2, a reverse peptide of TFLLRN-NH2, had little effect on release of TNF from T cells . It has been shown that thrombin, trypsin, and tryptase can induce proinflammatory cytokine IL-6 release from T cells , but lit T cells .\u03bcg/mL of thrombin and 10\u2009U/mL of hirudin were added to T cells for 16\u2009h. Hirudin alone at the concentrations tested had little effect on TNF secretion from T cells. SCH 79797, a PAR-1 antagonist at the concentration of 1\u2009\u03bcM, inhibited 89% thrombin-induced TNF release from T cells . Inhibitors of trypsin, SBTI at the concentrations of 10 and 30\u2009\u03bcg/mL, eliminated 0.3\u2009\u03bcg/mL trypsin-induced TNF release by a value up to 94.8 and 94.2%, respectively. SBTI alone at the concentrations tested had little effect on TNF secretion from T cells. SCH 79797, a PAR-1 antagonist at the concentration of 1\u2009\u03bcM, inhibited 96.8% trypsin-induced TNF release from T cells .SLIGKV, an agonist peptide of PAR-2 and TFRGAP-NH\u03bcg/mL for 2 and 6\u2009h. The maximum enhanced expression of TNF mRNA was 4.2-fold over baseline control .SFLLR-NHcubation . But RLLAt the same time, neither thrombin nor trypsin showed obvious effect on the expression of PAR-1 and PAR-2 (data not shown).It is wellknown that there are numerous subtypes of T cells and each of them has distinctive functions. We, therefore, investigated subtypes of T cells by flow cytometer analysis in order to determine the subtypes that upregulate TNF in response to trypsin or thrombin. The results showed that trypsin and thrombin induced upregulated expression of TNF in CD4+ T cells, but not CD8+ T cells, following 16\u2009h incubation period. Among CD4+ T cells, trypsin and thrombin enhanced TNF expression in IL-4+ or CD25+ T cells, but not in IFN+ or IL-17+ T cells. SCH 79797 was able to inhibit enhanced TNF expression induced by trypsin and thrombin Figures .\u03bcg/mL, trypsin 0.3\u2009\u03bcg/mL, or medium alone for 16\u2009h. Following 16\u2009h incubation period, PD98059 an inhibitor of MAPK pathway, and LY294002, an inhibitor of PI3K, completely blocked thrombin- and trypsin-induced release of TNF  and trypsin-(0. 3\u2009\u03bcg/mL) induced enhanced phosphorylation of ERK1/2 in T cells following 0.5, 2, and 6\u2009h incubation periods. However, thrombin and trypsin did not significantly affect phosphorylation of P38 in T cells following 0.5, 2, and 6\u2009h incubation periods . PD98059 was able to completely block thrombin- and trypsin-induced phosphorylation of ERK1/2 when it was preincubated with T cells for 30\u2009min. PD98059 also inhibited basal phosphorylation of ERK1/2 in T cells . LY294002 was able to block thrombin- and trypsin-induced phosphorylation of Akt when it was incubated with T cells for 30\u2009min. LY294002 also diminished basal phosphorylation of Akt in T cells CD25(+) T cells were significantly high, but the percentage of FoxP3(+) cells were low in allergic rhinitis patients, and that IL-4, IL-5, and TNF levels in nasal lavage fluids were high indicates that the increased TNF release may be from CD4(+)CD25(+), nonregulatory T cells . We beliMAPK/ERK pathway is the signaling pathway that is most likely involved in the thrombin- and trypsin-induced TNF release from highly purified T cells, as PD98059, an inhibitor of MAPK/ERK pathway, almost completely blocked thrombin- and trypsin-provoked phophorylation of ERK and TNF release. While little information on signaling pathways associated with PAR-1 signaling in purified T cells is available, the previous reports that PAR-1 agonists activated MAPK/ERK and p38 MAPK signaling pathways in dermal  and card\u03b1, Fas ligand, and CD40 ligand. The family is now considered as central mediators of a broad range of biological activities in protective immune responses against a variety of infectious pathogens. On the other hand, TNF also exerts host-damaging effects in sepsis and autoimmune disease [TNF is a member of a growing family of peptide mediators comprising at least 19 cytokines, including lymphotoxin- disease , 31. TheIn conclusion, it is discovered in the present study that serine proteinases thrombin and trypsin are potent stimuli of TNF secretion from highly purified T cells. Their actions on T cells depend on their enzymatic activities and are likely through activation of PAR-1. Stimulation of TNF secretion from T cells by serine proteinases further proved that these proteinases are actively involved in the pathogenesis of inflammation and regulation of immune response in man."}
+{"text": "We have previously proposed a method for assessing the quality of individual teleconsultation cases; this paper proposes an additional step to allow the long-term monitoring of quality. The basic scenario is a teleconsultation system  where the referrer posts a question about a clinical case, the question is relayed to an appropriate expert, and the chosen expert provides an answer. The people running this system want assurances that it is stable, i.e., they want routine quality assurance information about the \u201coutput\u201d from the \u201cprocess.\u201d This requires two things. It needs a method of assessing the quality of individual patient consultations. And it needs a method for taking into account differences between patients, so that these quality assessments can be compared longitudinally. Building on the previously proposed methodology, the present paper proposes two techniques for measuring the difficulty posed by a particular teleconsultation. The first is an indirect method, similar to a willingness to pay economic estimation. The second is a direct method. Using these two methods with real data from a telemedicine network showed that the first method was feasible, but did not produce useful results in a pilot trial. The second method, while more laborious, was also feasible and did produce useful results. Thus, when output quality is measured, an allowance can be made for the characteristics of the case submitted. This means that fluctuations in output quality can be attributed to variations in the process (network) or to variations in the raw materials (queries submitted to the network). Long-term quality assurance should assist those providing telemedicine services in low-resource settings to ensure that the services are operated effectively and efficiently, despite the constraints and complexities of the environment. Telemedicine has been used for many years to support doctors working in low-resource settings. Sometimes real-time telemedicine is used, for example, video links between a doctor in the field and a specialist, but more commonly store-and-forward telemedicine is employed, because it is cheaper and easier to organize. M\u00e9decins Sans Fronti\u00e8res (MSF), a non-governmental humanitarian medical organization, has used both approaches \u20133. The sAs telemedicine matures and becomes adopted as a routine method of healthcare delivery, there is an obligation to implement quality assurance/improvement activities. All provider organizations need to demonstrate that they are providing high-quality care via validated and controlled tools.A store-and-forward telemedicine network of the type under discussion provides \u201ctele-expertise\u201d to doctors in the field. These field users can submit clinical queries to the network, and based on some internal mechanism (not relevant here), the query is sent to an appropriate expert for reply. In other words, the telemedicine network can be regarded as a \u201cblack box\u201d , which aIf a telemedicine network is viewed as a black box, then industrial methods for controlling the process become relevant. In industrial production processes, it is usually desirable to measure the quality of the output and ensure that this meets some target value. To do this, the output from a production run is sampled intermittently and judged against a suitable standard. For example, the output from a factory bottling wine might be judged by weighing the bottles to confirm that they had been filled satisfactorily. Let us suppose that the target weight for the contents of the bottles is 700\u2009g. A sample bottle can be weighed when empty and again after it has been filled, allowing the weight of the contents to be determined accurately. To carry out quality control, bottles will be sampled regularly and the content weights will be plotted on a process control chart. The filling process will be considered satisfactory if the average content weight is sufficiently close to the target and there are no indications that the average weight is drifting either up or down. Conventional process control therefore depends on a method for measuring the output achieved and a comparison with a target (the desired output).Now consider the quality of teleconsultations, selected from the \u201coutput\u201d of a telemedicine network. Again, the process operators  may wish to know that the process is stable. That is, they want confirmation that the quality of the teleconsultations is satisfactory and that the average quality is not declining. input to the process, so that observed fluctuations in output quality can be attributed to variations in the process (network) or to variations in the raw materials (queries submitted to the network).In conventional process control, the output from the telemedicine network would be measured, and compared with a predetermined target value. We have previously described a method for measuring output , but it Measuring the output. Our previous paper  vary from batch to batch, but the process operators require the product to be as consistent as possible. So in some batches, much more skill is required . In the commercial kitchen example, this might mean preparing the food at a different temperature and/or for a different time. There may be instances where such a poor batch of ingredients is supplied that the quality of the product suffers. Quality monitoring would then show that this batch was of lower quality, and would also reveal the reason why: the \u201ccase\u201d was extremely difficult because of substandard raw material. In other instances, a poor batch of ingredients might be supplied, yet the skill of the production operatives (chefs) might ensure that the output quality was normal.Thus, the problem addressed in the present work is the development of a method that can be used by the people responsible for running a telemedicine network to monitor its operation with the aim of determining whether the process is stable and whether the quality of the teleconsultations is being maintained. This requires a method for taking into account differences between cases, so that these quality assessments can be compared. As far as we are aware, there has been no previous work on this subject.(1)the description of the problem(2)the complexity of the patient(3)the availability of network resources for providing an answer(4)the availability of resources for implementing the advice .The difficulty of a submitted case will be partly dependent on the clinical complexity of the patient. . In fact, the difficulty of the case depends on four main factors:(1)the description of the problem depends on how well formulated the question is, and how much information is provided about the patient .(2)the complexity of the patient can be measured in different ways. One accepted approach is to determine the severity of the illness; the presence of multiple co-occurring medical conditions; the difficulty in determining an accurate diagnosis and/or management plan; the degree of impairment or disability that results from the medical condition; the level of need for comprehensive care management . That is(3)the availability of network resources for providing an answer depends on having suitable case-coordinators available and on the availability of whatever specialists/subspecialists are needed to provide a definitive response.(4)the availability of resources for providing treatment depends on the size of hospital , local facilities and their capacity, and the ease with which a referral could be made elsewhere for specialist treatment if required.That is, from the point of view of the telemedicine network that receives a new case, it may be difficult to provide an answer because the problem is badly described, because the patient has a very complex illness, because the network does not have the right expert available to respond, or because the case is being managed in a remote hospital where treatment options are likely to be limited. Some or all of these difficulties may be present in any given case. Furthermore, each of these factors depends on various sub-factors:The situation is summarized in Table The objective of the present work was to develop a method for determining the difficulty of a case being submitted for teleconsultation, able to take into account the differences between patients.We propose two methods for determining the difficulty of the case submitted to a teleconsultation network. The first is indirect, and the second is direct. The feasibility of each method was trialed using data from an operational telemedicine network. Ethics permission was not required, because patient consent had been obtained prior to submitting each case and the work concerned the retrospective review of anonymized data conducted by the organization\u2019s staff in accordance with its research policies.In health economics, an established technique for estimating the value of a product is to find out people\u2019s willingness to pay (WTP) for it. Technically, WTP is the maximum amount that a person is willing to sacrifice to procure a good or to avoid something undesirable. This is usually established by surveying a group of consumers who are asked questions such as, \u201cWould you purchase this product if it were offered at a price of X?\u201d If this price differs between the consumers surveyed, then it is possible to make a good estimate of the sample\u2019s collective WTP a particular price.Willingness to pay surveys have been used in medicine generally and in telemedicine specifically. For example, in one of the earliest telemedicine studies, Tsuji et al.  surveyedWe have previously proposed a method for assessing the quality of a teleconsultation, which requires a panel of observers to answer questions about a selected case. The method provides indices (scores) relating to different aspects of quality . The preSuppose four panel members review a case, answer the value questions independently, but are not told what the overall value (score) of their responses is. Then they are asked a final question: \u201cConsidering the teleconsultation as a whole, do you think the quality  was sufficiently good in the circumstances? In other words, quality can always be made higher, but was it good enough?\u201dThat is, the final question takes into account the specificity of the environment and its variability. Their individual answers to this question might be:If the corresponding quality scores  are computed, these might turn out to be:From the first two responses, we know that the score of 9.1 was considered high enough (by panel member 1), but that a score of 8.5 was also considered high enough (by member 2). That is, 8.5 represents the upper bound on the quality required.just above 7.5. In the scoring system under discussion, a precision of more than 1% would not be meaningful. Thus, a lower bound lying just above 7.5 can be taken as a value of 7.6.From the other answers, we know that 6.9 was not considered high enough (by member 3) and that 7.5 was not considered high enough either (by member 4). That is, the lower bound lies Therefore, in this example, the value can be estimated to lie in the range 7.6\u20138.5. This represents a consensus view about the quality of the teleconsultation, taking into account the circumstances of the case, such as whether the clinical question was very complex.(A)Some panel members answer that their individual estimate was sufficient and some answer that it was not.(B)All panel members answer that their estimate was sufficient.(C)All panel members answer that their estimate was not sufficient.In establishing the consensus view of the panel, there are three possible sets of answers:These three scenarios are depicted in Figure To examine the feasibility of this approach, we used it prospectively on cases from the MSF telemedicine network. A panel of observers rated seven cases, which were being assessed routinely for quality assurance purposes.The responses of the panel are summarized in Table Note that the panel estimate was considerably higher in case 914 than in cases 1201 and 1221. This suggests that the latter cases are more \u201cdifficult.\u201d Case 914 concerned a request for interpretation of chest X-ray images; this was a relatively straightforward query for the network to handle. Case 1201 was a patient with penile wounds, and case 1221 concerned loss of vision in a patient with multiple drug-resistant TB; both cases can be considered as fairly complicated queries. However, in four of the seven cases, the panel\u2019s estimate was only determined as an upper boundary  rather than a specific value.An alternative method of assessing the difficulty of the question in a teleconsultation network is direct estimation, by having an expert panel rate the difficulty of each case explicitly. That is, suitably qualified observers would independently assess teleconsultation cases by answering the 11 questions about each case shown in Table Three observers (experienced telemedicine case-coordinators) independently rated 10 telemedicine cases selected randomly from previous cases in the MSF telemedicine network.The mean score for difficulty (0\u2009=\u2009no difficulty to 33\u2009=\u2009extreme difficulty) ranged from 19 (case 1019) to 24 (case 1082), see Figure There are few published reports about quality measurement in telemedicine. Most have been retrospective studies, and concern specific application areas such as radiology , ophthalThe present work sets out what is required for long-term monitoring of quality in a teleconsulting network. In conventional process control, the output from the telemedicine network would be measured, and compared with a target value. Since it is not straightforward to define the latter, we propose the assessment of the input to the process instead. When each quality measurement of the output is made, an allowance can be made for the characteristics of the case submitted. This means that fluctuations in output quality can be attributed to variations in the process (network) or to variations in the raw materials (queries submitted to the network).Two methods of estimating the degree of difficulty posed by cases submitted to a telemedicine network have been trialed. The first, an indirect method, is easier to use in practice, but a pilot study shows that it produces results of limited value. The second method, the direct estimation of case difficulty, is more demanding to implement, but produces results, which appear useful. Much further work will be required to develop this method for routine service, so that the individual assessments of case difficulty can be employed in the long-term monitoring of output quality. One simple method would be to normalize the quality score in a particular teleconsultation by dividing it by the difficulty level. However, it cannot automatically be assumed that a linear relationship is appropriate, and a more appropriate weighting scheme might require a logarithmic transformation of the difficulty level. Clearly, these matters all represent areas for future research.The methodology proposed in the present work is perfectly general, and extends beyond telemedicine in high-resource settings to non-telemedicine work in conventional health care settings. Using a low-resource setting as the environment in which to develop a more general method represents a strength of the study, since it does not depend on a pre-existing, reliable, and efficient health care system to provide a foundation. Long-term quality assurance should assist those providing telemedicine services in low-resource settings to ensure that the services are operated effectively and efficiently, despite the constraints and complexities of the environment.There are several limitations of the proposed technique (the direct estimation of case difficulty). First, the validity of the method must be established formally. Second, the optimum number of observers remains to be established. Both these matters stem from the sources of variability in the estimation problem being considered, where the underlying true value is obscured by variation between patients, by variation between observers, and also by variation between specialists .Finally, the best method of combining the panel\u2019s scores requires some theoretical basis. Clearly, further research is required to investigate all this prospectively.As telemedicine becomes adopted as a routine method of healthcare delivery, there is a requirement to implement quality assurance activities. However, there is little published information about quality assurance in store-and-forward networks, especially in low-resource settings. The present study builds on a previous proposal for measuring the quality of individual teleconsultations being produced by a network, and allows long-term process control by taking into account the difficulty posed by individual cases. The methodology is feasible and appears to produce useful results. It should assist those working in low-resource settings to ensure that telemedicine services are operated effectively and efficiently, despite the constraints and complexities of the environment.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "P\u2009=\u20090.59) and a larger study might be helpful. In the meantime, routine monitoring of telemedicine service quality will continue in the interests of quality assurance. As yet, there is no evidence on which to base a correction for case difficulty.We examined the difficulty of telemedicine cases and the quality of the resultant consultation in a mature store-and-forward telemedicine network. A random sample of 10 telemedicine cases was selected from those occurring over a 3-month period (5% of the workload) and they were scored by three experienced observers. Inter-observer agreement on the difficulty scores was poor (Fleiss\u2019s kappa\u2009=\u20090.18) and it was also poor on the consultation quality scores (Fleiss\u2019s kappa\u2009=\u20090.11). Differences between observers were minimized by consensus scoring, and the cases were re-assessed jointly by two observers. Based on the consensus scores, there was a weak negative relation between output quality and case difficulty, i.e., the more difficult cases tended to result in lower quality consultations. However, the effect was non-significant ( We have proposed a method for measuring quality and demonstrated its feasibility (M\u00e9decins Sans Fronti\u00e8res (MSF), a non-governmental humanitarian medical organization, operates a store-and-forward tele-expertise network to support its field staff . This sesibility .the description of the problemthe complexity of the patientthe availability of network resources for providing an answerthe availability of resources for implementing the advice .However, in real life each telemedicine case is different: some will be easy to manage by telemedicine and some will be difficult. The difficulty of an individual case will depend on four main factors :the des-the complexity of the situation, for example, due to political, cultural, socioeconomic, or environmental factors-the health care system available, such as the infrastructure, organization, and human resources-the characteristics of the health workers who are managing the patient, such as their background, competencies, and experience.The latter point refers to the patient\u2019s environment and constitutes an important dimension since any management must depend on the patient\u2019s environment. Taking account of the environment is often challenging because there are multiple factors involved :-the coTo facilitate the operation of the MSF telemedicine system, information is available to the specialists concerning both the referrer and the patient\u2019s health care facility. This allows the specialist to tailor the advice provided to suit the local environment.We have proposed a method for measuring the difficulty of cases and demonstrated its feasibility . The queThe aim of the present study was to investigate the relation between consultation quality and case difficulty.a random sample of 10 telemedicine cases was selected from those occurring over a 3-month period (the first 3\u2009months of 2015)assessments of these cases were made independently by three experienced observers. Case difficulty was scored by answering 17 multiple choice questions (no/perhaps/yes), resulting in a score from 0\u2009=\u2009very easy to 10\u2009=\u2009very difficult . Consultagreement between observers was measured for difficulty scores and for quality scores using Fleiss\u2019s kappa statisticthe cases were also assessed jointly by two observers to obtain consensus values for the scores. Several conference calls were used to discuss cases and reach the consensusthe relation between consultation quality and case difficulty was examined by regression analysis.The relation between output quality and input difficulty was investigated in a sample of cases from the MSF telemedicine network:Ethics permission was not required because patient consent to access the data had been obtained and the work was a retrospective chart review conducted by the organization\u2019s staff in accordance with its research policies.During the 3-month period, the telemedicine network dealt with 185 clinical cases. The random sample of 10 cases, therefore, represented 5.4% of the caseload. Brief details are provided in Table The sample of cases was assessed independently by a panel of three observers Table . The cort\u2009=\u20090.56, P\u2009=\u20090.59).The cases were then re-assessed jointly by two observers, who discussed each scoring disagreement and came to a consensus. Based on the consensus scores, there was a weak negative relation between output quality and case difficulty, i.e., the more difficult cases tended to result in lower quality consultations, see Figure When telemedicine cases were assessed independently by three observers, the inter-observer agreement on the scores was poor. This was probably due to differences in the observers\u2019 background (one observer had no MSF field experience) and to the absence of formal training materials about the two scoring systems used. The value of prior training for an expert panel which is undertaking quality assessment  has been shown to be important in ensuring valid estimates .questions need to be defined precisely, so that there can be no doubt about the subject of the question; detailed guidance may be necessary to clarify each question. For example, both the quality and the difficulty scores contained a question about whether sufficient information had been provided by the referrer. In some of the cases which were assessed, we observed that the specialists involved in the cases had started their responses by asking a question. It seems natural to assume that if the specialist begins by asking a question, the referrer cannot have provided sufficient information in the original referralobservers who assess a case that refers to their own specialty tend to be more demanding in their scoringobservers sometimes change their mind when re-scoring a case. This may be due to a lack of attention initially, or to a change of mind after hearing the opinion of other observers.From the consensus sessions (after scoring cases independently), some points emerged which could improve the quality of future scoring:Using consensus scores between two observers showed that there was a weak negative relation between output quality and case difficulty, i.e., the more difficult cases tended to result in lower quality teleconsultations. Why does this matter?Y and X are required, i.e., this is not the standard regression situation.If the input and output of a telemedicine network  can be measured, then the process itself can be quantified; this is analogous to the transfer function describing the behavior of a black box model. Measuring the transfer function can be done using a sample of cases that cover a range of input values Figure . The besAlso note that the transfer function must be established quickly enough that the underlying process can be assumed to be stationary. In the present study, 10 cases were randomly selected as being about the maximum number that could be analyzed, given the practical constraints on the observers. Obviously, the smaller the sample, the less likely it is that the stationarity assumption would be violated. Thus, the number of cases sampled represents a compromise.Once the baseline transfer function has been established, it can be used to detect changes in the behavior of the network. For example, the transfer function analysis could be repeated after about 6\u2009months, and compared with the baseline Figure .Alternatively, we could add individual observations once a week, say. To detect a change, each new point would be examined to see if it was significantly different from the model Figure . If not,We are not aware of previous work on the relation between the difficulty of cases in a telemedicine network (of any kind) and the value of the resulting consultation. One strength of the study was that it was performed using real cases, selected at random from a mature telemedicine network. Another strength was that the observers who carried out the assessments were experienced in operating the telemedicine network: between the three of them, they had handled almost three-quarters of the cases on the network in the first 6\u2009years Table .On the other hand, the scoring system used in the present work rested ultimately on the subjective judgments made by the observers. As was clear from their independent assessments, their agreement was poor \u2013 something that would have been improved by prior training \u2013 so consensus scoring was used to eliminate inter-observer differences. One of the observers had previously managed some of the randomly selected cases, so there is a possibility of unconscious bias in his scoring, although given the 6-month interval between case management and scoring that seems unlikely. Another weakness was that the study was carried out using a small sample, and it is conceivable that a Type 2 error may have been made. Nonetheless, the results show that while a statistical relation between the output quality and the input case difficulty may exist, the magnitude of the effect is small. We, thus, feel confident in ignoring it in future long-term monitoring of network performance.The present study examined the difficulty of telemedicine cases and the quality of the resultant consultation provided at distance. Differences between observers were minimized by consensus scoring, and it appears that use of a scoring manual would be important in minimizing inter-observer differences in future. The results suggest that more difficult cases tend to result in lower quality teleconsultations, although the effect is non-significant. The study was based on a small sample and a larger study might be helpful. In the meantime, routine monitoring of telemedicine service quality will continue in the interests of QA. As yet, there is no evidence on which to base a correction for case difficulty.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.http://journal.frontiersin.org/article/10.3389/fpubh.2015.00217The Supplementary Material for this article can be found online at Click here for additional data file."}
+{"text": "Store-and-forward telemedicine in resource-limited settings is becoming a relatively mature activity. However, there are few published reports about quality measurement in telemedicine, except in image-based specialties, and they mainly relate to high- and middle-income countries. In 2010, M\u00e9decins Sans Fronti\u00e8res (MSF) began to use a store-and-forward telemedicine network to assist its field staff in obtaining specialist advice. To date, more than 1000 cases have been managed with the support of telemedicine, from a total of 40 different countries. We propose a method for assessing the overall quality of the teleconsultations provided in a store-and-forward telemedicine network. The assessment is performed at regular intervals by a panel of observers, who \u2013 independently \u2013 respond to a questionnaire relating to a randomly chosen past case. The answers to the questionnaire allow two different dimensions of quality to be assessed: the quality of the process itself and the outcome, defined as the value of the response to three of the four parties concerned, i.e., the patient, the referring doctor, and the organization. It is not practicable to estimate the value to society by this technique. The feasibility of the method was demonstrated by using it in the MSF telemedicine network, where process quality scores, and user-value scores, appeared to be stable over a 9-month trial period. This was confirmed by plotting the cusum of a portmanteau statistic (the sum of the four scores) over the study period. The proposed quality-assessment method appears feasible in practice, and will form one element of a quality assurance program for MSF\u2019s telemedicine network in future. The method is a generally applicable one, which can be used in many forms of medical interaction. M\u00e9decins Sans Fronti\u00e8res (MSF) is a non-governmental humanitarian medical organization that responds to emergency situations and provides medical assistance to those in need. MSF teams provide medical emergency aid in difficult settings around the world, and staff often have to diagnose and treat patients with limited resources . In 2010In a store-and-forward telemedicine network of this type, doctors in the field refer cases electronically to obtain a second opinion about diagnosis or management. Incoming cases are reviewed by a case coordinator and assigned for reply to one or more appropriate experts. The network therefore operates in a similar way to a bulletin board, with messages being posted by its users. Although formal evidence for the clinical effectiveness of the telemedicine advice obtained through networks of this kind is rather scarce , 4, theyAs store-and-forward telemedicine in resource-limited settings is becoming a relatively mature activity, there is a concomitant requirement to implement quality assurance/improvement activities. Indeed, it may be considered unethical not to do so. However, there are few published reports about quality measurement in telemedicine, except in networks concerned with radiology , ophthalThe primary research question was whether a method could be developed for quality measurement in general teleconsulting work in low income countries. The aim of the present work, therefore, was to develop a method for assessing the quality of the teleconsultations being conducted in the MSF telemedicine network, and then to examine its feasibility for routine adoption.(1)development of a quality-assessment tool(2)demonstration of feasibility in the MSF telemedicine networkThe present study required the development of a method to assess quality and then a demonstration of its feasibility in practice. The work was performed in two stages:Ethics permission was not required, because patient consent to access the data had been obtained and the work was a retrospective chart review conducted by the organization\u2019s staff in accordance with its research policies.A questionnaire was developed by a consensus between three experienced telemedicine practitioners. It was based on accepted tools used in previous studies , 9. The (1)process by which the response was produced satisfactory? i.e., what was the quality of the teleconsultation process itself?was the (2)outcome from the teleconsultation useful? i.e., what was the value of the teleconsultation and to whom?was the We defined quality in terms of two of the three dimensions of the Donabedian model: process and outcome.  Thus in assessing the quality of a given teleconsultation, there are two principal questions:These questions address separate dimensions of quality, both of concern to network operators. That is, the process for producing a response might be satisfactory, but the response itself could be useless. Or the process could be unsatisfactory, but the response might still be useful.Both aspects of quality can best be judged by using a panel of assessors. This is because any evaluation will involve subjective judgments, so a panel of observers is more likely to produce an accurate estimate than a single observer. However, it is not feasible to evaluate the quality of every single teleconsultation conducted in the network, so there must be a sampling process by which a case is selected (randomly) for assessment at regular intervals. This leads to a quality-assessment scheme whose main features are summarized in Table qp) can be assessed by the panel members, who can make a judgment about various relevant matters. For example, they can judge whether the referrer provided sufficient information, whether the case was sent promptly to an appropriate expert, whether an answer was obtained sufficiently quickly to be useful and so on. There are 10 questions listed in Table The quality of the teleconsultation process ((1)vp. After the patient himself, the person best placed to judge this is the referring doctor. It can also be estimated by senior staff in the organization.Value to the patient, (2)vr. The person best able to judge this is the referring doctor, but it can also be estimated by senior staff in the organization.Value to the referring doctor, (3)vo. This is probably best judged by senior staff in the organization itself.Value to the organization, (4)vs.Value to society as a whole, The value of the response can be assessed in a similar way by the panel members. There are four domains of interest:The first three values can be assessed by staff with suitable telemedicine experience. However, assessing the value to society is much more difficult. The value to society of telemedicine will be partly determined by the health care system in the country concerned , including the degree to which telemedicine has been properly integrated into the chain of health care there. Assessing the value to society as a whole is therefore difficult to do on the basis of a single telemedicine case, and is ignored in what follows. It is worth noting that in a humanitarian context (or a not-for-profit operation), the value to society will be closely aligned with the value to the organization.Direct measurement of value is not straightforward. In health economics, it is usual to measure the cost-effectiveness of the technique in question and to make a comparison  to obtain evidence that it does not represent a waste of resources. However, in the context of telemedicine in resource-limited settings, this is not easy to do. First, the costs are distorted, because many staff are volunteers and there may also be donor support, which can be hard to quantify. Second, the clinical effect of telemedicine may be difficult to document, as patients are commonly lost to follow up after their initial encounter.How else can the \u201cvalue\u201d of a teleconsultation episode be measured? That is, what is the value to the interested parties? Panel members can form a judgment about whether the telemedicine response clarified the diagnosis, whether the eventual clinical outcome would be beneficial for the patient and so on. There are nine questions listed in Table (1)the system automatically selected a past case for review at the beginning of each month. The case was chosen randomly from those referred 4\u20138\u2009weeks previously. If there were fewer than four cases in the period of interest, no case was selected. (The average case submission rate during the period in question was approximately one case per day.)(2)the members of the quality-assessment panel were notified by email that a case had been chosen for review. The panel comprised mainly senior doctors with previous MSF field experience; there were three other healthcare professionals with telemedicine experience.(3)panel members logged in to the telemedicine system, viewed the information about the chosen case and answered the questions about the case. The questions had simple, multiple-choice answers, which were presented in a drop-down box for ease of selection. Panel members could not view the answers from any other panel member until they had provided their own.(4)when at least one set of answers had been provided, the system calculated the quality scores for the case. The four quality scores were values in the range 0\u201310.To demonstrate the feasibility of the proposed approach, a panel of 12 experts was invited to answer the 17 questions about randomly selected telemedicine cases, see Table A control chart was used to examine the stability of the monthly quality scores. Control charts can be plotted for each of the four quality indices, but for simplicity, a grand quality score (GQS) for each case was calculated from the panel\u2019s quality and value scores asThat is, the GQS represents an equi-weighted summation of the four constituent indices. The GQS was transformed to lie in the range 0\u201310 .The cusum chart is a well-established and powerful method for identifying changes in a process average. The chart plots the cumulative difference between the recorded values and a target value, which is often chosen to be the process average. The GQS values were plotted as a cusum, using the grand mean as the reference value.Note that there are two important assumptions underlying the use of control charts: the measurement that is used to monitor the process is distributed according to a normal distribution; it was not necessary to transform the data in the present case. Also, the measurements are assumed to be independent of each other.The panel assessed randomly selected cases starting in July 2013. At least four responses were received for each case. The median panel score for process quality was 8.0  across the nine cases. The lowest score awarded for process quality by an individual panel member in any case was 4.7 and the highest was 9.0. The median values in each case are shown in Figure The median panel score for value to the patient was 8.9 . The lowest score awarded for value to the patient was 3.3 and the highest was 10. The median values in each case are shown in Figure The median panel score for value to the doctor was 9.1 . The lowest score awarded for value to the doctor was 5.7 and the highest was 10.0. The median values in each case are shown in Figure The median panel score for value to the organization was 8.9 . The lowest score awarded for value to the organization was 5.6 and the highest was 10.0. The median values in each case are shown in Figure The median panel GQS was 8.6 . The lowest individual GQS was 6.1 and the highest was 9.8. The median values in each case are shown in Figure We have developed a quality-assessment scheme for a store-and-forward telemedicine network and demonstrated its feasibility in a real-life clinical setting. There appear to be no previous reports of similar work.Previous work on assessment of quality in telemedicine networks has often focused on user satisfaction , which The proposed method was trialed in a real-life telemedicine network, where it was shown to be feasible and appeared to produce useful results. It thus appears suitable for routine adoption. Implicit in the methodology are a number of design decisions.The size of the questionnaire is likely to influence the number of responses from the panel. The right balance has to be struck between asking too few questions and too many. On one hand, the more questions that are asked, the better the situation can be assessed; but on the other hand, too many questions will discourage the observers from responding, which will make the system less sustainable. In practice, 10\u201320 questions seems to be a reasonable number.Which index  is most appropriate for long-term monitoring, in order to measure network performance? Are all four indices of equal importance, or should some be more heavily weighted than others? Should they be monitored collectively, rather than individually? This requires further work.How often should cases be sampled and monitoring be performed? On one hand, more frequent sampling will allow closer performance monitoring; on the other hand, it is likely to lead to \u201cobserver fatigue.\u201d In practice, we suggest that random sampling of one case per month is about right.How many panel members should give an opinion? The more members there are, the more likely there is to be disagreement between them; on the other hand, the more there are, the better the estimate of the underlying value. In practice, we suggest that 5\u201310 panel members are about right.Routine measurement of quality on randomly selected cases is only one part of the whole evaluation process and will form one element of an overall quality assurance program for the telemedicine network concerned. Other elements may include obtaining other points of view and follow up reports to assess long-term outcomes concerning the cases and the benefits of the expertise.The present work has certain limitations. For example, before it could be used routinely, the quality-assessment methodology would require validation. However, it is difficult to validate the proposed indices independently, especially in the context of a telemedicine network operated by a humanitarian organization. Ideally, they should be evidence-based, and of demonstrated validity and reliability . FurtherIndustrial process control is normally done using an absolute standard as the reference. In the present work, a relative reference value was employed. That is, it represents an assessment of relative quality, which pragmatically, is probably better than no assessment at all. Again, further work is required to find out whether absolute reference standards can be developed.Finally, the quality of this evaluation relies on the information available for assessing the case. Sampling a case at a particular time may be problematic if there is insufficient feedback on follow up. It also relies on the expertise and experience of the assessor panel. The panel members must be selected carefully and it is important that they have no conflict of interest. This is why it may be better to use independent volunteers, rather than senior staff from the organization running the network.The present method provides estimates of the value to the main parties concerned in a teleconsultation, together with an estimate of the quality of the teleconsultation process itself. This is important information for those responsible for the operation of the network. To the best of our knowledge, there has been no information published previously about the quality of general teleconsultations in a store-and-forward network. Yet, if telemedicine is considered sufficiently mature that it can enter routine service, there is an ethical imperative to ensure that it is employed in a cost-effective manner. The method described here provides an instrument for monitoring quality and will form part of the toolset used by the operators of the MSF telemedicine network in future.Once a method for assessing quality is available, application of industrial process control methodology allows the stability of the network to be monitored. Again, this is important if network operators are to be reassured that quality is not in slow decline. The information may also be valuable in improving the performance of healthcare staff in low-resource settings, which is known to be a difficult problem .The techniques presented in this paper are of wide application. They could potentially be used in non-telemedicine consultations , and in industrialized countries as well as resource-limited settings.A method for assessing the quality of the teleconsultations in a store-and-forward telemedicine network is proposed. It provides estimates of the quality of the process and the value of the consultation to the main parties involved. A trial of the method showed that it was feasible and that the process in the network studied was stable. The method appears to give useful results. It seems desirable to implement it in other telemedicine projects where it can contribute to the evaluation of practice, something that is necessary in all medical services provided.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "Mycobacterium tuberculosis but do not progress to the active disease \u2013 latent tuberculosis infection. The objective of this study was to assess the prevalence and risk factors associated with latent tuberculosis infection among healthcare workers in Nampula Central Hospital, Mozambique.Healthcare workers in high tuberculosis burdened countries are occupationally exposed to the tuberculosis disease with uncomplicated and complicated tuberculosis on the increase among them. Most of them acquire n\u00a0=\u00a0209) were administered a questionnaire on demographics and occupational tuberculosis exposure and had a tuberculin skin test administered. Multivariate linear and logistic regression tested for associations between independent variables and dependent outcomes (tuberculin skin test induration and latent tuberculosis infection status).This cross-sectional study of healthcare workers was conducted between 2014 and 2015. Participants , those who had no BCG vaccination (39.6%) and were immunocompromised (78.1%). Being immunocompromised was significantly associated with latent tuberculosis infection . Positive but non-significant associations occurred with working in the medical domain , length of employment > eight years  and occupational contact with tuberculosis patients .Personal and occupational factors were positively associated with latent tuberculosis infection among healthcare workers in Mozambique. The World Health Organization (WHO) reported in 2014 that the African Region had approximately 25% of the global tuberculosis (TB) cases and the highest prevalence of active TB infection . Mozambique is classified among the countries with a high burden  of active TB infection , fuelled by the number of people infected with human immunodeficiency virus (HIV) .Mycobacterium tuberculosis but they do not present with active disease being in a state referred to as Latent Tuberculosis Infection (LTBI). In this state, the tuberculin skin test (TST) is positive but the clinical and radiological signs are absent. Healthcare workers with LTBI are not infectious but there is a risk of developing active TB if their immunity fails  being established. Healthcare workers were randomly selected from the list until the accepted proportion of HCWs per category per department was reached to ensure a good representation of HCWs regarding category and working department. The proportion of HCWs per category and department in the sample was calculated according to the proportion in the list of HCWs collected from the hospital. During the recruitment of the HCWs by the interviewers if a HCW declined participation another one was selected. This process went on until exhaustion of the study population. Unfortunately the sample size was not reached (figure) due to staff refusing to have a second TST. Those with active TB, on treatment and with at least two symptoms suggestive of TB  were excluded from the study\u00a0Fig. .Fig. 1ThInitially all volunteering HCWs were administered a TB symptom screening questionnaire  with symThis was based on HCWs response to questions on their exposure to TB and use of administrative control measures. The assessed length of exposure to TB at workplace (patients and co-workers) and at home was at least for 6\u00a0months. In this study administrative control measures included cough triage, isolation room, sputum collection and use of personal respiratory protection (PRP) all the time when working.To diagnose LTBI, HCWs were tested with tuberculin by nurses trained to test TB in patients at Nampula Central Hospital. An intradermal injection of 0,1\u00a0mL of tuberculin PPD RT23 was performed using the Mendel \u2013 Mantoux technique in the dorsal aspect of the left forearm using a special disposable 1\u00a0mL syringe . The tesThe TST results were read as recommended by Jensen et al. where immunity defined TST cut-off points. Immunocompromised HCWs  were positive when TST\u00a0\u2265\u00a05\u00a0mm and non-immunocompromised HCWs when TST\u00a0\u2265\u00a010\u00a0mm . ChronicHealthcare workers were asked if they knew their HIV status. If answered in the affirmative they were asked if they wish to reveal their status. Healthcare workers who had never been tested for HIV were encouraged to do so. Thirty-one HCWs (14.8%) refused to reveal their HIV status but were retained in the study.Data was entered and analysed in SPSS (version 21). The dependent variables were TST induration measured in millimetres and LTBI presence based on the reading of the TST induration and categorization into positive and negative test result (yes/no). The independent variables were age, sex, smoking status, education level, perceived health status, current employment setting, job category, contact with a TB patient at home (last year), duration of employment (years of employment), previous job (last six months), Bacillus Calmette-Gu\u00e9rin (BCG) vaccination, HIV status, chronic conditions and current use of immunosuppressive medication, contact with TB patients, use of PRP and administrative controls practiced at work. Age was categorised in three groups according to the trends found during the data analysis. Healthcare workers reported on their current employment setting in the hospital which was then categorised into work domains . The prevalence of LTBI was the proportion of TST positive results of the total number of HCWs tested. Continuous variables were categorised around the mean since data was normally distributed. Means and standard deviations and frequencies were used to describe continuous and categorical variables respectively.t-test and ANOVA were used to test for associations between the independent variables and TST induration. Chi square tested for associations between the independent variables and LTBI. Variables were tested for covariance using HCW\u2019s age and working time as covariates (continuous variables) separately, each one at a time, because these two variables are strongly correlated .On bivariate analysis the independent-samples p-value.Multiple linear and logistic regression tested for associations between the independent variables and the continuous and categorical dependent variables respectively while controlling for age and sex. The model was tested controlling for each risk factor to find the one which best explained the influence of risk factors on the dependent variable but the R square value did not improve. The accepted level of significance was 0.05. Based on evidence presented in the literature review all variables from bivariate analysis were entered into the multivariate model. Education level was excluded since it was reflected in the job category. The introduction of variables in the model was done using hierarchical multiple regression starting with age and sex and then each variable was entered in the model by increasing order of the n\u00a0=\u00a0209) and those who refused (n\u00a0=\u00a098) with respect to demographic and occupational variables shown in Table Three hundred and sixteen (83.2%) of 380 HCWs, participated in the questionnaire survey. Two hundred and nine HCWs consented to have a TST, ninety eight refused and nine were excluded based on exclusion criteria. The mean age of HCWs was 36.8\u00a0years (standard deviation (SD) 7.8) with a female predominance (68.4%). There was no significant difference between the HCWs consenting to the TST ). Healthcare workers aged 33 to 40\u00a0years had the highest prevalence of LTBI . Non-smokers HCWs had a higher LTBI prevalence . Lower educated HCWs had a higher LTBI prevalence . The LTBI prevalence was higher in HCWs with no previous BCG vaccination  and immunocompromised HCWs .The LTBI prevalence among tested HCWs was 34.4%  compared with the surgical domain and administrators. The prevalence of LTBI was higher among HCWs who worked for more than eight years , in the presence of administrative control measures  and in those who reported contact with TB patients at the workplace    compared to those who were not (mean: 6.75\u00a0cm) p\u00a0=\u00a00.09 (Table 9) Table .Adjusted for age and sexHealthcare workers aged 33\u00a0years to 40\u00a0years (Odds Ratio (OR) 1.55 ) and more than 40\u00a0years  had higher odds of having LTBI as compared to the younger group on bivariate analysis even though not significant. There was a positive association between being smoker and LTBI  with being female positively associated with LTBI . Administrative control measures had a negative association being protective  in bivariate but positive  in multivariate analysis.On multivariate analysis there was no significant association found with LTBI with the following risk factors but positive association were demonstrated: working in the medical domain , working for more than eight years , contact with TB patients in the workplace  and at home . On multivariate analysis, being immunocompromised  was significantly associated with a diagnosis of LTBI. BCG vaccination showed a negative association with LTBI which was not significant .This study of LTBI prevalence among HCWs in Mozambique provides valuable information in a country classified as a high TB burden country by the WHO in 2013 , 9, 10. The prevalence of LTBI was higher in HCWs more than 32\u00a0years of age (and highest in age group 33\u201340\u00a0years) with a positive association on bivariate analysis although not statistically significant. There are other studies which have reported a high prevalence with advancing age , 30, 31.The prevalence of LTBI was very similar between males and females (34.8% vs 34.3% respectively).n\u00a0=\u00a08, 3.8%) and presence of immunocompromised amongst the non-smokers.Contrary to what was expected from the literature , 33 a hiImmunosuppression is a very important individual risk factor with a high LTBI prevalence (78.1%) and a statistically significant association . The wide confidence interval may be reflective of our small sample size however Van Rie et al. found HIV associated with a high prevalence of LTBI and an increased probability of progression to TB disease . This haIn this study the prevalence of LTBI was higher in the HCWs who had not been vaccinated with BCG. This is supported on multivariate analysis where a protective relationship was shown with BCG vaccinated HCWs being less likely to have LTBI  and positive association on multivariate analysis  seen in HCWs in contact with TB patients at work is consistent with work by Whitaker et al. that concluded that HCWs more often in contact with TB patients have a higher LTBI prevalence . In MozaThe major limitation of our study is related with TST disadvantages (less specific for diagnosis of LTBI than blood tests using IGRA and dependent on the technician who performs the test) and definition of immunosuppression since the conditions were self-reported  and not clinically validated. The TST limitations have contributed to the high refusal rate especially the number of laboratory visits to perform and read the test as the two-step testing method was used. Other limitations include: no doctors among the study participants, self-reported TB exposure (questionnaires), self-reported BCG vaccination, self-reported HIV status and lack of LTBI prevalence in the general population for comparison purpose. Doctors were reluctant to participate in the study mainly related to the number of laboratory visits to comply with two-step TST.In conclusion, amongst the risk factors for LTBI in our study we found positive, though non-significant, associations with increasing age, being female, working in the medical domain, working for a longer duration in healthcare and contact with TB patients at work and home. Immunosuppression was significant on multiple logistic regression analysis. Immunosuppression is largely related to HIV . The pre"}
+{"text": "PDK1), a negative regulator of oxidative phosphorylation, is highly active in clusters of cells arranged in a spotted array. To understand this pattern, we developed a reaction\u2013diffusion model that incorporates Wnt signaling, a pathway known to upregulate PDK1 and Warburg metabolism. Partial interference with Wnt alters the size and intensity of the spotted pattern in tumors and in the model. The model predicts that Wnt inhibition should trigger an increase in proteins that enhance the range of Wnt ligand diffusion. Not only was this prediction validated in xenograft tumors but similar patterns also emerge in radiochemotherapy\u2010treated colorectal cancer. The model also predicts that inhibitors that target glycolysis or Wnt signaling in combination should synergize and be more effective than each treatment individually. We validated this prediction in 3D colon tumor spheroids.Cell\u2010intrinsic metabolic reprogramming is a hallmark of cancer that provides anabolic support to cell proliferation. How reprogramming influences tumor heterogeneity or drug sensitivities is not well understood. Here, we report a self\u2010organizing spatial pattern of glycolysis in xenograft colon tumors where pyruvate dehydrogenase kinase ( Cellulaet\u00a0al, et\u00a0al, 2 production) to favor glycolytic modes that produce lactate   that must be exported to the tumor microenvironment. Lactate can be angiogenic, and thus, the activities of glycolytic cells can be important for delivery of nutrients and growth factors to the tumor microenvironment \u201d and \u201cOXPHOS (Po)\u201d to indicate that they differ in the relative balance between these two modes of metabolism. As the spots of PDK activity and Wnt signaling appeared as a regular array in space, we hypothesized that metabolism was subject to rules of pattern formation, and we therefore developed a mathematical model with spatial features to study the organization of this pattern. Using reaction\u2013diffusion equations to describe the dynamics of Wnt signaling, nutrients, cell substrates, and the populations of the different metabolic cell types, we elucidate the mechanisms that underlie this spatial pattern and find good agreement between the model and experiments. We lastly exploit this knowledge to identify promising therapeutic strategies.In the course of our study of Wnt signaling and glycolysis in xenograft colon tumors, we observed heterogeneous patterns of metabolism. Heterogeneity was observed via immunohistochemical stain of PDK1 activity, a major inhibitor of mitochondrial activity, and immunohistochemical stains of Wnt signaling. In particular, these stains revealed a pattern of discrete clusters of cells, or \u201cspots\u201d, indicating groups of cells with different levels of glycolysis relative to OXPHOS, and differences in Wnt activity. We refer to these groups of cells as \u201cglycolytic  colon cancer cell line SW480  were produced by subcutaneous injection of cells in immunocompromised mice. To investigate metabolic changes within the tumor, 5.0\u2010 to 6.0\u2010\u03bcm serial sections of formalin\u2010fixed, paraffin\u2010embedded tumor were probed with antisera specific for phosphorylated PDH (pPDH) as an indicator of PDK activity, and lymphoid enhancer factor\u20101 (LEF\u20101), a Wnt signaling transcription factor and Wnt target gene . While this analysis is not definitive because it does not guarantee that the paired pixels are in the same cell  and also does not take into account spatial variation in spot densities, it suggests that the patterned heterogeneity of metabolism and Wnt signaling are linked.To determine the significance of the association between the spots see  and founXenograft tumors from colon cancer cell lines are different from primary human colon cancers, the latter of which develop in immunocompetent patients and contain a greater variety of cell types and stromal involvement. We asked whether PDK activity and Wnt signaling were uniform or heterogeneous in primary human colon tumors. In Fig\u00a0et\u00a0al  cells, and those that perform more glycolysis, which are termed glycolytic (Pg) cells. Both types of cells may divide, die, and undergo random movement. Depending on local environmental conditions, the cells may switch from one phenotype to the other. A diffusible substrate (N), which accounts for concentrations of nutrients such as glucose and growth factors, regulates cell division and death (\u03c7N), the switching function \u03c7W\u2217\u03c7N\u2217 from OXPHOS to glycolysis, and the ability of cells to generate Wnt (W) and Wnt inhibitor (WI) activities. The Wnt and Wnt inhibitor equations are based on the Gierer\u2013Meinhardt activator\u2013inhibitor model  also depend on Wnt activity where a higher activity level increases cell propensities for glycolysis over OXPHOS, if sufficient nutrients are available (\u03c7N\u2217). To model the angiogenic response of the mouse vasculature to the lactate produced by the glycolytic cells and the accompanying increased delivery of nutrients, we introduced sources NS that increase the amount of nutrient in the system proportionally to the amount of glycolytic activity of the cells. We also assumed that the vascular density was largest at the domain boundary and thus, we modified the boundary conditions for nutrients analogously. See We therefore developed a Turing\u2010type model for simulating the spatial and temporal dynamics of different metabolic phenotypes, nutrients, and Wnt signaling activity through a system of reaction\u2013diffusion equations Fig\u00a0 and A3. in\u00a0vivo model, which accounted for PDK activity, hypoxia\u2010inducible transcription factor concentrations (HIF1\u03b1), lactate concentration, and cross\u2010feeding between glycolytic and OXPHOS cells  has been distilled in the simpler model so that Wnt activity level, rather than PDK levels, provides an effective metabolic switch between relative amounts of OXPHOS and glycolysis. Because PDK drives the switch in metabolism in SW480 cells, we use the Pg and Po spatial distributions to compare to our xenograft stains.We also considered a more general OS cells . AssuminT of 1\u00a0day to rescale time and a characteristic diffusion length l of the Wnt inhibitor to rescale space. Since we did not know l , we varied l and found good agreement between the experimental and numerical patterns when l\u00a0\u2248\u00a040\u00a0\u03bcm. A full description of the both models, boundary conditions, and the nondimensionalization can be found in Materials and Methods and in the et\u00a0al, et\u00a0al, et\u00a0al, The model equations were solved in nondimensional form using a characteristic proliferation time Figure\u00a0o and Pg. Increasing or decreasing the Wnt switch changed the background levels of Pg cells and spot sizes without affecting the number of spots. Small reductions in SW, which can be thought of as reducing overall Wnt signaling, reduced the background levels of glycolytic cells without much effect on the sizes or numbers of spots. Sufficiently reducing SW resulted in all terms  decreasing to 0. Decreasing \u03baW (nonlinear Wnt activity) or increasing b (Wnt response to inhibition) paradoxically increases the number of glycolytic cells because nonlinear interactions actually result in a decreased amount of WI. Analogously, when \u03baWI (nonlinear Wnt inhibitor activity) decreases, the number of glycolytic cells decreases. Modifying the cell diffusion coefficients, death and decay rates, and the nutrient uptake rates did not significantly influence the self\u2010organization of a spotted array. Similarly, varying the proliferation times only changed the time it took to reach a steady state but otherwise had no effect on pattern formation.Because the model parameters were largely unknown, we investigated their influence on the results through a parameter study . Using aet\u00a0al, et\u00a0al, et\u00a0al, Since our model utilizes Wnt signaling, we tested how interference of this pathway would alter metabolic patterning. To disrupt the pathway, we used lentiviral transduction to express dominant negative LEF\u20101 (dnLEF\u20101) or dominant negative TCF\u20101 (dnTCF\u20101) transcription factors. Both dominant negative versions are naturally occurring LEF/TCF isoforms that lack the \u03b2\u2010catenin binding domain and therefore interfere with the activation/expression of Wnt target genes. Expression of moderate, physiological levels of dnLEF\u20101 or dnTCF\u20101 expression, partially, but not completely, disrupts Wnt target gene expression in the xenograft tumors . Thus, solely lowering overall Wnt signaling (SW) in the model produces outcomes in pattern that are inconsistent with the experimental data.To understand the phenotypic changes in the spotted patterns when Wnt signaling was partially disrupted, we used our model to identify changes in parameters that could recapitulate the experimental observations. The simplest change was to reduce SW, which increases the range of Wnt ligands and makes the spots larger, and concomitantly increasing DWI, which increases the range of Wnt ligand inhibitors and reduces the number of spots. Changing these two parameters and decreasing Sw simultaneously resulted in a striking recapitulation of the changes in the spotted pattern observed in the dnLEF\u20101/dnTCF\u20101\u2010expressing tumors: lower background levels of Pg cells and larger, fewer spots of Pg\u2010glycolysis  and that the decrease in the number of pPDH\u2010positive cell clusters could be due to factors that increase the range of inhibition. Therefore, we included two additional parameter modifications: increasing Dysis Fig\u00a0C. The avions Fig\u00a0D. Furtheions Fig\u00a0, a resulg spots but the Wnt\u2010activity spots were increased in size and distance relative to the pattern of Wnt activity in the simulations of the mock tumors  is shown relative to that of the untreated tumor , which we modeled by increasing DW and DWI proportionally. To model the effects of DCA, we increased the rate at which cells switched from a glycolytic metabolic phenotype to an OXPHOS phenotype  to reflect the tendency of cells to perform OXPHOS when PDK is inhibited.Because the inhibition of \u03b2\u2010catenin by XAV939 is similar to the effects of dnLEF\u20101 and dnTCF\u20101, we modeled treatment by XAV939 using an analogous approach. In particular, we assumed that XAV939 decreases the general Wnt signaling term Sg) to an OXPHOS state (Po) until there is an insufficient level of glycolytic cells to sustain the tumor and all the tumor cells die. Furthermore, the treatment simulations indicate that a combination of the two therapies will be more effective than single therapies as long as one or the other has adequately been applied. For example, a value of 1/\u03c4go=12 is effective in eradicating the cells as long as Wnt signaling has been reduced by more than about 27% . In other words, if \u03b2\u2010catenin expression has not been sufficiently suppressed by XAV939, then PDK inhibition by DCA must be adequately increased, and vice versa. Similar results are obtained when an in\u00a0vitro version of the mathematical model is used to simulate the growth of colonies in fibrin gels .Given that factors that increase Wnt diffusion were upregulated in the dnLEF/dnTCF tumors, we also tested the effect of increases in Wnt diffusion. We determined that increased expression of Wnt diffusers decreases the sensitivity of the tumors to treatment. For example, decreasing SWe performed a preliminary experimental test of model predictions using 3D colony growth of colon cancer cells. A total of 200 single cells were seeded in fibrin gels and cultured under drug treatment for 14\u00a0days Fig\u00a0A. Over tin\u00a0vivo simulation and the in\u00a0vitro experiments, the Combination Index is zero because neither XAV939 nor DCA treatment separately affects tumor sizes , although the Combination Index does depend on the drug concentrations and increases toward one as the DCA concentration increases because the responsiveness to DCA treatment saturates , and markers of Wnt signaling . We observed that the tumors exhibit a pronounced spotted pattern of metabolic states where the spots indicate clusters of cells in which their mitochondria are inhibited (by PDK action) and thus where glycolysis was likely to be highly active. This is in contrast to the cells in the regions surrounding the spots. In these regions, mitochondria are more active (not inhibited by PDK) and therefore utilize more oxidative phosphorylation. Although we cannot rule out that the spotted pattern is due to the\u00a0emergence of genetically distinct, clonal populations, the short timescale of the xenografting (14\u201321\u00a0days) and the reproducibility of the pattern in another cell line (SW620) as well as site of injection (subcutaneous and orthotopic within the colon cecum) suggest that what we have observed is a fundamental pattern of tumor heterogeneity that is not genetic in nature, but nongenetic and dynamic .et al, et\u00a0al, et\u00a0al, et\u00a0al, Metabolic patterning had been previously proposed as a mechanism to facilitate transport of glucose into hypoxic regions of tumors . Our model incorporated terms for Wnt as an activator with a short range of diffusion and Wnt inhibitors  with longer ranges of diffusion. The Wnt and Wnt inhibitor equations describe a feedback relationship, and this lies at the crux of a spotted pattern that emerges in our simulations. Our equations also describe activities of metabolic reprogramming through changes in Wnt levels and availability of nutrients and cell substrates. The model describes a mutualistic interaction between the glycolytic and OXPHOS cells because the glycolytic cells induce the delivery of nutrients from blood vessels to mimic the effects of lactate\u2010induced angiogenesis and these nutrients benefit both cell types. More generally, we can also interpret these nutrients as mutually beneficial cell substrates produced by the glycolytic cells. When we considered the effects of symbiosis by explicitly incorporating cross\u2010feeding between glycolytic and OXPHOS cells in a more general model  and an iro model , we founl et\u00a0al,  and heteg cells), a prediction that was validated in our xenograft experiments in which Wnt transcription was partially blocked by the overexpression of dominant negative LEF\u20101. However, the phospho\u2010PDH stains also revealed fewer, but larger regions of PDK activity . To simulate these observations, coefficients of diffusion for Wnt and its secreted inhibitors were increased\u2014parameter changes that resulted in a \u201cspreading out\u201d of Wnt and Wnt inhibitor activity. This model prediction prompted us to investigate whether the expression of proteins known to increase the range of Wnt ligand and Wnt inhibitor diffusion was increased when dnLEF\u2010 or dnTCF\u2010expressing colon cancer cells were developed into xenograft tumors. Consistent with the mathematical model, we observed that the diffusers SPOCK2 and GPC4 were overexpressed in our xenografts but interestingly, not in our 2D in\u00a0vitro culture conditions. The expression of SFRP5, which acts simultaneously as a Wnt inhibitor and diffuser by preventing binding to Frizzled receptors, also shows somewhat higher expression in our Wnt\u2010low xenografts (dnLEF\u20101). It is important to emphasize that it is human\u2010specific oligonucleotide primers that detect these changes in expression of Wnt ligand modifiers. Thus, the implanted human colon cancer cells appear to adapt to interference with Wnt signaling by directly increasing expression of Wnt ligand regulators. Our analysis of primary human colorectal tumors stressed by radiochemotherapy treatment shows that one consequence of therapy could be a similar increase in the distribution of Wnt ligands through upregulated expression of glypicans  and SFRP proteins  agreement with the spotted patterns of activity detected in the tumors. The model also predicted that interference with Wnt signaling is not solely the result of a decrease in overall Wnt activity. Making the simple parameter change of decreasing Wnt signaling throughput leads to overall less glycolytic activity  with a Wnt pathway inhibitor  might be an effective treatment to consider. We validated this prediction using 3D colony growth of SW480 colon cancer cells, which have high, intrinsic Wnt signaling and high levels of glycolytic activity. However, given that primary human colon cancers are more complex with respect to intrinsic Wnt pathway activity and crosstalk with the microenvironment, determining which tumor subtypes will be the most sensitive to this drug combination and how et\u00a0al, et\u00a0al, et\u00a0al, Our mathematical model is an abstract idealization and simplification of tumor proliferation and metabolism, and real tumors are\u00a0much more complex than modeled here. For example, it is likely\u00a0that Wnt and a Wnt inhibitor are not the only factors contributing to the pattern, although it is clear that Wnt has a strong\u00a0influence, since the spots change significantly when Wnt signaling is interfered with. In the et\u00a0al, While we have used a Turing\u2010type model to simulate the spotted pattern, a decision well supported by data, we acknowledge that this type of model is only one possible mechanism to explain the patterning in the tumors. Other alternatives include differential adhesion or cell sorting\u2014a process where cells of different adhesion potential sort away from each other  in the wall of the mouse cecum and observed patterning . In normo) cells and glycolytic (Pg) cells, respectively, are shown in Fig\u00a0I) activity, respectively.The nondimensionalized equations for the rate of change in the population of oxidative , which saturates at high levels of W. The parameters 1/\u03c4o and 1/\u03c4g are proliferation rates and 1/\u03c4go and 1/\u03c4og are switching rates. The last terms in these equations are cell death terms; death is modeled such that it occurs if the nutrient supply N drops below a threshold Nd. The death rates are given by \u03bco and \u03bcg.The first term on the right side of the equality in the PW and \u03c7W\u2217 are switch functions. Each switch function is defined by a modified hyperbolic tangent function, such that if Wnt activity falls below a parameter W*, then the cells utilize a more dominant OXPHOS program, and if Wnt activity is above W*, then cells are more likely to utilize a greater level of glycolysis.The model is designed such that glycolytic and oxidative cells can emphasize, or \u201cswitch\u201d, metabolism programs depending on W, Wnt activity, which is reflected in the third and fourth terms of each equation, where \u03c7Ng\u2217. Cells will die if nutrient is below the parameter Nd. The steepness of the functions can be adjusted so that they are more step\u2010like and hence more sensitive to W and N. Since we use large values for the steepness of the functions, we could alternatively have used piecewise functions for \u03c7N and \u03c7N\u2217.We assume that oxidative cells can switch to utilizing more glycolysis only if sufficient nutrient is present, given by parameter I  activity. DW and DWI are constant diffusion coefficients. It has been shown in epidermal cells that Wnt target genes produce Wnt signals as well as long\u2010range secreted Wnt inhibitors . We assume the Wnt inhibitor is being produced by Wnt activity through both cell types. The terms \u03bcW and \u03bcWI are decay rates. The term SW(Po+Pg) in the Wnt equation\u00a0refers to constitutive Wnt signaling through the cells.The dynamics of dead cells (not shown) is described by a similar reaction\u2013diffusion equation. This is the population of cells that have died from lack of nutrient. These cells can also diffuse and decay. The equations in Fig\u00a0\u03bcNN is a natural decay term. The last term, NS, refers to the nutrient source, which is a small source term applied to\u00a0the entire domain. This source term is based linearly on the glycolytic activity of the cells and is given by NS=NS(\u222bPg)=\u03b3N[1\u2212\u03b1N\u222bPgSxSy+\u03b1N], where \u03b1N and \u03b3N are parameters, \u222bPg is the integral of Pg cells, and Sx and Sy are the lengths of the sides of the spatial domain. This function was chosen so that Ns0=\u03b3N\u03b1N and NsSxSy=\u03b3N (SxSy is the maximum that \u222bPg can reach). We chose to have the nutrient source Ns depend on Pg cells because glycolysis induces angiogenesis , and their propensity to proliferate, die, and switch to the other cell type. Equations were included to account for dead cells, which consists of Po and Pg cells that have died from lack of nutrient, and which can diffuse and decay. Terms for Wnt (W) and Wnt inhibitor (WI) activity were made nonlinear with respect to Wnt, meaning that their rates are proportional to Wnt activity. Nonlinear Wnt activity is dependent on Pg levels, while nonlinear Wnt inhibitor activity is proportional to both Pg and Po levels. A term for constitutive Wnt signaling was included for both cell types as well as decay terms for W and WI. The general nutrient term N can diffuse, decay, and be taken up by the different cell populations. A bulk source was included for the nutrient as well as a Dirichlet boundary condition, both of which are dependent on the average level of glycolytic cells in the domain, a simplified way to incorporate increased angiogenesis driven by glycolysis , terms for each cell type . Initial conditions were set for a random distribution of Pg cells located near the boundary, and small random values of W and WI in the same areas where initial Pg cells are located. A constant high level of nutrient throughout the domain was provided , and the initial condition contained no Po or Pd cells. All parameters are given in Table\u00a0In the numerical results presented here, no\u2010flux boundary conditions were used for all terms except N, which is governed by Dirichlet boundary conditions ; male and female NSG mice, approximately 3\u00a0months old, were used for orthotopic tumors ]. Tumors were removed , fixed in paraformaldehyde overnight, and paraffin\u2010embedded 4\u00a0weeks after injection. All experiments involving animals were approved by the UCI IACUC (Protocol 2002\u20102357\u20104 to R. Edwards).SW480 stable transductants for xenograft or orthotopic injection were prepared through lentiviral infection with pCDH vector from System Biosciences: empty vector (mock), or vector expressing dnLEF\u20101 or dnTCF\u20101, followed by selection with 500\u00a0\u03bcg/ml G418. Transduced cells were collected as a pool for confirmation of expression, and Wnt signaling activity was measured by a SuperTOPFlash luciferase reporter (Pate 2O2 and goat or horse serum plus MOM block reagent (if mouse primary antibody was used on mouse tissue), avidin, and biotin blocking reagents (Vector Labs). Sections were incubated in primary antibodies: antiphospho\u2010PDHpSer293 , anti\u2010\u03b2\u2010catenin , anti\u2010LEF\u20101 , anti\u2010HIF1\u03b1  followed by biotinylated secondary antibodies and visualization using a peroxidase\u2010conjugated avidin\u2010based Vectastain protocol. Slides were then counterstained with hematoxylin and mounted using Permount mounting medium (Fisher). Images were captured using an Olympus FSX100 system and processed in Adobe Photoshop.Deparaffinized 5\u2010 to 6\u2010\u03bcm sections of formalin\u2010fixed paraffin\u2010embedded (FFPE) mouse xenograft tumor and human colorectal carcinoma tissues followed by pressure cooker antigen retrieval in citrate buffer were blocked in 3% HRNA was extracted from xenograft tumors and cells using TRIzol (Invitrogen) following the manufacturer's instructions. cDNA was synthesized with 1\u00a0\u03bcg of total RNA with the High Capacity cDNA Reverse Transcription Kit (Invitrogen), as per the manufacturer's instructions. qPCR was performed in triplicate for each experimental condition using Maxima SYBR Green qPCR Master Mix (Invitrogen), according to the manufacturer's instructions. To normalize mRNA levels, GAPDH probes were used. Primer pairs are as follows: GAPDH forward: TCGACAGTCAGCCGCATCTTCTT, reverse: GCGCCCAATACGACCAAATCC; TINAGL1 forward: ACCAGGTCACTCCTGTCTACC, reverse: GATGCCTCCCTTGTATAGGAAG; CDC42 forward: CCATCGGAATATGTACCGAC, reverse: CTCAGCGGTCGTAATCTGTC; SPOCK2 forward: CCCGGCAATTTCATGGAGG, reverse: GCGGTTCCAGTGCTTGATC; GPC1 forward: GGCTGGTGGCTGCTATGT, reverse: CAGGTTCTCCTCCATCTCGC; GPC2 forward: CACCTGCTGTTCCAGTGAGA, reverse: AGAGAGTGCTGGGCTACTGA; GPC4 forward: GTGGGAAATGTGAACCTGGAA, reverse: CGAGGGACATCTCCGAAGG; DKK4 forward: GGGACACTCTGTGTGAACGA, reverse: TGGTTTTCCTGGACTGGGTG; SFRP5 forward: CTGTACGCGTCATCCTAGCC, reverse: CGGACCAGAAGGGGGTCTAT.A total of 200 trypsinized SW480 cells were mixed with 100\u00a0\u03bcl of 2.5\u00a0mg/ml bovine fibrinogen  in DMEM plus 10% FBS and 1% penicillin\u2013streptomycin\u2013glutamine and 1\u00a0\u03bcl of thrombin (Sigma). The fibrin gels were seeded in 96\u2010well, flat\u2010bottom plates. After the gels solidified, 100\u00a0\u03bcl of DMEM media containing the desired drug treatment was layered on top . Wells were imaged after 14\u00a0days of incubation. Size measurements were taken using Adobe Photoshop. Data were analyzed using Prism (GraphPad).Image processing (overlay of spot contours and convex hulls) was done using built\u2010in functions in MATLAB's Image Processing Toolbox. Briefly, a color channel of an image was converted to a binary image based on a manually chosen threshold dependent on staining intensity. A noise filter was applied to reduce background staining. Thresholds were then chosen to define cutoff values of spot boundaries. Parameters for built\u2010in tools were chosen manually to give the best fit for pattern contours. Details for this\u00a0method are provided in ML and JL conceived the mathematical model; ML and EP coded and ran all simulations; ML, GTC, JL, and MLW wrote the manuscript; MLW and GTC designed the biological experiments; GTC, KW, and RAE performed biological experiments.The authors declare that they have no conflict of interest.AppendixClick here for additional data file.Expanded View Figures PDFClick here for additional data file.Review Process FileClick here for additional data file."}
+{"text": "Chlorella sp. XJ-445 harvesting, which was composed of algal surface modification by combined use of Al3+ and cetyltrimethylammonium bromide (CTAB) and followed dispersed bubble flotation. Dissolved organic matter (DOM) in the medium was firstly characterized and mainly consisted of hydrophilic low molecular weight molecules. The dosage of collector (CTAB) and coagulant (Al3+) were optimized, and with the pretreatment of 40\u2009mg Al3+ and 60\u2009mg CTAB per 1\u2009g dry biomass without pH adjustment, a maximum flotation recovery efficiency of 98.73% can be achieved with the presence of DOM. Algal cells characterization results showed that the combined use of CTAB and Al3+ largely enhanced the algal floc size, and exhibited higher degree of hydrophobicity, which favoured the flotation, and can be interpreted by DLVO  modelling. A benefit in fatty acid conversion was further found with the optimized coagulation\u2013flotation process. It was suggested that this coagulation based flotation is a promising strategy for high-efficiency harvesting of microalgae.This study developed a coagulation\u2013flotation process for microalgae  However, commercial microalgae-based biofuel production is not economically viable yet. Discounting the not inconsiderable costs and difficulties associated with biomass production, the process of harvesting and dewatering has often been cited as one of the major factors preventing a scalable industry [Microalgae as an alternative feedstock for biodiesel production has attracted much attention due to their high lipid content, high photosynthetic efficiency, COindustry . This is\u22121) [3+ and CTAB for oleaginous algal biomass recovery.Typically, the main methods that are researched for microalgal biomass separation are centrifugation, filtration, coagulation/flocculation, gravity sedimentation, flotation or electrical approaches. Centrifugal recovery is the fastest and most reliable method for biomass recovery for a wide range of species, however, the most expensive due to its high energy consumption (about 3000\u2009kWh\u2009t\u22121) , and it \u22121) . Electro\u22121) . Coagula\u22121) ; however\u22121) . For flo\u22121) ,9 instea\u22121) ,11, whic\u22121) . Thus, t3+) to modify the surface properties of algal cells for better flotation with the existence of dissolved organic matter (DOM). The surface characterization and fatty acid profiles of algal cells were monitored to evaluate the coagulation\u2013flotation process and its influence on the final biodiesel production. The coagulation process was also interpreted by DLVO  theory in this study.The aim of this study is to evaluate the harvesting potential of the modified chemical addition using a simple foam flotation device. Initial optimization trials of flotation were conducted using different concentrations of collector (CTAB) and coagulant , algal cells were firstly coagulated with different concentrations of Al3+, and then CTAB was added into the flocs at a given concentration and followed by pH adjustment using 0.1\u2009M NaOH or HCl.Flotation experiments were carried out using a columnar 150\u2009ml flotation cell (45\u2009mm in diameter and 100\u2009mm in height). There is a porous gas diffusor with a nominal pore diameter placing at the column bottom, just above the gas inlet port. Dispersed air bubbles (approx. 700\u2009\u00b5m) were generated from an air blower through the diffusor. The gas pressure leaving the blower was approximately 0.01\u2009MPa and the flow rate to the column was 50\u2009ml\u2009mini and Vi are the initial optical density at 680\u2009nm and the volume of algal suspension . ODa and Va are, respectively, the optical density at 680\u2009nm of the aqueous phase, the volume of the aqueous phase after flotation process.Harvest efficiency (Y) based on optical density measurements were determined to evaluate flotation performances and calculated according to the following equation (2.1) :2.1Y(%)2.3.2.3.1.\u22121, they were centrifugally harvested at 6000g, and the supernatant was collected for DOM analysis. The determination of hydrophilic (HPI) and hydrophobic fractions in DOM was performed following the method described by Malcolm and MacCarthy [\u22121. Concentrations of each fraction were determined by dissolved organic carbon (DOC) measurements .After 7 days cultivation, when the algal cells reached a biomass concentration of about 1.0\u2009g\u2009lacCarthy . BrieflyThe total DOM and DOM fractions were characterized in terms of molecular weight (MW) distribution. Centrifugation  at 4\u00b0C was used to drive the DOM fraction through Amicon Ultra-15 centrifugal filters  of 100, 50, 30, 10, 3\u2009kDa. The MW distribution was also expressed as DOC.2.3.2.The laser diffraction technique was widely used in the measurement of algal floc size ,17. It wAccording to the previous studies, contact angles can better explain the hydrophobicity of the algal cells surface, thus contact angles were measured using the sessile drop technique with water as the reference liquid in this study . Briefly2.3.3GLW) and an electrostatic force (GEL), which is usually repulsive because of overlapping electrical double layers surrounding charged particles. Thus, the total energy of interaction (GTOT) between two particles  can be obtained by the summation of interaction energy, resulting from GLW and the overlap of electrical double layers associated with the charged surfaces GEL. Both GLW and GEL are interpreted as functions of the separation distance (H) between cells [A is the Hamaker constant, which is a strain-dependent parameter. Here, the value is 8.1\u2009\u00d7\u200910\u221221\u2009J for Chlorella sp. XJ-445 [R is the cell radius (approx. 3.57\u2009\u00b5m) [\u03b5 is the dielectric constant of the solution (80\u2009\u00d7\u20098.854\u2009\u00d7\u200910\u221212\u2009C2\u2009J\u22121\u2009m\u22121 for aqueous). \u03c6 and k stand for the cell surface zeta potential and the reciprocal of the Debye length, respectively. k can be obtained by the following equation (2.5) [I is the ionic strength in terms of molarity.The DLVO theory  was firstly developed to relate the stability of colloidal suspensions to the total potential energy between two particles. In the theory, the net interaction energy between particles is interpreted as a balance of attractive Van der Waals force (en cells . Equatioen cells :2.2GTOTon (2.5) :2.5k=3.GLW, is generally negative while the interaction energy resulting from the electrostatic repulsion force, GEL, is positive. According to equations (2.3) and (2.4), GLW decreases with the increasing separation distance between the cells, and GEL is an approximately exponential function of the separation distance with a range of the order of the thickness of the double layer (\u03ba\u22121). Consequently, GLW predominates at small intercellular distance and GEL dominates at intermediate separation distance between cells. Hence, at larger energy barrier, the cell suspension is more stable, and the flocculation is prevented. According to the DLVO model, only the electrostatic double layer force can be significantly modified, and repulsion performance between cells can be greatly affected by changing the ionic strength of the liquors medium or by modifying the surface charge of the cells through pH adjustment or addition of positively charged flocculants [In the classic DLVO theory, the Van der Waals force is responsible for attraction, thus, the corresponding interaction energy, cculants ,22. Thus2.3.4.\u22121 after a 1\u2009min hold time at 50\u00b0C, then with an oven temperature gradient of 170\u2013210\u00b0C at 18\u00b0C\u2009min\u22121 after a 1\u2009min hold. All parameters of the FAME were derived from the calibration curves generated from the FAME standard mix  [Total lipid content of the cells was determined in triplicate by the modified Bligh & Dyer  method uch, USA) .2.4.t-test was performed using SPSS 18.0 package , with values of 0.05 selected as significance.In this study, 3.3.1.a shows the hydrophilic (HPI) and hydrophobic (HPO) properties of DOM of Chlorella sp. XJ-445 at exponential phases. In terms of DOC, HPI fractions dominated the DOM, constituting above 90% of DOM, whereas HPO and transphilic (TPI) only accounted for 3.3% and 3.5% of DOM, respectively. This observation on high proportion of hydrophilic property of DOM was consistent with the results reported previously by other researchers [Figure 1earchers ,27.Figub illustrates the relative molecular weight fractionations of DOM and its HPI, HPO and TPI fractions obtained by centrifugation-driven filtration in terms of DOC. The largest portion of compounds was determined in less than 3\u2009kDa fraction for DOM, followed by 3\u201310\u2009kDa and greater than 100\u2009kDa. For DOM, less than 3\u2009kDa fraction accounted for almost 50% of algogenic organic matter (AOM), while over 70% for its three parts. This fraction represents low-MW intermediate products of metabolism such as aldehydes, hydrocarbons, amino acids as well as mono- and oligosaccharides [Figure 1charides . Moleculcharides . The thicharides ,29. The 3.2.3.2.1.14TAB) to evaluate the feasibility of harvesting Chlorella sp. XJ-445 using flotation. The flotation recovery efficiency of microalgae Chlorella sp. XJ-445 as a function of time under different CTAB concentrations was presented in Most microalgae are negatively charged at nature pH values and show a characteristic of low hydrophobicity, let alone with the hydrophilic DOM in the medium. Thus, to increase the degree of hydrophobicity, the microalgal cells were firstly pretreated using cationic collector tetradecyl trimethylammonium bromide  .3.1Y=YmR2) all above 0.9, suggesting that the flotation process can be satisfactorily modelled by equation (3.1). In addition, the value of b increased with the increasing collector dosage from 20 to 60\u2009mg\u2009g\u22121, however, decreased when further increasing the dosage. It was suggested that the highest flotation rate was found at a concentration of 60\u2009mg\u2009g\u22121 CTAB as collector. Moreover, it was noted that when the concentration of CTAB was over 60\u2009mg\u2009g\u22121 dry biomass, the harvest efficiency increased slowly with the increasing CTAB concentration. Considering the higher expense of CTAB, a concentration of 60\u2009mg\u2009g\u22121 was chosen to combine a cheap coagulant for algal cells recovery in the subsequent experiments.The fitting parameters were listed in 3.2.2.3+) and collector was introduced in this study. Aluminium salt was used because of its effective performance and reasonable price [3+ to pretreat the cells and followed by adding 60\u2009mg\u2009g\u22121 dry weight biomass CTAB as collector. As illustrated in 3+ concentration at a given time, peaked at 40\u2009mg\u2009g\u22121 dry biomass Al3+, and then kept decreasing when further increasing Al3+ concentration. As fitted to equation (3.1), the highest maximum harvest efficiency achieved 98.73% , the interaction between air bubbles and algal flocs was optimized and the highest algal removal achieved.To further enhance the recovery efficiency of algal cells, a composite chemical combining coagulant , and then decreased from 7 to 9. Namely, the harvest efficiency peaked at the nature pH value without any pH adjustment, valued at 98.73% after fitting . The downward trend of surface charge of microalgae cells with increasing CTAB concentration indicated that charge neutralization occurred. In addition, with the combination reaction of Al3+, zeta potential of algal flocs tended to be positive (b). 20\u2009mg\u2009g\u22121 Al3+ addition exhibited a zeta potential of 4.5\u2009mV; however, further increase in Al3+ concentration did not show any significant change. When adjusting the pH value to 5, the net positive zeta potential increased (c). In addition, with increasing pH value, zeta potential of algal flocs decreased and tended to be negative. CTAB is a cationic collector which neutralizes the negative charges of algal cells, and Al3+ further attracted the negatively charged cells, causing them to become destabilized and hence to coagulate, corresponding to figure 5d,e. Accumulative volume of particle size showed that most of the algal flocs (over 80%) were below 10\u2009\u00b5m (figure 5d) with CTAB used alone. It was suggested that the use of CTAB for a microalgae flocculation is limited [To investigate the mechanism for the composite chemicals enhancing the flotation recovery efficiency, experiments for characterization of algal cells in terms of zeta potential, floc size and degree of hydrophobicity were conducted. hlorella . With thght CTAB a. The dopositive b. 20\u2009mg\u2009ncreased c. In add limited , so that3+ addition and showed an accumulative volume of over 80% above 10\u2009\u00b5m, and increased with the increasing Al3+ (e), which was consistent with the previous studies [\u22121 Al3+ showed the best performance with medium floc size and medium iron strength, which favoured flotation. Moreover, even adjusting the pH value, an initial pH without pH adjustment showed the highest floc size and achieved the highest recovery efficiency (f).As expected, the algal floc size sharply increased after Aling Al3+ e, which  studies ,38. The  studies ,29. Howeficiency f.3+/g dry biomass, the addition of 60\u2009mg CTAB/g dry weight biomass and algal cells without any chemicals addition. Previous study by Garg et al. has proved that algal hydrophobicity can be improved by using a cationic collector [et al. also reported that most of CTAB in the suspension was adsorbed onto the cells and modified the surface of algal cells [3+.As for the hydrophobicity, ollector . Coward al cells . Neverthal cells . Moreove3.4.GTOT negative) or repulsive (GTOT positive) as a function of separation distance as depicted in \u221220\u2009J to 131\u2009\u00d7\u200910\u221220\u2009J by only adding 60\u2009mg\u2009g\u22121 dry cell weight biomass CTAB at the separation distance of 5\u2009nm. When combined with 40\u2009mg\u2009g\u22121 Al3+, the total energy further decreased to \u221236.3\u2009\u00d7\u200910\u221220\u2009J. This can be largely attributed to the sharply decreasing electrostatic repulsive forces between cells resulting from the decrease in the zeta potential as presented figure 5b. Thus, according to the DLVO model, the coagulant efficiency of Chlorella sp. XJ-445 was expected to increase from solely adding CTAB to combined adding CTAB and Al3+. Thus, the experimental results were in agreement with the model as shown in figure 5d\u2013f. Therefore, the DLVO theory can be used to interpret the coagulation process using combined CTAB and Al3+.Based on the DLVO theory, the electrostatic double layer surrounding the charged cells is related to the ionic concentration of the bulk solution as shown in equation (2.5). Owing to the fact that interactions between cells are primarily responsible for the coagulation behaviour, it was necessary to calculate the total interaction energy, which helps to predict whether the interaction between cells is attractive . However, the fatty acid composition significantly changed by chemical addition (p\u2009<\u20090.05). These observations were consistent with the previous study by Coward et al. [3+ showed the similar pattern, however, greater degree in changing. The significantly higher content of C16\u2009:\u20090 and C18\u2009:\u20090 after the addition of Al3+ contributed to the total SFA, implying that the significant degree of change was largely attributed to the presence of Al3+. Rwehumbiza et al. [3+ significantly increased (p\u2009<\u20090.05). In terms of biodiesel quality, higher proportions of MUFA and SFA and relatively lower content of PUFA are desirable as they increase cetane number, and also improve the oxidative stability, two of the most important parameters representing the diesel property [The lipid content and mole percentage of prevalent of FAMEs isolated from Caddition . When thd et al. . In addia et al.  also repa et al. . The higproperty . Thus, f4.3+ as coagulant and CTAB as collector was employed for algal surface modification. The floc size and degree of hydrophobicity of algal cells were largely enhanced and a maximum harvesting efficiency of 98.73% was achieved by the sequential dispersed air flotation without any pH adjustment. A better fatty acid composition in relation to biodiesel was further found. It was concluded that a coagulation-assisted flotation can lead to effective separation of microalgae from the dilute medium.Microalga with low surface hydrophobicity and small size as well as hydrophilic DOM in the medium are difficult to harvest by flotation separation. A pretreatment by mixing algal cells with Al"}
+{"text": "Background: Orientation for new medical residents is challenging due to the diversity of prior experiences and cultural backgrounds and is compounded by a lack of orientation curricula that adequately addresses the needs of the medical residents to allow them to perform their duties in an efficient manner from the start. The beginning of residency training is associated with reduced quality of healthcare widely referred to as the \u2018July effect\u2019.Objective: To assess the impact of a peer-led orientation for new interns on (a) self-reported confidence level, (b) improvement in performance of first-year residents in appropriate clinical documentation and efficient discharge procedures and protocols.Design/methods: In June 2016, a hybrid of interactive teaching and simulation exercises was used to teach documentation of critical information, such as discharge medication reconciliation and discharge summary. A handout of an intern guide/manual was also provided. The previous year\u2019s data served as comparison/control data. Comparison data were obtained for both groups from hospital\u2019s utilisation review department.Results: Twenty-one of 23 expected new interns (91%) participated in the intervention. There was a significant decrease in non-compliance for clinical documentation in the intervention group compared to the control group. The self-reported confidence level in the intervention group increased 34%.Conclusions: Such peer-to-peer orientation has the potential to effectively improve appropriate documentation and discharge process by new residents and may help to reduce the \u2018July effect\u2019. It is a major component of medical training, and as such, the habits formed during the residency years of practical training leave a lasting footprint on the way a physician will deliver medical care. This \u2018rite of passage\u2019 for the medical trainee commences in July and transpires for the next few years depending on the choice of specialty training.Orientation for new residents (interns) usually begins a few weeks prior to the start date of training on 1 July . This ma2.We obtained an exemption from standardised informed consent for human research study from our institutional review board (IRB). We secured departmental approval for quality improvement activities as required by our hospital policy. This novel quality improvement (Q.I) effort was planned to involve the incoming Internal medicine (I.M) residents and was scheduled to occur in the last week of June 2016, prior to the commencement of residency training on 1 July. Our methodology was based on the principles of Plan-Do-Study-Act (PDSA) 2.Interactive teaching and simulation exercisesProvision of an intern manual/guide to all participants prepared by graduating first-year residentsSpecific interventions included the following:The duration of the intervention was 3 hours. First, there was an hour-long interactive session regarding an efficient discharge process. The training included discharge medication reconciliation and discharge summary (DS) documentation. The second hour involved teaching appropriate physician documentation and issues regarding compliance with hospital and New York (NY) state public health mandates. Based on our hospital utilisation review mandates and NY state public health law, all newly admitted patients should be screened for HIV, smoking and domestic violence and counselled appropriately, with adequate documentation of screening and counselling .The third hour was dedicated to the simulation of discharge process with discharge summaries and the medication reconciliation process according our electronic medical record system. The new interns were also taught how to conduct proper handoff during a shift change; issues about the dynamics and workflow in various units were also shared including reflections about challenges faced as interns in different units.In addition, at the end of the intervention, an intern manual/guide was provided to all participants, which was prepared by current first-year residents. We provided the participant with an electronic and a hard copy of this manual, which contained valuable information to aid in their daily routine. The use of a resident manual has been shown to be highly beneficial to the smooth transition of new residents in previous similar interventions . The man3.To assess the impact of our intervention on the confidence level of the interns, we provided a pre- and post-intervention survey. The survey included likert-scale type questions regarding the confidence level related to undertaking various designated responsibilities as new interns. Because of the novelty of our intervention, our literature search did not reveal a validated survey used for similar projects in the past, and therefore the survey that was used is not validated.These included electronic discharge summary documentation, knowledge of the unacceptable abbreviations in clinical documentation, and medication reconciliation. To objectively assess the impact of our intervention on the 2016 interns during the transition months of July\u2013September 2016, we used performance of previous year (2015) interns during their transition months as control data. Our comparison of the intervention and control groups was based on two domains; a) clinical documentation (comparing the incidence of unacceptable abbreviations used by both groups during the transition months. b) Comparing the level of hospital utilisation and public health infractions committed by both groups during the transition months .Comparison data were obtained for both groups from our utilisation review department. Our utilisation review department typically compiles weekly deficiencies in documentation and public health mandates. This helped us compare groups effectively, as the same level of staff members was involved in the data gathering for both groups. A total of 274 charts  were randomly selected by the utilisation review department staff and reviewed for non-compliance during the transition month.4.As expected, 21 out of the 23 expected new interns (91%), who were able to start the orientation on time, participated in the intervention. There was no significant difference in the demographic characteristics between both groups compared. Both groups included 100% international medical graduates (IMGs), and the intervention group (IG) included 11 males (52%), the control group (CG) 11 . The average clinical experience of the IG was 4\u00a0years (SD: 1.8) compared to CG . Other demographic information is shown in We found that the new interns who had undergone our intervention showed a) mean increase in self-reported confidence level of 34%  for performance during the transition months regarding overall confidence, discharge summary documentation, efficient discharge process and planning as well as clinical documentation compliance and avoidance of \u2018common do-not-use abbreviation lists\u2019. They also demonstrated an objective reduction in clinical documentation non-compliance rates compared to the previous year\u2019s control group. Total non-compliance recorded over the transition month in the control group was 54.8% versus 34.7% in the intervention group  see . The non5.The \u2018July effect\u2019 results in decreased quality of medical care during the months following commencement of residency training, with direct effects on patient care, patient safety, and hospital reimbursement. One of the reasons identified in the literature is a deficiency in the orientation of new interns ,11. We sThe change in overall confidence level was derived by converting the likert scale survey responses to a numerical score. There was a sizable increase in the confidence level of the new interns post-intervention, based on pre- and post-intervention survey administered. Our results showed that our intervention may have increased new interns\u2019 skills in clinical documentation compared to the previous year\u2019s interns while also boosting their confidence to perform well. We believe a similar intervention can be replicated with appropriate modifications to meet the requirement of other residency programmes in different specialties. If adopted nationwide, we believe it may help to reduce the \u2018July effect\u2019.Generalisability of our intervention was limited by a small sample size. It also involved 100% IMGs which may also limit the generalisability of our result. Variations in the composition of residents and the location of the healthcare center  are factors that may impact the generalisability of our results.6.Our intervention resulted in improvement in clinical documentation and the discharge process while increasing confidence levels of the new interns. More and similar interventions are needed to examine the impact of such peer-to-peer orientation on quality and efficiency of care delivered by new interns."}
+{"text": "Community First Choice is a program within the Affordable Care Act that encourages states to expand Medicaid home and community-based services (HCBS). Specifically, this Medicaid state plan benefit provides states with an additional 6% federal match to promote greater rebalancing of long-term services and supports. Through Community First Choice, states can offer services that assist with activities of daily living, instrumental activities of daily living, and health-related tasks. The program is optional for states, and, to date, eight states have pursued Community First Choice. The purpose of this study is to understand the barriers and facilitators to implementing Community First Choice in two states. Data was collected through semi-structured interviews with individuals involved in HCBS policy nationally and in Maryland and Texas, including government bureaucrats, consumer advocates, and provider representatives. The results suggest that communication with the Centers for Medicare and Medicaid Services, the enhanced federal match, and leveraging existing HCBS infrastructure facilitated implementation. Maryland and Texas encountered challenges implementing Community First Choice because of constraints posed by existing HCBS programs, ambitious timelines, limited staff resources, and insufficient engagement with external stakeholders. The findings suggest that implementing Community First Choice is a large undertaking, and states should ensure they have enough time and sufficient staffing for the implementation process. States should also understand how implementing Community First Choice will impact existing HCBS offerings and how leveraging HCBS infrastructure can facilitate implementation. The lessons from implementing Community First Choice can be informative to other states pursuing or contemplating this program."}
+{"text": "Anatolia was home to some of the earliest farming communities. It has been long debated whether a migration of farming groups introduced agriculture to central Anatolia. Here, we report the first genome-wide data from a 15,000-year-old Anatolian hunter-gatherer and from seven Anatolian and Levantine early farmers. We find high genetic continuity (~80\u201390%) between the hunter-gatherers and early farmers of Anatolia and detect two distinct incoming ancestries: an early Iranian/Caucasus related one and a later one linked to the ancient Levant. Finally, we observe a genetic link between southern Europe and the Near East predating 15,000 years ago. Our results suggest a limited role of human migration in the emergence of agriculture in central Anatolia. Central Anatolia harbored some of the earliest farming societies outside the Fertile Crescent of the Near East. Here, the authors report and analyze genome-wide data from a 15,000-year-old Anatolian hunter-gatherer and from seven Anatolian and Levantine early farmers, and suggest high genetic continuity between the hunter-gatherers and early farmers of Anatolia. Subsequently, it spread across western Eurasia while increasingly replacing local hunting and gathering subsistence practices, reaching central Anatolia by c. 8300\u00a0BCE5. Such mode of spread is often referred to as the demic diffusion model. In contrast, in regions of the Fertile Crescent such as the southern Levant and the Zagros Mountains (located between present-day eastern Iraq and western Iran), the population structure persists throughout the Neolithic transition6, indicating that the hunter-gatherers of these regions locally transitioned to a food-producing subsistence strategy.Recent genetic studies have shown that in mainland Europe, farming was introduced by an expansion of early farmers from Anatolia that replaced much of the local populations3 and thus is a key region in understanding the early spread of farming. While archeological evidence points to cultural continuity in central Anatolia3, due to the lack of genetic data from pre-farming individuals, it remains an open question whether and to what scale the development of the Anatolian Neolithic involved immigrants from earlier farming centers admixing with the local hunter-gatherers.Central Anatolia has some of the earliest evidence of agricultural societies outside the Fertile Crescent7. This deeply branching ancestry often referred to as Basal Eurasian likely diverged from other Eurasians before the latter received Neanderthal gene flow6. Interestingly, a previous study reported that European hunter-gatherers younger than 14,000 years ago tend to show an increased affinity with present-day Near Easterners compared to older European hunter-gatherers8, although how this affinity formed is not well understood.Likewise, pre-farming genetic links between Near-Eastern and European hunter-gatherers are not well understood, partly due to the lack of hunter-gatherer genomes from Anatolia. Genetic studies have suggested that ancient Near-Eastern populations derived a substantial proportion of their ancestry from a common outgroup of European hunter-gatherers and East Asians3, from the site of Boncuklu, Turkey), adding to previously published genomes from this site9, and two Early Neolithic (PPNB) farmers from the southern Levant . These data comprise a genetic record stretching from the Epipaleolithic into the Early Holocene, spanning the advent of agriculture in the region.Here, we report new genome-wide data from eight prehistoric humans Fig.\u00a0, includiWe find that the AHG is genetically distinct from other reported late Pleistocene populations. We reveal that Neolithic Anatolian populations derive a large fraction of their ancestry from the Epipaleolithic Anatolian population, suggesting that farming was adopted locally by the hunter-gatherers of central Anatolia. We also detect distinct genetic interactions between the populations of central Anatolia and earlier farming centers to the east, during the late Pleistocene/early Holocene and describe a genetic link with European hunter-gatherers that predates 15,000 years ago.11, which resulted in human DNA yields lower than 2%  (\u201c1240k capture\u201d)12, which resulted in 129,406 to 917,473 covered SNPs per individual. We estimated low mitochondrial contamination levels for all eight individuals . These three prehistoric Anatolian populations , representing a temporal transect spanning the transition into farming, are positioned along PC1 between Mesolithic western European hunter-gatherers (WHG)12 who are at one extreme of PC1 and Levantine Epipaleolithic Natufians6 who are at the other. Along PC2, ancient Anatolians, WHG, and Natufians have similar coordinates. The newly reported Levantine Neolithic farmers (BAJ001 and KFH2) are positioned near the previously published Levantine Neolithic farmers6  of present-day principal component analysis (PCA)6 Fig.\u00a0. Strikin of preseD-statistics13 of the form D \u2009\u2265\u20094.8\u2009SE (standard error) and D \u2009\u2265\u20099.0\u2009SE  are symmetrically related to multiple outgroups13. By doing so, it tests whether the proposed admixture model is adequate to explain the target gene pool and provides admixture coefficient estimates. We find an adequate two-way admixture model (\u03c72p\u2009=\u20090.158), in which AHG derives around half of his ancestry from a Neolithic Levantine-related gene pool  and the rest from the WHG-related one , the AAF early farmers show a marginal excess affinity with early Holocene populations from Iran or Caucasus and with present-day south Asians, who have also been genetically linked with Iranian/Caucasus ancestry15 , in which AAF derive most of their ancestry (89.7\u2009\u00b1\u20093.9%) from a population related to AHG (Supplementary Tables\u00a0\u03c72p\u2009=\u20090.014). This suggests a long-term genetic stability in central Anatolia over five millennia despite changes in climate and subsistence strategy. The additional Neolithic Iranian-related ancestry (10.3\u2009\u00b1\u20093.9%) presumably diffused into central Anatolia during the final stages of the Pleistocene or early Holocene, most likely via contact through eastern Anatolia. This provides evidence of interactions between eastern and central Anatolia in the Younger Dryas or the first millennium of the Holocene, currently poorly documented archeologically.In turn, AAF are slightly shifted on PC2 compared to AHG, to the direction where ancient and modern Caucasus and Iranian groups are located. Likewise, when compared to AHG by D\u2009\u2265\u20093.8 SE . Likewise, qpAdm modeling suggests that the AAF gene pool still constitutes more than 3/4 of the ancestry of ACF 2000 years later  but not by the Neolithic Iranians   than with older ones (\u201cEarlier European HG\u201d)8. With ancient genomic data available, we could directly compare the genetic affinity of European hunter-gatherers with Near-Eastern hunter-gatherers (AHG and Natufian) using the D-statistic of the form D. We compared the European hunter-gatherers to the 37 thousand-year-old individual Kostenki1417 representing the oldest available European genome with genetic affinity to later European hunter-gatherers   and since Iron Gates HG harbored Near-Eastern-like mitochondrial groups, an affinity with Anatolians beyond the WHG\u2009+\u2009EHG model has been hypothesized18. Accordingly, we find that Iron Gates HG can be modeled as a three-way mixture of Near-Eastern hunter-gatherers (25.8\u2009\u00b1\u20095.0 % AHG or 11.1\u2009\u00b1\u20092.2 % Natufian), WHG  and EHG ;  HG Fig.\u00a0. Since t8, as a tracer for gene flow from the Near East. To estimate the Basal Eurasian ancestry proportion (\u201c\u03b1\u201d), we followed a previously established qpAdm-based approach that uses an African reference (the ancient Ethiopian Mota genome19) as a proxy6 \u2009\u00d7\u2009(\u03b1 in AHG), suggesting that unidirectional gene flow from the Near East to Europe alone may not be sufficient to explain the excess affinity between the Iron Gates HG and the Near-Eastern hunter-gatherers. Thus, it is plausible to assume that prior to 15,000 years ago there was either a bidirectional gene flow between populations ancestral to Southeastern Europeans of the early Holocene and those ancestral to Anatolians of the Late Glacial or a genetic influx from the populations ancestral to Southeastern Europeans into the Near East.To further test the model of Near-Eastern gene flow into the ancestors of Iron Gates HG as an explanation of the extra affinity between them, we utilized the Basal Eurasian ancestry that was widespread in early Holocene and late Pleistocene Near-Eastern populations and their descendants but undetectable in European hunter-gatherersans Fig.\u00a0, consistrce Fig.\u00a0. In cont20. However, Y-haplogroup C1a2 has been reported in some of the earliest\u00a0European hunter-gatherers21. The early farmers belong to common early Neolithic mitochondrial  and Y chromosome types (C and G2a), with the exception of the Levantine BAJ001, which represents the earliest reported individual carrying the mitochondrial N1b group  gene that is primarily responsible for lighter eye color in Europeans22. The derived allele is observed as early as 14,000\u201313,000 years ago in individuals from Italy and the Caucasus23, but had not yet been reported in early farmers or hunter-gatherers from the Near East.We examined alleles related to phenotypic traits in the ancient genomes  show a strong genetic affinity with AHG. Our analysis on their Basal Eurasian ancestry proportions, although limited in resolution, suggests that a Near-Eastern gene flow from AHG into the ancestors of Iron Gates HG may not be sufficient\u00a0to explain this affinity. Two additional scenarios, both involving gene flow from the ancestors of Iron Gates HG to the ancestors of AHG, can help explain the extra affinity between Iron Gates HG and AHG. One assumes a secondary gene flow from Southeastern Europe to Anatolia after the initial formation of the Near-Eastern gene pool as a mixture of the Basal Eurasian and the Villabruna-related gene pools. The other assumes that Iron Gates HG are indeed the most closely related group among European hunter-gatherers to the Villabruna-related ancestry in ancient Near Easterners. Further sampling in Anatolia and Southeastern Europe is needed to specify the spatiotemporal extent of the genetic interactions that we observe.To the west, we observe a genetic link between the Anatolian and European Pleistocene hunter-gatherers, which extends the temporal frame of the previously reported genetic affinity between late Pleistocene Europeans and present-day Near-Eastern populationsWe extracted and prepared DNA for next-generation sequencing in two different dedicated ancient DNA (aDNA) facilities (Liverpool and Jena).10. The extraction included incubation of the bone powder in 1\u2009ml of extraction buffer  at 37\u2009\u00b0C for over a 12\u201316\u2009h. Subsequently, DNA was bound to a silica membrane using a binding buffer containing guanidine hydrochloride and purified in combination with the High Pure Viral Nucleic Acid Large Volume Kit (Roche). DNA was eluted in 100\u2009\u03bcl of TET . One extraction blank was taken along. The extracts were then shipped to Jena, Germany where downstream processing was performed.In Liverpool, UK, sampling and extraction steps for the individuals from P\u0131narba\u015f\u0131 and Boncuklu were carried out in the aDNA labs at the Liverpool John Moores University. The outer layer of the bone was removed using powdered aluminum oxide in a sandblasting instrument. Then, the bone was ultraviolet (UV) irradiated for 10\u2009min on each side and ground into fine powder using a cryogenic grinder Freezer/Mill. DNA was extracted from 100\u2009mg of bone powder following an established protocol24 and DNA was extracted from 76 to 109\u2009mg of the bone powder. An extraction of ~100\u2009mg pulverized bone from the P\u0131narba\u015f\u0131 individual ZBC was done in the Jena facility in addition to the Liverpool extraction . All extractions followed the same protocol as cited for Liverpool. A 20\u2009\u00b5l aliquot from each extract was used to prepare an Illumina double-stranded, double-indexed DNA library following established protocols25. Deaminated cytosines that result from DNA damage were partially removed using uracil-DNA glycosylase and endonuclease VIII, but still retained in terminal read positions as a measure of aDNA authentication26. A negative library control (H2O) was taken along for each experiment. Unique combinations of two indexes (8\u2009bp length each)\u00a0were assigned to each library. The indexes were then attached through a ten-cycle amplification reaction using the Pfu Turbo Cx Hotstart DNA Polymerase (Agilent), the PCR products purified using a Qiagen MinElute kit (Qiagen), and then eluted in TET . Subsequently, indexed libraries were amplified using Herculase II Fusion DNA polymerase, following the manufacturer\u2019s protocol, to a total of 1013 DNA copies per reaction and again purified using a Qiagen MinElute kit (Qiagen) and eluted in TET . Finally, all samples were diluted and pooled (10\u2009nM) for sequencing. The indexed amplified libraries were also used for two previously published downstream in-solution enrichments: a protocol targeting 1,237,207 genome-wide SNPs (\u201c1240k capture\u201d12) and one targeting the entire human mitochondrial genome27.In Jena, Germany, all pre-amplification steps were performed in dedicated aDNA facilities of the Max Planck Institute for the Science of Human History (MPI-SHH). The inner ear part of the petrous bones of the individuals from Kfar HaHoresh and Ba\u2019ja was sampled by drilling28. The targeted SNP panel is a combination of the two separate SNP sets first reported by Haak et al.13 and by Fu et al.28 and further described by Mathieson et al.12. For each of the ~1.2 million target SNPs, we used four distinct 52-bp-long probes: two flanking the target SNP from each side and the other two centered on the SNP matching with the reference and alternative allele, respectively28. The capture was performed following the published protocol described in detail in the SI text sections 3.2\u20133.3 of Fu et al.28 with modified hybridization conditions of 65\u2009\u00b0C for about 24\u2009h.The \u201c1240k capture\u201d is an established in-solution enrichment assay based on hybridization of the indexed libraries to DNA probes29. First, adapter sequences were clipped and reads shorter than 30\u2009bp were discarded using AdapterRemoval (v 2.2.0)30. Adapter-clipped reads were subsequently mapped with the BWA aln/samse programs (v 0.7.12)31 against the UCSC genome browser\u2019s human genome reference hg19 with a lenient stringency parameter (\u201c-n 0.01\u201d). We retained reads with Phred-scaled mapping quality scores \u226520 and \u226530 for the whole genome and the mitochondrial genome, respectively. Duplicate reads were subsequently removed using DeDup v 0.12.229. Pseudo-diploid genotypes were generated for each individual using pileupCaller, which randomly draws a high quality base  mapping to each targeted SNP position (https://github.com/stschiff/sequenceTools). To prevent false SNP calls due to retained DNA damage, two terminal positions in each read were clipped prior to genotyping. The genotyping produced between 129,406 and 917,473 covered targeted SNPs and a mean coverage ranging between 0.16 and 2.9 fold per individual . Sequenced reads were demultiplexed allowing one mismatch in each index and further processed using EAGER (v 1.92.54)18 with a dataset that has been described elsewhere6. This dataset includes 587 published ancient genomes35 and genomes from 2706 individuals, representing world-wide present-day populations36 that were genotyped on the Affymetrix AxiomTM Genome-Wide Human Origins 1 array4 (\u201cHO dataset\u201d) with a total of 597,573 SNP sites in the merged dataset. To minimize bias from differences in analysis pipelines, we re-processed the raw read data deposited for previously published Neolithic Anatolian genomes9 (labeled Tepecik_pub and Boncuklu_pub) in the same way as described for the newly reported individuals.We merged the newly reported ancient data and data reported by Mathieson et al. 201837. Third, we estimated human DNA contamination on the mitochondrial DNA using schmutzi38. Last, we estimated nuclear contamination in males with ANGSD (v 0.910)39, which utilizes haploid X chromosome markers in males by comparing mismatch rates of polymorphic sites and adjacent ones (that are likely to be monomorphic). The genetic sex of the reported individuals was determined by comparing the genomic coverage of X and Y chromosomes normalized by the autosomal average coverage. To avoid bias caused by grouping closely related individuals into a population, we calculated the pairwise mismatch rates of the Boncuklu individuals following a previously reported method40  and three due to low amount of analyzable data ; 42 to perform a maximum-likelihood unsupervised clustering of 3293 ancient and present-day individuals in the HO merged dataset, allowing the number of clusters (k) to range between 2 and 20. Pruning for linkage disequilibrium (LD) was done by randomly removing one SNP from each pair with genotype r2\u2009\u2265\u20090.2, using PLINK (v 1.90)44; (\u2013indep-pairwise 200 25 0.2). The analysis was replicated five times for each k value with random seeds and the highest likelihood replicate is reported .3.042 toD-statistics were computed using the qpDstat program (v 701) of the ADMIXTOOLS package45 (v 4.1) with default parameters. D-statistics provide a robust and sensitive test of gene flow and are preferable for low quantity data analysis  as they are insensitive to post-admixture drift, including artifactual drift due to a limited sample size45. In order to determine whether a test population is symmetrically related to populations X and Y, the D-statistic D  was used. In particular, when comparing the affinity of different European hunter-gatherers to Near-Eastern ones in the D-statistic of the form D , both the central African Mbuti and the Altai Neanderthal (Altai_published.DG) were used to check if the differing level of Neanderthal ancestry in these hunter-gatherers affects the results. Otherwise, Mbuti was used as the single outgroup. The above statistics are reported when more than 30,000 SNP positions were overlapping between the four analyzed populations. To further validate the D-statistics of the form D  beyond the jackknifing performed by qpDstat, we compared the inferred D-statistics based on the population mean to the distribution of the D-statistic when individuals are permutated between populations. We performed the permutation tests in the following settings: (1) for the D-statistics of the form D , we performed all five possible permutations. In each permutation, we placed one out of the five AAF individuals into the second position (AHG*) while placing the other four individuals and the AHG individual into the first position (AAF*)  a total of 1,000 permutations were performed, in addition to the original test, for each of the four \u201ctest\u201d populations that had the most positive values in the original observed statistic . In each test, we randomly chose five out of 30 individuals (5 AAF and 25 ACF) and placed them into the second position (AAF*) while placing the rest into the first position (ACF*). Empirical P-values were calculated by dividing the number of permutations with a D-statistic equal to or greater than the original observation by the total number of permutations .To estimate allele frequency correlations between populations, 13 to test and model admixture proportions in a studied population from potential source populations (reference populations). As the explicit phylogeny is unknown, a diverse set of outgroup populations (Supplementary NotesWe used the qpWave v400) and qpAdm v 632) programs of ADMIXTOOLS programs00 and qp6, which represents a Levantine gene pool outside of modern genetic variation and the European Upper Paleolithic individual Kostenki1417. As a prerequisite for the admixture modeling of the target population, we tested whether the corresponding set of reference populations can be distinguished by the chosen outgroups using qpWave6  that represent a global genetic variation and published ancient populations such as Natufian6 that does not require a proper proxy for the Basal Eurasian ancestry, which is currently not available in unadmixed form. This framework relies on the basal phylogenetic position of both Basal Eurasian and an African reference (the ancient Ethiopian Mota genome19) relative to other non-Africans. Thus, by using a set of outgroups that includes eastern non-African populations  and Upper Paleolithic Eurasian genomes , but neither west Eurasians with detectable basal Eurasian ancestry nor Africans, the mixture proportion computed for Mota (\u03b1) can be used indirectly to estimate the Basal Eurasian mixture proportion of west Eurasian populations.For estimations of Basal Eurasian ancestry, we followed a previously described qpAdm approach38, using its log2fasta program and a quality cutoff of 10. Mitochondrial haplotypes were established by aligning these consensuses to rCRS48 using the online tool haplosearch49. The coverage of each of the reported SNPs was confirmed by visually inspecting the bam pileup in Geneious (v11.0.4)50. The resulting consensus sequences were then analyzed with HaploFind51 and Haplogrep52 to assign mitochondrial haplogroups and double-checked with the rCRS oriented version of Phylotree53.The endogenous mitochondrial consensus sequences were inferred from the output of schmutzi54. Each male individual was genotyped at 13,508 ISOGG consortium SNP positions (strand-ambiguous SNPs were excluded) by randomly drawing a single base mapping to the SNP position, using the same quality filters as for the HO dataset. In addition to the yHaplo automated haplogroup designations, we manually verified the presence of derived alleles supporting the haplogroup assignment.To assign Y-chromosome haplogroups we used yHaplo56, Malaria resistance58, glucose-6-phosphate dehydrogenase deficiency60, and skin pigmentation62. The allele distribution for the SNP positions listed in Supplementary Data\u00a0We tested for the presence of alleles related to biological traits that could be of interest in the geographical and temporal context of the reported ancient populations, including lactase persistence2 in an elemental analyzer. CO2 was converted catalytically to graphite. The dating was performed using the MICADAS-AMS of the Klaus-Tschira-Arch\u00e4ometrie-Zentrum. The resulting 14C ages were normalized to d13C\u2009=\u2009\u221225%63 and calibrated using the dataset INTCAL1364 and the software SwissCal 1.065.The phalanx bone from individual ZBC (Pinarba\u015f\u0131) and the petrous bone from individual KFH2 (Kfar HaHoresh) were each sampled and directly radiocarbon dated at the CEZ Archaeometry gGmbH, Mannheim, Germany (Supplementary Table\u00a0Further information on experimental design is available in the\u00a0Supplementary InformationPeer Review FileReporting SummaryDescription of Additional Supplementary FilesSupplementary Data 1Supplementary Data 2Supplementary Data 3Supplementary Data 4Supplementary Data 5Supplementary Data 6Supplementary Data 7Supplementary Data 8Supplementary Data 9Supplementary Data 10Supplementary Data 11Source Data"}
+{"text": "Metabolism stayed constant during ILP (Glucose consumption: 1.86\u2009mg/min/LTLC (95%CI: \u22122.09 to \u22121.63) | lactate production: 0.005\u2009mmol/min/ LTLC (95%CI: 0.004 to 0.007)). ILP of surgically resected human lobes is a feasible and promising method. By maintaining a near physiological setting, this model may pave the way for future experimental lung research including cancer research, transplantation, physiology, pharmacology and mechanical ventilation.Isolated lung perfusion (ILP) is an ideal model to study treatment effects on a variety of pathologies. As published research mostly relies on rejected donor lungs or animal organs, this study investigates the use of surgically resected human lobes as an alternative and novel model for personalized experimental research. Ten surgically resected lobes were perfused in acellular and normothermic condition. The indication for surgery was lung cancer. Perfusion and ventilation were adapted to the size of the lobes and both functional and metabolic parameters were assessed during ILP. Patients (age 67.5\u2009y (59\u201381)|\u2640n\u2009=\u20093|\u2642n\u2009=\u20097) underwent anatomic pulmonary lobectomy. Ischemic time between arterial ligation and ILP was 226\u2009minutes (161\u2013525). Median duration of ILP was 135 (87\u2013366) minutes. Gas exchange and mechanical respiratory parameters remained steady during ILP (pulmonary venous pO Despite rudimentary perfusion strategies resulting in tissue damage and therefore short perfusion times, researchers early recognized the potential use of ILP within the field of organ preservation and transplantation4. The major clinical breakthrough was made after intense basic and translational research in 2001 with the first successfully transplanted human lung after ex-vivo lung perfusion (=EVLP)5. This has been expanded and EVLP is now widely used to re-assess marginal donor lungs and has been studied as preservation technique for standard donor lungs. However, all clinical applications of isolated organ perfusion are based on the perfusion of either a double lung block or entire single lungs. Less is known about perfusion of isolated lobes and its applicability for research, particularly in an oncologic setting with tumor affected lobes. Thus, we aimed to establish an ex vivo perfusion model of isolated resected human lobes based on perfusion protocols in use for entire lungs which can be used as a research platform for several applications including in-vivo lung perfusion.Lung physiology and therapeutic interventions can ideally be studied on isolated lung models. Historically the first experiments on (out of body) isolated and perfused lungs (isolated lung perfusion\u2009=\u2009ILP) were performed and published only in the seventiesex-vivo lung perfusion (EVLP) protocol was initially developed to assess gas exchange in donor lungs retrieved from organ donors without cardiocirculatory function (donation after circulatory death\u2009=\u2009DCD)7. This method used a novel hyper-oncotic albumin-based perfusion solution (Steen Solution\u00ae), which allowed for the first time a prolonged functional re-evaluation of lungs with unclear or initially insufficient function . After the first successful clinical lung transplantation (LuTX) of such a \u201cre-conditioned\u201d marginal donor lung in 200710, this new approach led to a tremendous worldwide interest. Considering the increasing organ demand and their limited availability, EVLP has been the most recent development with the potential to reducing waiting list mortality. Soon, a new (acellular) perfusion approach was developed in Toronto12, which led to the first published clinical series of 23 EVLPs of initially rejected donor lungs which were successfully transplanted after re-evaluation13. Despite different perfusion approaches (acellular and blood-based), all following reports  described comparable post-operative outcomes between LuTX patients receiving an EVLP lung  and those who received a \u201cstandard\u201d donor lung. Thus, the safety and feasibility of EVLP to increase the donor lung pool available for transplantation by re-evaluating \u201cmarginal\u201d donor lungs could be clearly demonstrated. Those promising results led to two randomized trials on \u201cstandard\u201d lungs23. These showed that the short timeframe between retrieval of a donor lung and its reperfusion within the recipient could be significantly prolonged (>4\u2009hours) without altering organ quality during EVLP. In addition, postoperative results including oxygenation, primary graft dysfunction, intubation time, duration of hospitalization were comparable between perfused lung transplantations and controls. Of note, another advantage of this method was to identify initially unrecognized impairments of the grafts before transplanting them, and thereby to prevent potential risk of the recipients. Different mechanisms and strategies are essential for prolonged EVLP. On the one hand the hyper-oncotic albumin/dextran perfusate reduces the formation of tissue edema leading to reported preservation times of over 12\u2009hours24. On the other hand, a near physiologic setting with regard to perfusion and ventilation allows for recruitment of atelectatic lung tissue and thereby to a reduction of a ventilation perfusion mismatch within the graft8. Also, thrombi and pro-inflammatory cytokines can potentially be flushed out during perfusion25.The first \u201cmodern\u201d in vivo lung perfusion (IVLP) with chemotherapeutic drugs still has to prove its clinical benefit in thoracic oncology, promising future developments of this method can be expected. During such procedure, pulmonary circulation is separated unilaterally and reattached to an extracorporeal circuit without removing the lungs from the patient. In this context, high-dose chemotherapy or immunotherapy can be locally administered to malignant lung diseases, especially lung metastases, without provoking systemic drug-related side effects of the patient. In the first clinical series26, patients with unresectable tumors  underwent IVLP with doxorubicin or cisplatin. During a perfusion time of over 45\u2009minutes a high concentration of the substance was measured within lung tissue whereas the concentration in the systemic circulation remained below the toxicity threshold. None of the patients showed treatment related adverse events however no tumor response was observed. A porcine experiment (n\u2009=\u20096) showed that IVLP with Steen solution can be performed for total duration of four hours without histological or functional damage to the lung27. Those observations could be reproduced with the addition of doxorubicin and Ifosfamide28. So far, dose finding for therapeutic IVLP has been carried in toxicity/efficacy experiments on perfused (porcine and human) lungs and in vitro30.Although 4. In that study, lung lobes were perfused for up to 180\u2009minutes with whole blood and saline, which ultimately led to pronounced lung edema. Importantly, subsequent histologically examination of the tissue showed no interference of ILP on pathohistological grading and staging31. The model was first used to study pharmacokinetics and toxicity of anti-cancer drugs within the lungs32. Although the feasibility of normothermic lung perfusion has been clearly demonstrated on porcine, murine and human lungs33, there is still a lack of highly reproducible and cost- but also resource-effective models. Thus, this study suggests a novel method of normothermic isolated human lobar lung perfusion for future experimental research.To our best knowledge, only one single model of isolated lung perfusion on surgically resected lobes  has been published so farApproval was obtained from the ethics committee of the university of Duisburg-Essen before first patient enrollment (Nr 17-7802-BO). The study was registered on the German register for clinical trials (DRKS00013927).Informed consent form was obtained from all included patients. In detail, patients who were scheduled for lobectomy and who met the inclusion criteria Table\u00a0 were infSurgery was performed according to our clinical routine either via open surgery  or a minimally invasive approach . After retrieval of the pulmonary lobe it was immediately submerged in cold saline. All ligated or stapled vessels were reopened to evacuate blood and possible thrombi. Subsequently the vasculature was flushed both antegrade  and retrograde (via the pulmonary vein) with 1 liter of pH-buffered Perfadex\u00ae solution. At this point the lobes where meticulously inspected for any iatrogenic damages or insufficient cold perfusion. Lobes that were unsuitable for perfusion were directly sent to pathology. For included lobes, bronchi were reopened if they had been closed with a stapler device during surgery and resection margins were cut down if a frozen section was necessary to evaluate surgical-oncological radicality of the resection. Then, all vascular and bronchial stumps were anastomosed on silicone tubing of the same diameter (referred to as cannulas) with running sutures (Prolene 4/0 & 5/0). Separated arteria and veins were reconnected either by anastomoses or by the use of Y-connectors  has been used in this series. The lobes were placed in a commercially available Xvivo\u2122 chamber. The pulmonary vein drained into the main reservoir (Maquet cardiotomy reservoir). From here a centrifugal ECMO pump (Maquet cardiohelp) pumps the perfusate through a build in heat exchanger and a membrane oxygenator (used for de-oxygenation and CO2 addition) before recirculating it through the lungs via the arterial cannulas. Ventilation was achieved with pediatric sized tubings and OR-Ventilators . An additional roller pump (Kamoer Lab UIP) was used to recirculate any perfusate leaking in the chamber. The pressure from the arterial cannula was measured with a button cannula placed within the pulmonary artery and a standard OR pressure transducer .A custom assembled perfusion circuit  by subsequent addition of Bicarbonate or Tris (THAM) to the perfusate.2:1.0, VT:10\u2009ml/kg, frequency: 10\u2009bpm), ventilation settings were not changed during perfusion and FiO2 was set to 0.4. Perfusion and ventilation settings are summarized in Table\u00a0Perfusion and ventilation parameters were calculated according to the size and the weight of the patient as well as the resected lobe. After a short retrograde de-airing of the vasculature, the lobes were slowly warmed up and perfusion flow was gradually increased during the first hour up to a calculated maximum flow . For later analysis, tissue samples were taken and preserved on formaldehyde, before and at the end of ILP. Perfusate samples were collected every 15\u2009minutes during ILP.th Edition 2016).After ILP, specimens were sent to pathology for clinical routine examination and TNM staging . If not stated otherwise data is presented as median and range.From March 2018 to September 2018, 26 patients with suspected  or verified  malignancy of the lungs were screened for eligibility and gave informed consent to this study. Of those, 17 (65.4%) ultimately underwent surgical lobectomy. Finally, 10 of these resected lobes were included in this trial after cold perfusion and visual inspection. The other 7 lobes were not included either due to anatomical  or iatrogenic .Table\u00a0None of the patients had neo-adjuvant chemotherapy or radiotherapy. 6 patients had open surgery (thoracotomy) whereas the other 4 patients were operated by minimally invasive techniques . 2 patients had an extra-anatomical wedge resection to confirm malignancy by frozen section of the specimen, followed by lobectomy. 4 of the perfused lobes were from the right lung  and the remaining six were left lower lobes.Median time between arterial clamping of the lobe within the patient and cold storage was 53 (12\u2013123) minutes (WIT: warm ischemic time). After cool down, the median time until the start of ILP was 189 (47\u2013490) minutes (CIT: cold ischemic time). Total ischemic time (TIT) before ILP was 226 (161\u2013525) minutes. Cannulation was performed after the cold preservation with up to three arterial limbs and a single venous anastomosis in all cases. ILP was continued until no perfusate was left in the venous reservoir (due to extravascular loss and evaporation over the ventilator and the oxygenator). Median duration of ILP was 135 (87\u2013366) minutes.Histopathological evaluation after ILP revealed that 9 out of 10 resected lobes harbored primary lung cancer. Only one case was carnifying pneumonia. Importantly, tumor staging remained unaffected by the preceding ILP. Malignancies were adenocarcinoma (n\u2009=\u20094), squamous cell carcinoma (n\u2009=\u20092), typical lung carcinoid (n\u2009=\u20092) and a neuroendocrine tumor of the lung (n\u2009=\u20091). Patient and perfusion data are summarized in Table\u00a0During ILP and after initiating ventilation, O2 and Co2 partial pressures remained steady over time in both arterial and venous measurements. The observed increase of CO2 in the first 30\u2009minutes of ILP can be explained by the lack of sweep gas over the ECMO membrane during the warm-up phase. Ventilation parameters such as airway pressures and dynamic lung compliance showed no significant changes over time. pH decreased steadily and was buffered with the addition of bicarbonate to a value above 7.0 Table\u00a0; Fig.\u00a02.TLC (95% CI: \u22122.09 to \u22121.63) and a lactate production of 0.005\u2009mmol/min/ LTLC (95% CI: 0.004 to 0.007)  has been initially only used with various degrees of success in physiological and pharmacological experiments33. The limitations are given by high costs , difficult logistics , legal provisions 37 and time dependent ischemic damage of the tissue39. In contrary, all these restraints do not apply for surgically resected lobes as patients scheduled for surgery are asked for consent, their procurement bears no additional cost or risk and the warm ischemic time can be reduced to a minimum, thus preserving tissue vitality. Secondly, there is widespread ethical agreement that the number of animal experiments should be limited to prevent unnecessary animal harm and suffering40. Apart from that, animal experiments are highly expensive. Of note, it can be safely assumed that an isolated human lobe will give more comparability to human preclinical and clinical questions than experiments performed in lung tissue from a different species.The advantages of ILP on resected human lobes over its alternatives are numerous. First, research on cadaveric lungs, either from deceased hospitalized patients or from organ donors (with lungs unsuitable for LuTX) is highly restricted43.Another major advantage is that surgically resected human lobes contain specific and known pathologies. Thereby, malignancies or structural diseases of the lung  as well as surrounding healthy parenchyma can be investigated in a near physiological setting. The isolation of a lung lobe from any other organ system and the possibility to interfere with ventilation, circulation and the composition of the solution allows for reproduceable and precise measurements of functional parameters. Also, biomolecular processes and cell migration (e.g. free-floating cancer cells) could potentially be assessed in detail in future approachesThis pilot study gives the results and observation of our first 10 ILP experiments with resected human lobes. Since the ILP protocol was built upon clinical expertise, the first encountered pitfalls were specific to the surgical technique and not to the perfusion process itself.First, the time between clamping of the arteries and the actual removal of the specimen can vary tremendously. This can be attributed to variations in anatomy, to different surgical approaches (VATS or thoracotomy) and to the individual surgeon experience. The preservation of the lobe by flushing and cooling can only take place after having retrieval from the patient. Thus, warm ischemic damage can only be reduced by shortening this period. Secondly, in minimally invasive surgical approaches (VATS and RATS), the deflated lobe has to be extracted from the chest cavity through a very small incision diligently to keep the fragile lung tissue intact during retrieval.Thirdly, the number of vascular and bronchial stumps as well as their length varies on the technique used to seal and divide them. When using a mechanical stapling device, routinely applied in minimally invasive surgery, the portion of the vessel or bronchi secured with staples (~3\u2009mm) has to be shortened to suture a cannula on. If that suture line happens to be at a vascular intersection or a bronchial carina, those vessels or bronchi have to be anastomosed together, which is technically challenging and can subsequently lead to a perfusion mismatch on a segmental level.Although theoretically all pulmonary lobes can be cannulated for ILP, it is substantially more difficult and time consuming for upper lobes. The multitude of variation in the branching pattern of the main pulmonary artery into their segmental arteries necessitates different approaches to rebuild a common arterial trunk. However, in lower lobes with sufficient stump length, only the common basal artery and proximal to it the superior segmental artery (segment 6) have to be connected together and sutured to the cannula.All these challenges in the preparation process for ILP restricted us to use only 10 out of 17 lobes. The other 7 lobes had to be excluded due to insufficient vascular stumps or obvious tears in the parenchyma.In terms of learning curve, our cannulation technique improved gradually which ultimately led to shorter ischemic periods. In our series, we could even observe that the two lobes with the longest stable perfusion needed only one arterial cannula and had comparable short warm ischemic periods.Presumably, the cumulative ischemia/reperfusion damage undergone by a resected lobe between arterial clamping and ILP will strongly affect the tissue integrity and thereby the possible duration of ILP. Following circumstances have to be mentioned: the first lobe in this series was resected by means of robotic assisted lobectomy (RATS). Only after the beginning of ILP, this lobe was shown to have been traumatized during preparation and during retrieval from the chest cavity which ultimately led to pronounced edema.Because of logistical reasons, another lobe (#8) was subjected to a total ischemic time of 525\u2009minutes during which it completely deflated because of an unrecognized pleural lesion. Consecutively the performance was rather poor with a reduced perfusion time of 88\u2009minutes.In a third case (#9), definitive histology revealed a carnifying pneumonia. Right from the start of ILP, an intraparenchymal broncho-vascular fistula was recognized. Ultimately, the fluid overflow into the airways made ventilation impossible within the first hour of perfusion.44 and in experimental ILP with both acellular and cellular perfusion solution4. Presumably, the edema formation is caused by an altered capillary integrity (as a result of ischemia/reperfusion damage) leading to extravascular shifting of colloids  and thereby fluid. In lobes affected by malignancy or pneumonia it is conceivable that chronic inflammation also contributes to a capillary leak and possibly to the release of inflammatory cytokines. By putting our focus on the technical challenges and the feasibility of the method we regrettably didn\u2019t perform any assessments on tissue permeability. Possible methods to accurately quantify edema formation and alveolar fluid clearance (AFC) would have been to measure wet/dry ratio of tissue samples or to measure albumin shifting across lung compartments. All these hypotheses have to be addressed in future approaches but according to published reports and to our best knowledge, a healthy donor lung with minimal ischemic time and without structural impairments can be safely perfused for a prolonged period exceeding the duration reached in this study45.From a physiological point of view, our experiments were limited by edema formation during ILP. Although all functional parameters remained stable during perfusion, the lungs became progressively edematous and the solution within the circuit decreased steadily until the reservoir run on empty. Neglecting fluid loss via evaporation  this fluid leakage into the parenchyma without imminent functional impairment in the first hours of perfusion has been observed previously in clinical EVLP of whole lungsEven in best possible surgical conditions ischemia/reperfusion injury can never be completely avoided in our model. Nonetheless a learning curve was observed and further improvements in our technique will lead to shorter and less variant ischemic times in future experiments, thus improving comparability between each case.ex vivo testing of treatment approaches in future settings.Despite the above-mentioned challenges, another limitation is given by the relatively small sample number. Having been designed as a pilot trial to future comparative experiments, this series does not allow a statistical correlation between ILP related variables and tumor related clinicopathological parameters. Reasonably, size and the histopathological characteristics might correlate with parameters of metabolism during ILP. Measurements of biomarkers in the tissue, perfusate and exhalate may provide further insights in tumor biology and provide a basis for 4, no disadvantages arose for the patient in performing an ILP on the resected lobe. Intraoperative evaluation of the resection margins as well as histological diagnosis and tumor staging remained unaffected by the procedure. Frozen sections were taken before ILP and the tissue specimen remained vital throughout the experiment.Importantly, as previously postulated48, this series is to our best knowledge the first one to present genuine data on glucose metabolism of isolated perfused lung lobes. The calculated glucose consumption of 1.86\u2009mg/min/LTLC (95% CI: \u22122.09 to \u22121.63) is similar to the one observed in marginal donor lungs \u22122.03\u2009\u00b1\u20091.03\u2009mg/min/LTLCp, substantiating the reliability of the novel approach.Taken together, this series successfully demonstrated that ILP of lung lobes is a feasible approach in which all functional parameters could be precisely assessed and kept steady over time, thereby allowing for unmitigated comparative analyses. Although previously addressed in the context of EVLPIn summary, the innovative technique of isolated lung perfusion on human pulmonary lobes which have been surgically resected due to underlying malignancy allows to mimic physiological conditions in a highly controlled environment for up to 6\u2009hours. By the plethora of possible applications in lung specific experimental research this novel approach has the potential to reduce the need for animal testing and to save up on research resources. Our findings may pave the way for future personalized approaches not only for patients with primary lung cancer but also for patients with pulmonary metastases undergoing resection."}
+{"text": "The effect of the topology of the amorphous phase and phase interconnectivity on the stability of the deformation of semicrystalline polyethylene was investigated. The chain topology was modified by crosslinking the samples with electron beam irradiation. The samples were deformed by plane-strain compression, while the accompanying structural changes were monitored with X-ray and differential scanning calorimetry (DSC). At the true strain around of e = 0.3, the lamellar stacks parallel to the loading direction experienced microbuckling instability, which shortly led to the cooperative kinking of lamellae. Macroscopically, this showed up as the \u2018second yield.\u2019 Buckling is driven by the different stiffness levels of the hard and soft layers and their strong connectivity\u2014for given layer thickness, the critical strain for buckling appeared proportional to the stiffness of the amorphous phase. Above e = 1.0, lamellae fragmentation was observed. This resulted from the localization of crystallographic slip, which was triggered by stress concentrations generated at lamellae faces by taut \u2018stress transmitter\u2019 (ST) chains. Accordingly, the fragmentation was found to be dependent on the surface fraction of STs at the amorphous-crystal interface: a low concentration of STs resulted in fewer but stronger stress concentrations, which led to earlier slip localization, followed quickly by lamellae fragmentation. The observed instabilities, either lamellae kinking or fragmentation, profoundly influenced the deformation process as well as the resultant structure. Both phenomena relieved much of the structural constraints imposed on deforming lamellae and make further strain accommodation easier.  The outstanding mechanical performance of semicrystalline polymers, including their ability for large-scale plastic deformation, can be attributed to their unique morphology, consisting of crystalline and amorphous elements in the form of thin alternating layers. Additionally very important is the specific structure of layers\u2014more or less regularly folded chains in crystalline lamellae vs. highly entangled chains constituting the amorphous phase\u2014and the robust phase interconnectivity, which is provided by numerous chains intersecting the amorphous-crystalline interface and ensuring the extremely strong covalent bonding of adjacent amorphous and crystalline layers. These chains allow for the load transfer between neighboring lamellae across the stack. It is commonly accepted that the performance of semi-crystalline polymers crucially depends on such molecular links, which are called stress transmitters (STs) . TherefoThe deformation of a semicrystalline polymer appears to be a complicated process, involving all elements of their complex morphology. In this process, different micromechanisms are activated at various stages ,2,3,4,5.The main deformation instabilities found in the plastic deformation of semicrystalline polymers are associated primarily with cavitation, the formation of lamellar kinks, and lamellae fragmentation, which often lead to profound changes of the material morphology, as e.g., the transformation of the initial lamellar structure into microfibrillar due to lamellae fragmentation, frequently observed in tension. All of these instabilities are essentially related to the properties of the amorphous phase as well as to its stress response. For example, the lamella stacks respond to the tensile stress perpendicular to the lamella plane, initially with the dilatation of the amorphous layers, which can end up either with cavitation within this layer or with the cooperative bucking of layers, the formation of kinks, and, subsequently, the chevron-like morphology, depending on the properties of the amorphous layer, including its coupling to adjacent lamellae and additionally on the stress field, which can either promote or suppress internal cavitation .While the cavitation, commonly observed in tension, has been studied  = 0.2 g/10 min . The oxidation induction time (OIT) of the resin (determined by means of DSC according to the ISO 11357-6:2018 standard) was much longer than 30 min, which proved the presence of stabilizers, added by the manufacturer to prevent the generation of unstable oxidation species or chain scission during processing. Therefore, no additional stabilization was needed. The polymer used in this study was linear high-density polyethylene (HDPE) provided by Basell  of a weight- and number-average molecular weight 3 plates were compression molded at T = 190 \u00b0C and p = 50 bar. The molded plates were solidified by rapid cooling between two heavy aluminum blocks maintained at the temperature near 0 \u00b0C. All plates were produced according to the same protocol in order to obtain samples of similar structure and morphology. Part of the prepared plates was crosslinked by irradiation with an electron beam. Samples of various crosslink densities were obtained by irradiation with doses of 50, 100 or 200 kGy. The following procedure was used: The samples were packed in vacuum-sealed polyethylene bags and placed on a thermostated aluminum block, with one side exposed to an electron beam produced by the linear accelerator. Irradiation was performed by applying pulses of 6 MeV electrons at a frequency of 20 Hz (the duration of a single pulse: 4 ms). The average dose rate was 5.35 kGy/min, as determined by calorimetry. The required dose was obtained by adjusting the exposition time. In order to prevent an excessive heat generation within the polymer, the irradiation was carried out in steps up to 50 kGy each. Therefore, the irradiation of samples with 50 kGy dose was carried out in a single step, while the samples irradiated up to 100 and 200 kGy required two and four steps, respectively, with intermissions to cool down the samples. Other details are given in Reference , where most crystallites were preferentially oriented with their  ae strain ,33.onsT and maximum of the melting peak\u2014mT) were determined from the thermograms and then plotted in function of the applied strain; the respective plots are presented in c(cX)), presumably again associated with an extensive fragmentation of lamellae. onsT or mT on the applied strain could be approximated by two lines that intersected at e \u2248 1.0, irrespective of irradiation treatment. In the low strain range (e < 1.0) mT and onsT remained practically constant. However, above e = 1, the melting behavior diversified: onsT tended to increase with increasing strain in all samples, while mT varied with the strain depending on the irradiation dose\u2014it tended to increase in the raw sample H-0, remained nearly constant in H-50, and tended to decrease in samples H-100 and H-200 as the strain increases. The melting behavior of raw and deformed samples was investigated by means of DSC. The crystallinity degree and the temperature of melting , a fraction of the medium and thick ones (which would melt near the maximum temperature mT) were also damaged in these crosslinked samples. Such behavior was interpreted previously [The reported changes in melting behavior and crystallinity due to deformation support the view of the damage of the lamellar structure induced by deformation through lamellae fragmentation. This fragmentation was a consequence of an advanced crystallographic slip, which tends to localize at some strain, preferentially in the thinnest parts of lamellae ,31. It imaterial . On the eviously  to be a eviously . The critical strains that can indicate the beginning of various deformation instabilities, estimated from the mechanical, SAXS, WAXS and DSC results reported in this section, are summarized in a/lcl, the dependence of which seemed to be consistent with the general concept that the buckling of layered materials is driven by different stiffness degrees of adjacent layers. At e = 0.6\u20131.0, another significant instability was observed: the fragmentation of crystalline lamellae due to the significant localization of the crystallographic slip. We postulated that the fragmentation was initiated in already highly deformed lamellae by the stress concentrations generated at the amorphous-crystal interface by stress transmitter chains, stretched and taut due to the interlamellar shear in amorphous layers that accompanies the deformation of crystalline lamellae. As a consequence, the critical strain for lamellae fragmentation appeared to depend on the surface fraction of stress transmitters at the interface (SF)\u2014when FS was low, the stress concentrations were fewer but grew stronger than in the system of high FS. This, in turn, could trigger an earlier localization of the slip, quickly leading to lamella break-up. Such instability had a large impact on further deformation of the material and strongly affected its final texture\u2014the massive fragmentation of lamellae significantly reduced structural constraints imposed on deforming material and facilitated the formation of a new ordering of fragmented crystals along the FD.In our recent paper  the defocf.In contrast to the previous work, where the samples demonstrated various degrees of crystallinity and layer thickness but had a similar topology of the amorphous phase, consisting of the network of entangled chains  , the samcf.cf. c(IFD) = 0.2 (in H-0) to 0.28 (in H-200)\u2014cf. The effects of buckling instability were observed in crosslinked samples in the range of low strain, similarly to the non-crosslinked samples studied previously . This inBuckling instability, resulting in the cooperative folding or kinking of layers, was observed in various layered materials in response to the compressive load along the direction of layers or to the tensile load, perpendicular to them. It seems to be a general phenomenon occurring in various materials on remarkably different length scales that can range from the molecular scale  up to the macroscopic scale  . The prea/lcl, and kinks started to develop at a lower strain when a/lcl decreased. In this study, the samples did not markedly differ in thickness of the amorphous and crystalline layers, as well as in degree of crystallinity, i.e., a/lcl and the stiffness of crystalline layers were roughly constant. Instead, they differed significantly in the properties of the amorphous phase, which exhibited increasing stiffness with increasing crosslink density. As reported above, initiation of microbuckling, indicated by the SAXS data, shifted toward higher strains with an increasing irradiation dose (increasing crosslink density). It can be concluded then that lamellae buckling was controlled in this case  by the stiffness of the amorphous phase, which increased with the dose\u2014see c(IFD) on the strain hardening (network) modulus of the amorphous component. The conclusion drawn here agrees with the general prediction that buckling is driven by different stiffness degrees of the layers  [In a recent work , we founickness) . If the ickness) . Another deformation instability that was detected in crosslinked samples at higher strain, around e = 1.0, manifested as curve break points on the dependencies of the SAXS intensity (maximum or average), long period, average crystal size, crystallinity, and melting temperature on strain (see c(cX) \u2248 1.0  \u2248 1.0 a. Crystac) \u2248 1.0 b, suggeshklD  tended to decrease with strain but with a varying rate, which appeared notably higher in the high strain range than in the low strain range (see c(hklD) = 0.9\u20131.0, irrespective of the crystallographic direction. The faster reduction of average crystal size above this critical strain could be considered as another signature of lamellae fragmentation, which appeared to markedly intensify above ec(hklD). This coincided well with the conclusion derived from DSC data, discussed earlier. Regrettably, any deeper analysis of the presented dependencies is problematic due to the noticeable scatter of data points. In particular, it is hard to assess whether the critical strain associated with a reduction of the average crystal size ec(hklD) showed any dependence on the irradiation dose  or did not.Another indication of lamellae damage by extensive fragmentation can be found in the relationship between the average crystal size and strain. The average X-ray coherent crystal sizes ange see . The crocf. c(maxI) = 0.94 to ec(maxI) = 1.04, for H-0 and H-200, respectively. The quickly decreasing intensity in the maxima of the pattern indicated a fast reduction of the population of lamellae stacks that were normally oriented in their current preferred orientation direction. This notion is supported by the results of the average intensity obtained by integration along the azimuth, which also showed a quick decrease of totI at high strain, although for every dose, the critical strain ec(totI) = 0.65\u20130.95 (c(maxI)  cf.. This wac(LP) \u2248 1.0\u2014LP decreases notably faster at e > ec(LP) than below ec. The decrease of LP is associated with advancing plastic deformation by chain slip, which results in an increasing chain tilt in lamella and consequently decreasing lamella thickness, hence decreasing LP. The steeper decrease of LP above ec(LP) could have been a result of an extensive lamellae fragmentation, which seriously relieved the structural constraints that were imposed earlier on deforming lamellae by the initial structure. This makes the further deformation by slip mechanism in survived lamellae fragments easier and faster than in the initial, more constrained structure. Consequently, the thickness of these lamellae, and thus the LP, could decrease at a rate higher than prior to fragmentation.Another cross-over point was found in the curve of the primary long period vs. applied true strain, approximately at eThe next consequence of lamellae fragmentation is the development of a completely new population of thin and short lamellae, preferentially oriented roughly perpendicular to the FD. They were formed by the restructuration of small crystalline blocks that survived the fragmentation of highly deformed initial lamellae . The stac(maxI) and ec(totI) visibly increased with increasing irradiation. Regrettably, other critical strains related to lamellae fragmentation, derived from the SAXS, WAXS and DSC results, though located in the same strain range as ec(totI), did not show such a clear dependence, perhaps due to the small variability and/or insufficient accuracy of estimates. Nevertheless, it seems reasonable to conclude just on the basis of the variation of ec(maxI) and ec(totI) that the instability of deformation, which brought extensive lamellae fragmentation, was correlated with the irradiation dose. On the other hand, that radiation dose determined the number of crosslinks, hence the properties of the amorphous phase, including the molecular network density effN (consisting now of both chain entanglements and crosslinks) and the surface fraction of stress transmitters at the amorphous-crystal interface sF. In this way, a relationship was established between the deformation instability leading to lamellar fragmentation and the parameters describing the amorphous phase, either effN, sF or nG (the network modulus). These parameters were discussed in the previous section and their values are reported in effNand sF is given by Equation (5). Since the thickness of the amorphous layer was practically constant in all samples studied here, the parameters effNand sF became equivalent: sF = const\u00b7effN. In addition, there was a linear dependence of nG on effN: nG = kT\u00b7effN. In sF, a clear linear relationship between ec(totI) or ec(maxI) and sF can be observed. In the previous paper [s.F The following explanation was proposed: stress transmitter chains, when stretched out due to the shear in amorphous layer, which accompanies crystallographic slip, generate stress concentrations at the amorphous-crystal interface. Then, low sFresult in fewer but stronger stress concentrations on the lamella face, which bring the localization of the crystallographic slip and a non-uniform \u2018coarse\u2019 deformation of the lamellae [sF result in smaller stress concentrations and thus a more homogeneous distribution of the stress on the lamella face, which promotes a more uniform, \u2018homogeneous\u2019 slip in crystalline lamellae and thus delays their fragmentation  to a larger strain. The data presented in The critical strains eus paper , we alsolamellae . ConsequThe deformation study of linear polyethylene, crosslinked in the amorphous phase by electron beam irradiation and then highly deformed in compression, revealed several instabilities that accompany the plastic deformation process, occurring at various strains. These instabilities result in lamellae fragmentation and/or reorientation, which apparently enables the easier accommodation of the strain in an energy-minimizing way by opening new paths of relatively easy plastic deformation of the lamellar crystals. This prevents or delays excessive stress build-up due to high network stress generated in the amorphous phase and thus facilitates the further deformation of a polymer without its premature damage. The instabilities leading to lamellae fragmentation can have different origins and intensities that depend on the material structure\u2014in both amorphous and crystalline phases and phase connectivity\u2014as well as on the deformation conditions. One of the deformation instabilities studied in this paper is the microbuckling of lamellae and interlamellar amorphous layers that sets in at the true strain around 0.3 and results in their joint and cooperative bending that quickly leads to joint folds or kinks of lamellae. Kinking contributes to some fragmentation of lamellae, although limited to kink tips. What is important, however, is microbuckling followed by kinking induces a rapid and irreversible rotation of lamellae stacks, as well as the collapse of the stiff lamellar frame of the initial structure. This, in turn, allows for the activation and then the continuous operation of conventional mechanisms, like crystallographic slip, in these just reoriented lamellae. This transition frequently macroscopically manifests in the stress\u2013strain curve in the form of low and broad local maximum, commonly reported as the second yield. Experimental evidence has shown that microbuckling is driven by a big difference in the stiffness of the soft (amorphous) and hard  layers\u2014in irradiated samples, in which the thickness of layers and elastic properties of the crystalline phase remain constant, the critical strain for buckling initiation depends linearly on the amorphous phase modulus. As found in the previous study , when thsF, similarly to non-crosslinked samples studied previously [sF, which is related to either increasing entanglement density or additional chemical crosslinking.The second important instability of deformation studied here is the fragmentation of lamellae, initiated when the deformation of lamellae by crystallographic slip is already well advanced and stress concentrations develop at their faces due to stretched stress transmitter chains. This transformation occurs in polyethylene, also crosslinked, around a true strain of 1.0. The extensive lamellae fragmentation that relieves the deforming crystallites from constraints  not only facilitates further deformation of survived lamellae or smaller crystallites but also can deeply transform  the morphology of the material into a new ordering along the flow direction, as, e.g., the transformation of a lamellar morphology into a microfibrillar one, frequently observed upon tensile deformation. The lamellae fragmentation in crosslinked PE was found to depend on the surface fraction of stress transmitters at the amorphous-crystal interface eviously \u2014fragment"}
+{"text": "Giant Juncao is often used as feed for livestock because of its huge biomass. However, drought stress reduces forage production by affecting the normal growth and development of plants. Therefore, investigating the molecular mechanisms of drought tolerance will provide important information for the improvement of drought tolerance in this grass.A total of 144.96 Gb of clean data was generated and assembled into 144,806 transcripts and 93,907 unigenes. After 7 and 14\u2009days of drought stress, a total of 16,726 and 46,492 differentially expressed genes (DEGs) were observed, respectively. Compared with normal irrigation, 16,247, 23,503, and 11,598 DEGs were observed in 1, 5, and 9\u2009days following rehydration, respectively. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analyses revealed abiotic stress-responsive genes and pathways related to catalytic activity, methyltransferase activity, transferase activity, and superoxide metabolic process. We also identified transcription factors belonging to several families, including basic helix-loop-helix (bHLH), WRKY, NAM , ATAF1/2 and CUC2 (cup-shaped cotyledon) (NAC), fatty acyl-CoA reductase (FAR1), B3, myeloblastosis (MYB)-related, and basic leucine zipper (bZIP) families, which are important drought-rehydration-responsive proteins. Weighted gene co-expression network analysis was also used to analyze the RNA-seq data to predict the interrelationship between genes. Twenty modules were obtained, and four of these modules may be involved in photosynthesis and plant hormone signal transduction that respond to drought and rehydration conditions.Our research is the first to provide a more comprehensive understanding of DEGs involved in drought stress at the transcriptome level in Giant Juncao with different drought and recovery conditions. These results may reveal insights into the molecular mechanisms of drought tolerance in Giant Juncao and provide diverse genetic resources involved in drought tolerance research.The online version contains supplementary material available at 10.1186/s12870-020-02785-7. Drought stress is one of the most threatening environmental constraints that adversely affect plant growth and yield . HoweverDhn), which are among the most frequently observed proteins in plants, protect the cells from water deficit. Additionally, a large number of genes change their expression through the regulation of transcription factors (TFs)  4AP (c103687_g1_i3) were upregulated at D1, D2, and R1 but disappeared at R2 and R3 , 181 bHLH were used for hierarchical clustering analysis in water deficit and rehydration conditions Fig. b. These To validate the accuracy of TF sequencing, the relative expression level of two randomly selected bHLH was examined using quantitative RT-PCR analysis Fig. e and f. The gene co-expression profiles of Giant Juncao in response to water deficit and rehydration conditions were analyzed by using WGCNA to detect the relationship between genes and physiological indexes, as well as inter- or intramodular genes. Twenty co-expression modules and correlation coefficients were identified and obtained Fig.\u00a0. The phyThe genes related to the physiological indexes of Giant Juncao were mainly concentrated in the turquoise, darkorange2, skyblue, and white modules. Therefore, the genes with a higher weight in each module were selected for analysis and for drawing the network. The genes, including c118251_g1_i1, c118890_g1_i6, c103721_g1_i1, and c120227_g1_i6, which encoded \u03b2-glucosidase, peptide/histidine transporter, LOC103649875, and \u03b1/\u03b2 hydrolase, respectively, had the highest degree in four modules  and de novo transcriptome analysis  were useTaxus species were annotated in the KEGG and GO database, respectively [Due to the lack of genomic and transcriptome data, the genetic background and functional genes of Giant Juncao are not completely clear. Therefore, a large number of unigenes have not been annotated, and only 61.7% of the total unigenes were annotated in at least one database. This is different to the annotation results of transcriptome sequencing of reported species, such as common vetch, which has approximately 500 million clean reads employed to assemble 174,636 transcripts and 83.48% unigenes annotated in at least one database . In the ectively . This in4 plant photosynthesis multifunctional enzyme, which can be used to transfer into plants to improve photosynthetic efficiency, and becomes an important way to improve crop yield [2 into the mesophyll cell. CpFBA is one of the key enzymes controlling the rate of photosynthesis by improving carbon fixation efficiency in the Calvin cycle to enhance the resistance of plants [Sesuvium portulacastrum under salt and drought stress [Through the analysis of transcriptome data, some genes in the photosynthetic pathway showed difference in abundance, which may cause the photosynthetic indices in Giant Juncao to change after no irrigation and rehydration Fig. b. At theop yield \u201335. Undeop yield . In our f plants , 37. It t stress  and maint stress , 40. In However, at the beginning of re-watering, Pn, Tr, and WUE significantly increased, whereas Gs remained stable. Meanwhile, the expression of genes was downregulated Fig. . This fiGiant Juncao improved its adaptability to cope with drought environment by regulating the ability of antioxidants and the quantity of osmoregulation substances. In this study, SOD, POD, and PRO initially increased under drought stress and then decreased Fig. b. After Plant hormones not only widely participate in the various growth and development stages of plants but also play an important role in regulating plant growth to adapt to various kinds of biological or abiotic stress. In our research, ABF2, ATP binding protein, TPA: SAUR 56-auxin-responsive SAUR family member, and type-A response regulator ARR1 l showed opposite expression under drought and recovery processes  can provide drought tolerance as a jasmonate signaling module component [TabHLH39 genes enhances drought resistance, salt tolerance, and frost resistance in transgenic Arabidopsis [The bHLH family is one of the largest TFs in plants and play critical roles in light signaling, hormone signaling, wound, and drought stress response . For exabidopsis , 230 membidopsis , 146 memstachyon , and 175stachyon  that havstachyon . In addiomponent . Howeverbidopsis . In our For the cluster analysis, we divided bHLH into 5 categories and 8 subcategories, and the genes in each subcluster showed similar expression trends  and well irrigated. One month later, plants with consistent (seven leaves) and healthy growth were selected for drought experiment.Drought stress was imposed on the plants by stopping irrigation. Seedlings were sampled by collecting their third and fourth leaves at day 0 for control and at days 7 and 14 (D1 and D2) during drought. After 14\u2009days of drought stress, the seedlings were watered to field capacity, and leaf tissue was collected after 1, 5, and 9\u2009days  following re-watering. To eliminate the influence of the development process on the test results, a unified end time of the experiment was set, and the sampling was unified. Four independent biological replicates were collected for ecological and physiological tests and three replicates were used for RNA-Seq analysis. The tissues were collected immediately into liquid nitrogen and stored at \u2212\u200980\u2009\u00b0C until used.2 concentration in the reference leaf chamber was controlled at a constant value of 390\u2009\u03bcmol\u00b7mol\u2212\u20091, and the photosynthetically active radiation and air relative humidity were set to 1200\u2009\u03bcmol\u2009m\u2212\u20092\u2009s\u2212\u20091 and 75%, respectively. The experimental apparatus automatically recorded the net photosynthetic rate , transpiration rate , and stomatal conductance . Meanwhile, a formula was used to calculated the water use efficiency (WUE) as follows: WUE\u2009=\u2009Pn/Tr, mmol mol\u2212\u20091. The physiological indices, including superoxide dismutase (SOD), peroxidase (POD) activity, and malondialdehyde (MDA) and proline (PRO) contents, were determined in accordance with a previously reported method [In this study, a CIRAS-3 portable photosynthetic apparatus  was used to observe the photosynthetic parameters of the seedlings. The COd method , 66.High quality total RNA was isolated and extracted from the Giant Juncao seedling using the TRIzol reagent  according to the product instructions. RNA purity and concentration were tested using a NanoDrop 1000 spectrophotometer . The integrity of RNA molecules was measured using an Agilent Bioanalyzer 2100 system . Total RNA quality was detected using 1% agarose gels.The RNA-seq library was constructed with Illumina\u2019s TruSeq RNA Sample Preparation Kit  according to the product instruction. mRNA connected with poly-T oligo-attached magnetic beads was purified from total RNA, and divalent cations were used to conduct fragmentation under high temperatures in NEBNext First Strand Synthesis Reaction Buffer (5\u00d7). Random hexamer primers and M-MuLV Reverse Transcriptase (RNase H-) were used for first-strand cDNAs from the reverse transcribed fragmented mRNA. Then, the DNA Polymerase I and RNase H  were used to synthesize the second-strand cDNAs. The remaining moleculars were converted into blunt ends by exonuclease/polymerase activities. After purification with the AMPure XP system , the cDNA fragments were resolved in elution buffer for end reparation and addition of a poly(A) tail and then connected to sequencing adaptors with suitable length fragments. Libraries were sequenced on an Illumina HiSeq 4000 platform to generate paired-end reads of 150\u2009bp.http://www.bioinformatics.org/cd-hit/) with 95% global sequence identity was used to obtain unigenes by clustering the sequences of the de novo assembled transcriptome to remove any redundancy.Initial processing of original data in FASTQ file was achieved. Bowtie 2 was used to filter out rRNA . Then, t\u2212\u20095 against the NCBI non-redundant protein sequences database (Nr), Swiss-Prot protein database, and eukaryotic Cluster of Orthologous Groups of proteins (KOG) database [For functional annotation, the assembled unigenes were analyzed by BLAST to by using the Nucleotide database (Nt) with 10\u20135 E-value threshold . The unidatabase . The seadatabase . The KOBp-values of edgeR package analyses were adjusted via Benjamini-Hochberg\u2019s method to determine the false discovery rate (FDR) and identify DEGs [p-value obtained from the test was corrected to get the q-value. The standard of differential gene expression screening is |log2(FoldChange)|\u2009>\u20091 and q-value <\u20090.05.Gene expression quantification was performed using the Bowtie aligner and expectation\u2013maximization method (RSEM) to obtain the number of read counts via the Perl script align_and_estimate_abundance.pl with \u2013est_method RSEM from the Trinity protocol , 72. Theify DEGs . Then, tp- value was less than 0.05. The various metabolic pathways of DEGs were analyzed by using the KEGG database. The statistical enrichment of DEGs was tested using the KOBAS 2.0 web server and the corrected p-value <\u20090.05 was considered to be significantly enriched in KEGG [To study the biological significance of DEGs, the GO database was employed to exhibit GO enrichment analysis of DEGs during the different treatments of Giant Juncao using the GOseq (v1.22) software . Paramet in KEGG .http://planttfdb.cbi.pku.edu.cn/), and the threshold was set as 1\u2009\u00d7\u2009e\u2212\u20095.All identified DEGs were blasted with PlantTFDB (Plant Transcription Factor Database) 4.0  . Pearson-\u2206\u2206CT method was used to calculate the relative expression levels of genes.To validate the accuracy of the RNA-seq results, quantitative RT-PCR analysis was conducted on a CFX Connect qPCR detection system. Two bHLH transcription factors were randomly selected, and PgACT gene was used as a reference gene (the primers are shown in Table P\u2009<\u20090.05).Statistical analysis of physiological data was conducted using SPSS20.0 . The significance of differences among every treatment was tested by one-way ANOVA and Duncan\u2019s multiple comparative analysis  value of hub genes under different treatments in the four modules."}
+{"text": "Immune function, height and resource accumulation comprise important life history traits in humans. Resource availability models arising from life history theory suggest that socioeconomic conditions influence immune function, growth and health status. In this study, we tested whether there are associations between family income during ontogeny, adult height, cortisol level and immune response in women. A hepatitis B vaccine was administered to 66 young Latvian women from different socioeconomic backgrounds, and blood samples were then collected to measure the level of antibodies that the women produced in response to the vaccination. Cortisol levels were measured from plasma samples pre- and post-vaccination. Women from wealthier families had lower cortisol levels, and women from the highest family income group had the highest levels of antibody titers against hepatitis B vaccine. No significant relationships were observed between cortisol level and immune function, nor between family income and height. The results show that income level during ontogeny is associated with the strength of immune response and with psychoneuroendocrine pathways underlying stress perception in early adulthood. The findings indicate that the quality of the developmental niche is associated with the condition-dependent expression of immune function and stress response. Scarcity of bioenergetic resources restrains the development of central life history functions such as somatic growth, immune function, reproduction and socioeconomic development10. It has been shown that growing up in poverty causes developmental stress11 and that exposure to poverty is\u00a0linked with premature aging12. Resource availability is therefore an important dimension in life history models of human evolution and development10.Life history theory focuses on how organisms allocate finite resources to maximize their evolutionary fitness, with the ultimate goal of passing their genes to the next generation. Life history theory is predicated on the idea that the principal functions of organismal growth, survival and reproduction require sufficient resources, parceled out from the finite energy that each organism can extract from its environment15, but they also predict viability in adulthood16. Krams et al.9 have recently studied associations between socioeconomic status (SES), height and antibody titers against hepatitis B antigen (a measure of strength of immune response) in young Latvian men. The findings showed positive correlations between height and antibody response. The relationship between height and strength of immune response was indirect, and both variables were associated with family income9. The findings highlight the importance of childhood environment and nutrition to ensure that young people make the best possible start in life with regard to somatic and immunological development9.Each life stage brings a distinct set of adaptive challenges: responses to these challenges affect organismal development and function not only in childhood or adolescence13. Developmental niche construction recognizes the importance of environmental parameters in modifying the life cycle and in shaping the development of plastic phenotypes17. According to resource availability models based on life history theory, a high-quality environment can reduce somatic maintenance costs inasmuch as such an environment imposes fewer threats to the immune system; this, in turn, can lead to increased growth rates and earlier reproduction5. In contrast, worse socioeconomic conditions (particularly in Africa) are associated with declines in women\u2019s height4. The correlation between wealth and height was positive (95% CI 0.05\u20131.16) in 96% of 54 countries observed4. Morisaki and colleagues note that better environmental and social conditions, e.g. nutrition and sanitation, are the reasons for increases in average adult height in the majority of European and Asian countries over the last century18. However, recent trends in reduced average adult height in both sexes in Japan have been linked with an\u00a0increase in low birth weight prevalence because of undernutrition, infection and social factors such as increased competition18.Individual differences in family income, height and immune function can be conceptualized using a combination of developmental niche construction and life history theory22. Phenotypic characteristics such as body size25, physical strength27, appearance28 and immune defense29 all show significant sex differences in humans. These differences are influenced by genetics31, but also by socioeconomic and environmental factors33. Because of its whole-organism focus on resource allocations and phenotypic plasticity guided by environmental conditions, life history theory has substantial utility for explaining these sex differences and the adaptive processes underlying them35.Sexual dimorphism and/or sex differences occur in various traits and life history strategies that comprise important components of fitness36, and that the availability of bioenergetic resources can restrict the development of life history traits37. The findings also suggest that trait development might be at least moderately sex-specific. Georgiev and colleagues, for instance, detected that women appeared immunologically more sensitive to pathogen exposure early in life than men6. Exposure to early life psychosocial stress can perturb the development of hypothalamic\u2013pituitary\u2013adrenal (HPA) and hypothalamic\u2013pituitary\u2013gonadal (HPG) coupling, resulting in early sexual maturation and early reproduction in females15. Women made a higher relative investment toward innate immunity, not acquired immunity6. Stoehr and Kokko explained women\u2019s greater investment in immune function as an investment in longevity3. The sex that makes a higher investment in survival and longevity\u2014typically females\u2014will have superior immune defenses, a prediction supported by many studies42.Recent empirical findings support some of the main hypotheses arising from life history theory, namely that competing functions and processes cause bioenergetic trade-offs between life history traits21. In this study, we therefore sought to evaluate whether recent findings on the relationships between men\u2019s socioeconomic background, height and immune function replicate in women9. We reanalyzed a part of the data sets from Krams et al.43 and Skrinda et al.44 and added data that have not been used before. We predicted that young women with taller stature and stronger immune response grew up in families that had higher income. We predicted negative correlations between family income and cortisol levels, and between cortisol levels and antibody titers  by using Omron Body Composition Monitor BF500. None of the participants was obese: body mass index (BMI) of 56 young women fell within the normal BMI range (18.5\u201324.9 25) while 10 participants were overweight (BMI between 25 and 30).We studied associations between socioeconomic status, cortisol levels, height and antibody titers against hepatitis B antigen in 66 young Latvian women  . This method of fertility estimation is based on the assumption that the luteal phase lasts 14\u00a0days and that the fertile phase does not exceed 6 days\u22121 of anti-HBs  .Frequency distribution of immune response of young women was right-skewed , with 39 of 63 62%) women having 0 mIU ml% women hrs\u2009=\u20090.05, P\u2009=\u20090.69). There was a weak, non-significant linear  and a marginally non-significant non-linear  relationship between height and antibody titers  or non-linear  relationship between cortisol level and antibody titers.A negative correlation was found between family\u00a0income and cortisol level . The strength of immune response was not associated with BMI, total fat nor visceral fat  in either sex. When testing for the simultaneous association between young men\u2019s immune response, height and family income in ontogeny, the relationship between height and antibody levels was indirect and both were associated with family income9.The current results are consistent with Krams et al.\u22121 of anti-HBs may explain the lack of significant relationships between antibody response, height, BMI, total fat and visceral fat. The standard hepatitis B immunization protocol includes three vaccinations at months 0, 1 and 6. Previous research has shown a nearly exponential increase of anti-HBs levels towards the final vaccination event51. Interestingly, while some studies showed a negative association between stress\u00a0and the strength of immune response50, another study failed to find a significant effect of stress on the levels of anti-HBs51. Unfortunately, these studies\u00a0did not report the number of participants showing no antibody response because only participants with a detectable antibody level were included in the analyses or all participants with antibody levels below 10\u00a0IU/l were classified as non-responders51. This makes direct comparisons between the current study and previous studies impossible. Petri et al.49 reported a positive association between levels of psychosocial stressors and antibody response to hepatitis B vaccine. They note that all kinds of stress are equally detrimental to immune function and that a certain level of stress has the potential to mobilize the immune function. Petri et al.49 also pointed out that factors determining antibody formation and vaccine efficacy are not necessarily the same.It is important to note that the large number of participants having 0 mIU ml52. Poor environmental conditions affect the response to vaccinations, being weaker in African and Asian populations in developing countries than in populations from developed countries53. Studies on adolescents and adults55 showed that infections  affect responses to vaccines56 by reducing immune response. Blackwell and colleagues suggested that infection with helminths could impose hidden costs associated with immunological changes, and that such costs may affect somatic growth and other life history parameters57. Exposure to environmental toxicants during ontogeny directly or indirectly influences immune system and lung development, inducing adaptive responses in the immune and lung systems58. Importantly, the prevalence of soil-transmitted helminth infections is higher in communities with low household income60. Parasitic diseases, termed \u2018neglected infections of poverty\u2019, were shown to be widespread and associated with income level in Eastern Europe a decade ago61.Prior research has explored the influence of environmental and psychosocial stressors on growth and immune system in both human and nonhuman species62. Another study on several inflammation- and stress-related genes also found that low socioeconomic status is associated with higher levels of DNA methylation63. These findings indicate a role for epigenetic mechanisms in associations between socioeconomic conditions during childhood and adolescence and the development of immune phenotypes later in life. However, many other mechanisms and processes can be responsible for links between socioeconomic conditions during growth and the development of immunity64, and they need to be considered in future research.While socioeconomic status is recognized as an important predictor of health condition, the underlying molecular mechanisms linking low SES to poorer health outcomes are far from being understood. However, a recent genome-wide study showed that DNA methylation of a number of genes associated with immune function, cell communication and neurogenesis is higher in individuals with lower socioeconomic status18, the current Latvian sample of women did not show similar associations between SES and height as found in other countries. One possible reason for this null finding can be the relatively decent national socioeconomic and psychosocial conditions during the study period. Importantly, while a positive relationship between height and socioeconomic conditions was reported in young Latvian males9, the current study was done two years later, which might have had a positive influence on the developmental conditions of the participants of this study because of improving national socioeconomic conditions, thus attenuating income-driven variation in height. Another reason for this sex difference might be that males appear to be more sensitive than women to developmental perturbations on growth65. Male height is a sexually selected trait, and it is thus possible that the development and expression of male height are condition-dependent66 in a similar way as with many other sexually selected traits67, therefore being more sensitive to resource availability than female height.Although socioeconomic factors influence height in women16.Despite null findings between family income and women\u2019s height, family income was associated with the strength of immune response also in women, but only at the highest income levels. This suggests the existence of an important relationship between income and immunity. However, our results need to be interpreted with caution because of the low number of participants in the highest family income category. To study variation in immune function more accurately, future studies may benefit from using larger data sets and a broader set of immune function parameters, as well as from analyzing how other factors such as nutrition, illnesses and/or psychosocial stress influence the strength of immune response70. This finding can partially explain the association between lower socioeconomic status and adverse health outcomes, pointing to the role of psychoneuroendocrine pathways underlying stress perception and possible consequences of financial disadvantage for general health75. This interpretation is consistent with many studies that indicate a negative effect of high stress and cortisol on health, causing cardiovascular diseases78, acute myocardial infarction72 and type 2 diabetes73 as well as predicting cancer survival83. Overall, a well-regulated cortisol stress response is an essential component of adaptive cognitive, emotional and behavioral responses to stress, which in turn influence long-term health outcomes87. A possible limitation of the current study was that cortisol was measured only within a narrow time period in a single day. Cortisol can substantially fluctuate during the day, and such fluctuations were not measured in this study. As cortisol levels may also fluctuate in response to transient stressors, cortisol measurements spread over longer periods of time or cortisol measurements taken from hair samples would be needed to more accurately assess chronic stress89.This study showed a negative correlation between income and cortisol level, consistent with prior research9 found a positive correlation between family income and the strength of immune response in young men across different income groups, women\u2019s immunity was better only in the highest income group. The possible cause of different immune function findings in men9 and women may be explained by more active innate immunity function in women90. Women\u2019s immune system is more sensitive to early-life pathogen exposure compared with men6. Women also make greater relative investments toward innate, not acquired, immunity6. This process can be supported by the presence of estrogen receptors on most innate immune cells91, suppressing cytotoxicity natural killer cells92, increasing anti-inflammatory properties and decreasing the chemotactic activity of neutrophils93. It has been shown in birds that individuals with high innate immune response mount weaker antibody responses under stressful conditions, which suggests a competitive cross-regulation between the innate and the acquired branches of the immune system95. Interactions between the innate and the acquired immune systems have been blamed in maintaining the pathogenesis of metabolic diseases95. It is known that acquired immunity imposes high bioenergetic costs especially early in life97. The overall metabolic costs of the activation of adaptive immunity in its acute phase are substantial in humans99. Favorable conditions such as nutritional abundance, low mortality risk and high early-life socioeconomic status support the development of acquired immunity and high antibody response103. Under suboptimal developmental conditions, in contrast, it is to be expected that women invest more in their innate rather than adaptive immune system98. Thus, immunological studies in women may benefit from focusing on testing innate immune system function and/or possible competition between the two arms of immune function, instead of analyzing only adaptive immune system properties.This study tested for the trait development and possible trade-offs between growth and immune function in women with different income levels. While an earlier study9, these findings indicate that there are sex differences in the covariation between family income and height. These sex differences are possibly based on different sexually selected traits in men and women104, with height being a condition-dependent sexual trait in human males but not necessarily in females. We also found a negative association between income level and plasma cortisol level, both of which are predictors of general health and fertility. Although we cannot rule out genetic influences underlying the relationships between income level, immune response and cortisol level105, our findings indicate the importance of the developmental niche106 in creating individual differences in the strength of immune response, which can be considered a key life history trait. Finally, the vaccination approach serves as a powerful eco-immunological tool, while antibody response\u00a0to vaccination provides an estimate of total immune function. However, given the complexity of the immune system, vaccination\u00a0and measurement of\u00a0antibody response need to be carried out along with other immune function measurements107. The high number of non-seroconverters in our sample suggests that the antibody response might be a result of interactions between the innate and the acquired arms of the immune system, fluctuating environmental conditions and levels of physiological stress108.In summary, we found a relationship between socioeconomic conditions and the strength of immune response: the highest levels of antibody titers were found in young women who had the highest levels of family income during childhood and adolescence. However, family income was not associated with women\u2019s height. Comparing with prior research in young Latvian men109. Briefly, we collected venous blood in 6\u00a0ml vials to measure the presence of antibodies before the vaccination. This was done to ensure that none of the participants had hepatitis B-specific antibodies before the vaccination. One month after the vaccination, we collected 6\u00a0ml of venous blood again to measure antibodies produced. To quantitatively determine serum hepatitis B surface antigen (anti-HBs) levels, we used the commercially available AxSYM\u00ae AUSAB\u00ae microparticle enzyme immunoassay (MEIA). Anti-HBs concentrations were expressed in mIU/ml. Cortisol levels were measured from plasma samples taken during the first testing session . Cortisol was measured from the blood sampled between 9:00 and 10:00. All participants woke up between 2 and 2.5\u00a0h before the first sample was taken. We collected two cortisol samples (before vaccination and 30\u00a0min later) and calculated the average, which was used in the analyses.We activated the immune system of the subjects using hepatitis B vaccine 109. The participants were 19\u201322-year-old women; all were undergraduate students with no job class achieved, limited opportunities to work because of their full-time studies and largely dependent on parent income. All of the participants lived with their parents during the study. Thus, all socioeconomic parameters of the subjects were similar except for income. We interviewed the participants and their parents about current income of their families and their income since 1991, based on parents\u2019 recall . This is when most of the subjects were born and when Latvia regained its independence as a result of the economic crash and political crisis in the USSR. We divided the time since 1991 into five periods and assigned each family into one of seven income categories. The current analyses were done on recalled family income data divided by the number of family members in each family. We included only those families that remained in their income categories since 1991 or shifted away from the original socioeconomic status by a maximum of one category. In 2010, the first income group consisted of families with equivalent to or less than 50 EUR per family member/month (n\u2009=\u20098); the second group, 51\u2013100 EUR per family member/month (n\u2009=\u200919); the third group, 101\u2013150 EUR (n\u2009=\u200913); the fourth group, 151\u2013200 EUR (n\u2009=\u200912); the fifth group, 201\u2013250 EUR (n\u2009=\u20099); the sixth group, 251\u2013300 EUR (n\u2009=\u20093); and the seventh group, 301\u2013350 EUR (n\u2009=\u20092). This division of income per family member/month corresponds to those traditionally used by Latvian economists111. It is important to note that there were only a few families available in the area with more than 300 EUR per family member during the study period.There are several important variables that characterize the socioeconomic status of an individual. The following parameters are central: age, education, job class and income  framework was used to model the relationship between immune response (dependent variable) and height, income and cortisol level (independent variables). Specifically, a Tweedie (1.25) based GAM with a power (0.1) link function was implemented to model antibody levels. The analysis was done using the R 3.5.1. statistical packageThe study was approved by the Research Ethics Committee of the University of Daugavpils, Latvia (05/2012). All participants provided informed consent to participate in this study, and the ethics committee approved this informed consent procedure. The experiment was conducted in accordance with The Code of Ethics of the World Medical Association (Declaration of Helsinki). This paper is in line with the Recommendations for the Conduct, Reporting, Editing and Publication of Scholarly Work in Medical Journals."}
+{"text": "Chronic pain is a debilitating condition that occurs after tissue damage, which substantially affects the patient\u2019s emotional state and physical activity. The chronic pain in rheumatoid arthritis (RA) is the result of various autoimmune-induced inflammatory reactions in the joints. Both types of peripheral and central pain processing can lead to sensitisation. Non-steroidal anti-inflammatory drugs (NSAIDs) and disease-modifying anti-rheumatic drugs (DMARDs) can result in potent anti-inflammatory effect. However, these drugs are not able to suppress the pain from RA for a prolonged period. For years, researchers have examined the role of the N-methyl-D-aspartic acid receptor 2B (NR2B) subunit of N-methyl-D-aspartate receptors (NMDAR) in chronic and neuropathic pain models. This NMDAR subtype can be found in at the peripheral and central nervous system and it represents an effective therapy for RA pain management. This review focuses on the NR2B subunit of NMDAR and the different pathways leading to its activation. Furthermore, specific attention is given to the possible involvement of NR2B subunit in the peripheral and central pathogenesis of RA. Rheumatoid arthritis (RA) is an autoimmune disease caused by the inflammation process in the body. It can lead to pain, swelling, and joint stiffness. In the long term, patients may experience symmetrical disabilities in the hands, wrists, and knees bilaterally . AccordiPain is the primary complaint of many RA patients. The pain is usually described as chronic in nature but with flare-ups in between, leading to fatigue, psychological disturbances, and poor quality of life . These pCurrent pharmacological approaches for RA management are directed at the immune system to suppress the symptoms. However, the impact of the central nervous system (CNS) on pain flares is poorly researched upon, according to the Pain Management Task Force of the American College of Rheumatology . Non-steBased on this postulation, it is crucial to discover the most effective analgesic to manage the prolonged pain in RA. To combat the pain derived from inflammatory arthritis such as RA, it is critical to explore the possible mechanisms leading to arthritic pain so that they can be modulated appropriately. In the past, many approaches have been suggested to find the best therapeutic option for arthritic pain. Targeting N-methyl-D-aspartate receptors (NMDAR) can be a promising option because they involved in the established pathways of chronic and neuropathic pain. This review focuses on the possible roles and mechanisms of NMDAR in the published arthritic and inflammatory-related researches. Specific attention is given to the role of the N-methyl-D-aspartic acid receptor 2B (NR2B) subtype on the pathogenesis of RA and how specific drugs can modulate its activation.NMDAR is one of the ionotropic glutamate receptors (iGluRs). It is comprised of DL-\u03b1-amino-3-hydroxy-5-methylisoxasole-4-propionate (AMPA) and kainate receptors . As withSimilar to other iGluRs, NMDAR is a heterodimer made up of four subunits to form the ion channel collectively. N-methyl-D-aspartate receptor (NR)1 (contains eight splice variants), NR2 (A\u2013D) and NR3 (A and B) are the basic subunits of NMDAR. NR1 is the fundamental channel-forming subunit of NMDAR , 26, 27.2+ concentration and its route of entrance. It also depends on the type of NDMAR subunit structure and the location at which NMDAR is activated. Among the four subunits of NMDAR, the phosphorylation of NR1 and NR2 subtypes at C-terminals can modulate NMDAR activity and influence synaptic plasticity  would be dissociated from the NR2B subunit. These mechanisms lead to continuous development of EPSPs  can take place. There are two ways this process can happen. Firstly, via protein kinase A (PKA)-induced activation of transcription factor cyclic adenosine monophosphate (cAMP) response element-binding protein (CREB). Secondly, via NMDAR-dependent activation of mitogen-activated protein kinase (MAPK) signalling cascades. Both activation pathways ensure the long-term potentiation (LTP) . When the depolarisation of postsynaptic membrane and the generation of EPSPs via spatial and temporal summation reach the threshold level, magnesium ion (Mgof EPSPs . The proon (LTP) . A prolo subunit .Furthermore, the stimulation of G-coupled-protein receptors (GPCRs) also induces the activation of the NR2B subunit that ultimately produces CNS plasticity. To elaborate, GPCRs are the sites where glutamate, acetylcholine, and dopamine neurotransmitters unite via their signalling pathways. The union of these neurotransmitters is necessary to change the gating or trafficking of NMDAR, including NR2B subtype. GPCRs include muscarinic, lysophosphatidic acid (LPA), and metabolic glutamate receptor 5 (mGluR5) receptors . These r2) into solubilised inositol-1,4,5-triphosphate (IP3) and diacylglycerol (DAG). IP3 then binds to the IP3 receptors at the endoplasmic reticulum membrane to induce the release of intracellular Ca2+ from the neuronal calcium store. On the other hand, DAG triggers the activation of PKC via the subtype PKC\u0263. This subtype is primarily involved in nociceptive processing  that would be auto-phosphorylated on its Y402 site . Activated PLC hydrolyses phosphatitylinositol 1,4, bisphosphonate  from inhibiting the NR2B subunit activity. Moreover, this mechanism may be further augmented as Src kinase also increases the intracellular Nae neuron .The cascade of G\u03b1s-coupled GPCRs activation is another pathway that enhances the activity of the NR2B subunit during the inflammatory-induced pain transmission. This mechanism occurs through the binding of pituitary adenylate cyclase-activating peptide (PACAP) to PACAP type 1 (PAC1) receptors that are extensively expressed in the hippocampal region of the brain. PACAP regulates NR2B subunit activation in two ways. Firstly, the activated G\u03b1q-coupled GPCRs pathway can further activate phospholipase C and PKC. The alternative way is via the activation of G\u03b1s-coupled GPCRs pathway by binding to the enzyme adenylyl cyclase. Adenylyl cyclase able to produce cyclic adenosine monophosphate (cyclic AMP) from adenosine triphosphate (ATP). Cyclic AMP is needed to activate PKA. Following the stimulation of PKA, Fyn kinase and NR2B subunit are detached from the first WD propeller site of receptor for activated C kinase 1 (RACK1), resulting in the upregulation of tyrosine phosphorylation and activity of NR2B subunit , 33 Fig.2+ into the neuron (2+ level did not take place (The protein tyrosine kinase Ephrin B (EphB) is needed to increase the activity of the NR2B subunit. It tightly regulates the localisation and function of NMDAR at the synapse via its binding to EphB receptor on the postsynaptic density . This ree neuron . Ephrin ke place . In anotke place , thus hi2+influx, specific guanine nucleotide exchange factors (GEFs) would stimulate the phosphorylation of ERK (pERK)  which comprises p38MAPK and c-Jun N-terminal kinase (JNK). The initiation of the ERK/MAPK pathway in the activation series of kinases follows the below sequence: Ras \u00e0 Raf \u00e0 MEK \u00e0 ERK/MAPK . Apart fK (pERK) . The pERK (pERK) . These nDuring RA-induced inflammation, many pro-inflammatory cytokines are produced at the terminal ends of primary afferent fibres. Cytokines communicate by binding to their specific receptors at the terminal ends of the nerve fibres, resulting in the signal transduction process that causes inflammation. Since cytokines are pleiotropic in nature, they may act on different target cells and influence the role of other cytokines. The cytokines may act synergistically or antagonistically to stimulate an excessive inflammatory response. Interleukin-1 (IL-1), tumour necrosis factor (TNF)-, IL-17 and IL-6 superfamily are the cytokines that play a pro-inflammatory role. However, some of the cytokines may be anti-nociceptive or playing both pro- and anti-inflammatory roles .IL-1\u03b2 and TNF-\u03b1 can be found abundantly in the synovial fluids and systemic circulation of the RA patients. They are released from the macrophages and monocytes via TLR4 activation . The bin2 (PGE2) and vascular endothelial growth factor (VEGF)  .The pathogenesis of RA involves a cascade of inflammation and chronic pain. The activation of NMDAR on the peripheral terminals of the primary afferents and DRG happens either via the direct stimulation of mechanosensitive cation channels or the indirect stimulation of inflammatory cytokines. These actions result in the transduction of pain signals from nociceptors and mechanoreceptors. As a result, sensitisation can develop without any tissue damage or inflammation. This review will discuss in detail the possible mechanisms of the activation of the NR2B subunit that leads to peripheral and central sensitisation in RA.Articular changes in RA which may induce or sensitise primary afferent nerves, leading to pain at the extremities. The synovium and capsule of the joints are heavily innervated by postganglionic sympathetic nerve fibres and peripheral afferents of the DRG. In these areas, there is a large number of primary A\u03b1 and A\u00df sensory neurons that are involved in mechanosensation, and A\u03b4- and C-fibers that participate in nociception.2 (2+ into the neurons (+) following inflammatory responses. Substance P, CGRP and somatostatin are released from peripheral nociceptive fibres to further modulate inflammatory process. They also act by stimulating the auto activation of the sensory neurons through cognate receptors expressed on the nerve endings  channels such as TRPV1-4 and TRPM3 detect noxious heat sensation whereas TRPA1, TRPC5 and TRPM8 are associated with noxious cold temperatures. TRPA1 and TRPV4 subunits detect noxious mechanical signals while TRPA1, TRPV1, TRPV3, TRPM8 and TRPC3 are involved in the transmission of itch sensation . These iciceptor . On the  the DRG , 47. As tivation . Nerve gtivation . These ate GPCRs . It is areaction . Evidenttion  binding-activated monocyte or macrophage. These mediators can across the blood-brain barrier to activate microglia in the spinal cord and brain during autoimmune-induced inflammation . These nSeveral brain regions are reported to demonstrate a strong upregulation of the NR2B subunit of NMDAR during chronic inflammation. In a rat model of complete Freund\u2019s adjuvant (CFA) induced-inflammation, the injection of NMDAR antagonist MK-801 prominently blocked the aberrant spontaneous discharges and pain-evoked discharges at the arcuate nucleus site. This finding is highly suggestive to be related to the increased phosphorylation of the NR2B subunit mediated by PKC and subsequently resulted in the alleviation of thermal and mechanical hyperalgesia .Undeniably, the development of RA pain involves more than just the ascending nociceptive transmission pathways. It is also associated with an impaired descending inhibitory mechanism that may negatively facilitate the spinal transmission of pain. Under normal physiological conditions, the excitatory and inhibitory interneurons in the spinal dorsal horn lamina form a complex linkage that processes modality-specified somatosensory inputs in a proper manner. However, this system progressively collapses in the event of chronic pain, particularly in cases of developed mechanical allodynia. Moreover, the inhibitory glycinergic signals stimulated by A\u03b2-fibres to form a feed-forward inhibitory mechanism under the normal situation are also disrupted. As a result, the PKC\u0263 in lamina II of spinal dorsal horn that receives the mechanical and nociceptive signals from A\u03b2-fibres is activated . The actApart from the spinal cord, other regions categorised under the descending circuit include brainstem ACC, periaqueductal gray (PAG), and rostral ventromedial medulla (RVM). These brain regions play a dual role. They can either inhibit or facilitate nociception, depending on which cells are activated. Some studies have proven that NMDAR expression on these regions plays a significant role during chronic pain, such as RA pain , 27. ForIn another study, using CFA-induced chronic inflammatory pain model, Hu et al.  found a Although there is no specific cure for RA, there are several therapeutic strategies to expedite the diagnosis and to achieve a low disease activity state. Published research has shown that the application of several NMDAR antagonists can reverse the hyperalgesia and allodynia in several models of chronic pain to the normal or pre-inflammatory states. For example, MK-801 manages to reduce the mechanical hypersensitivity in a rat model of inflammation  while DL1-adrenoceptor antagonist and selective NR2B subunit antagonist) can inhibit the activation of NR2B subunit via interaction on the polyamine modulatory site , tricyclic antidepressants and selective serotonin reuptake inhibitors used to treat depression in Parkinson\u2019s disease , 74. Theory site . More reory site , 76. In Despite the availability of certain biologics to suppress and control the inflammatory responses in RA, the pain resulted from RA warrants more attention. The reduction of inflammation does not mean the patients will be pain-free. For clinicians, pain may just influence disease assessment and treatment choices. However, for RA patients, pain may be their worst problem as it affects their emotions and working ability. Current medications are not potent enough to reduce arthritic pain. For effective management of RA, clinicians need to be more concerned about the patients\u2019 pain symptoms to outline a better pain management plan. Therefore, the search for appropriate therapeutic approaches that can modulate the pain is critical to relieve the suffering of RA patients. The roles of the NR2B subunit of NMDAR especially in chronic and neuropathic pain management are gaining serious attention. Previous studies have shown that the antagonistic action of this N2RB may be effective in chronic pain management. However, more experimental studies and clinical trials need to be conducted to elucidate its possible roles in modulating RA pain. It is hoped that in the future, this therapeutic approach may become one of the effective strategies in alleviating the pain flares in RA patients."}
+{"text": "The COVID-19 pandemic presents a unique global health challenge further complicating surgical management of COVID-19 positive patients due to a lack of published literature.Within we discuss a 48-year-old Chinese man, presenting with acute gastrointestinal obstruction due to sigmoid colonic mass. The patient was screened and tested positive for COVID 19 due to his employment in Wuhan, China at the COVID-19 pandemic epicenter. The patient was subsequently taken for open sigmoid colonic resection, however the case presented multiple challenges due to the patient's COVID-19 positive status.The challenges of surgical management of COVID-19 positive patients exist are four-fold. First the unknown efficacy of pre-surgical risk stratification in COVID-19 positive patients, second the risk of aerosolized COVID-19 transmission during intubation for surgery, third the risk of fecal COVID-19 transmission to surgical staff during large bowel resection, and fourth the post-operative challenges of caring for COVID-19 positive patients.Further research is needed into these topics, as well as the medical management of COVID-19 surgical patients. First identified in Wuhan City, Hubei Province, China . Coping Multiple other studies have addressed the virology, epidemiology, pathology and critical care management of COVID-19, however surgical management of patients suffering COVID-19 infection remains unclear. In available Pubmed literature review there is a single pre-print article discussing pulmonary surgery in 2 patients with COVID-19 . As of t2A 48-year-old Chinese man, with history of positive HBsAg, presented in February 2020 with five days of worsening constipation and lower abdominal pain without fever, cough or subjective dyspnea. Social history was notable for employment in Wuhan, China at the geographic COVID-19 epicenter as a supermarket laborer. Physical exam revealed an age appropriate, ill appearing man, resting in bed without acute cardiopulmonary findings but notable for abdominal distension, periumbilical tenderness and hypoactive bowel sounds. Vital signs were unremarkable with an oxygenation saturation of 95% on room air.9/L (9.6%), elevated Carcinoembryonic antigen 4.32\u202fng/mL (reference 0\u20133), and elevated procalcitonin 1.87\u202fng/mL (reference 0.05\u20130.5). Computerized tomography (CT) of the abdomen revealed a colonic mass resulting in sigmoid colonic obstruction and large bowel dilatation  chest CT demonstrating resolution of ground glass opacities. Subsequent COVID-19 PCR testing on post-op days 15 and 16 were negative. The patient was discharged from the hospital on post-op day 18 without further complications and scheduled for outpatient follow up.Given concerns regarding potential transmission, the surgical staff were monitored for symptoms such as cough, fever, chills, myalgia or diarrhea 2 weeks post operatively without evident stigmata of COVID-19 infection. On post-op day 7 team members underwent screening chest CT imaging for further screen for COVID-19 without any noted imaging abnormalities.3COVID-19 presents in a myriad of severities. Wu and McGoogan et al. reported among 72,314 COVID-19 cases, 81% were mild (defined as absent or mild pneumonia), 14% severe , 5% critical , and 2.3% fatal [Pre, peri, and post-surgical procedure to minimize viral transmission to healthcare staff, as well as anticipation of a patient\u2019s potential for pulmonary complications are among the most critical concerns regarding these patients. It is current consensus that COVID-19 is transmissible through aerosolized droplets and physical contact, although airborne transmission remains a concern.The rising incidence of COVID-19 will likely place a previously unforeseen strain on infection prevention in large community centers where personal protective equipment (PPE) shortages have been reported worldwide. Leung et al. demonstrated the efficacy of surgical masks to reduce coronavirus detection and viral copies in large respiratory droplets as well as aerosols, suggesting surgical face masks may limit viral transmission of COVID-19 suspected patients in transport ,11.Intraoperatively, enhanced PPE  for surgical staff have been recommended by the Chinese Center for Disease Control. Patient risk categorization, reconstruction of operating room (preferably to negative pressure \u22124.7\u202fPa in the main room and \u22121.2\u202fPa in the anteroom), reorganization operating room workflow process are all likely to become key elements for the containment of viral transmission .In colorectal cancer, laparoscopy-assisted radical surgery has typically been the surgical modality of choice  with thePostoperatively, it has been difficult to anticipate the outcomes of patients infected with COVID-19 due to lack of published data. Recently two patients with active COVID-19 infection underwent thoracoscopically lobectomy, and though stable prior to surgical intervention noted 50 % post-operative mortality . FurtherUnfortunately, no specific antiviral agents in the treatment of COVID-19 have definitely been proven effective at the time of this paper. Remdesivir may have the greatest potential of inhibiting COVID-19, but its efficacy and safety require further evaluation . In ChinFinally, testing of clinical staff involved in patient care is again a difficult issue to address. Ideally, testing of all staff involved in patient care would allow for optimal minimization of viral transmission. However, lack of testing reagents and test kits worldwide limit this approach. Alternatively, due to availability screening chest CT was utilized among surgical staff per CCDC recommendations at that time. American College of Radiology guidelines as of March 11, 2020 have recommended against this approach due to radiologic exposure and lack of sensitivity. Further studies are needed to identify if the guidelines regarding COVID-19 screening are applicable to surgical staff in high risk aerosolizing environments such as operating suites.4In conclusion, COVID-19 remains a global health challenge. The efficacy of perioperative risk stratification in COVID-19 positive patients with varying degrees of COVID-19 infection remain unknown and requires further investigation. Although fecal COVID-19 RNA has been detected, surgical pathology did not note COVID-19 in adjacent bowel tissue, but this finding has unclear clinical implications at this time. Regardless, all surgical tissue and surgical waste removed in both large and small bowel surgeries will likely have fecal contamination and should be treated as a potential infectious source of COVID-19 and disposed of accordingly. Finally, further investigation is needed into post-operative management of COVID-19 patients, medical management of COVID-19 and appropriate screening for surgical staff involved in operating on COVID-19 patients.All authors declare no conflicts of interest.No funding involved in this case study.This is a case report. It does not require Ethical approval. The patient consents for the publication.Written informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal on request.Zhengbin Huang: Study concept, data collection, data analysis and interpretation.Jijun Yan: Data collection, data interpretation.Tian Jin: Data collection, data interpretation.Xiufang Huang: Data collection, data interpretation.Guoxiang Zeng: Data collection, data interpretation.Michael L. Adashek. Critical review and editing the article.Xinhai Wang: Data collection, data interpretation.Jieping Li: Data collection, data interpretation.Dan Zhou: Data collection, data interpretation.Zhengqi Wu: Writing the article, final approval of submission.Research RegistryName of the registry: Unique identifying number or registration ID: researchregistry5529https://www.researchregistry.com/browse-the-registry#home/registrationdetails/5ea0a8abef05070015be1856/Hyperlink to your specific registration (must be publicly accessible and will be checked): Zhengbin Huang.Not commissioned, externally peer-reviewed."}
+{"text": "How does the brain allow us to interact with others? Social neuroscience has already provided some answers to these questions but has tended to treat high-level, cognitive interpretations of social behavior separately from the sensorimotor mechanisms upon which they rely. The goal here is to identify the underlying neural processes and mechanisms linking sensorimotor coordination and intention attribution. We combine the human dynamic clamp, a novel paradigm for studyingrealistic social behavior, with high-resolution electroencephalography. The collection of humanness and intention attribution reports, kinematics, and neural data affords an opportunity to relate brain activity to the ongoing social behavior. Behavioral results demonstrate that sensorimotor coordination influences the judgments of cooperativeness and humanness. Analysis of brain dynamics reveals two distinct networks related to the integration of visuo-motor information from self and other which overlap over the right parietal region. Furthermore, judgment of humanness and cooperation of others modulate the functional connectivity between this right parietal hub and the prefrontal cortex. These results reveal how distributed neural dynamics integrates information from \u201clow-level\u201d sensorimotor mechanisms and \u201chigh-level\u201d social cognition to support the realistic social behaviors that play out in real time during interactive scenarios. Much of our social life consists of interactions with others. Despite their essential role, social interactions still remain the \u201cdark matter\u201d of social neuroscience: the field is in urgent need of studies that embrace the reciprocal and real-time nature of social coordination . OvercomAt the neurophysiological level, several frequency bands have been implicated in social processes, including fronto-central and occipito-temporal Theta 4\u20137\u00a0Hz; , fronto-Social neuroscience studies that investigate the interaction between multiple participants face the challenge of having more sources of unconstrained variance than experimental paradigms with single participants do. To overcome this limitation while at the same time maintaining the essential reciprocal and dynamical nature of social interaction, we use the human dynamic clamp (HDC) paradigm which enables direct experimental control of one of the social partners, as well as the coupling between them. The HDC consists of a human interacting reciprocally with a virtual partner (VP), the design of which is based on an empirically grounded computational model of human coordination dynamics . This atDivergent theories of social cognition have risen over the years. On the one hand, cognitive theories have focused on \u201ctop-down\u201d processes , mentaliThe present work aims to elucidate so-called top-down and bottom-up perspectives of social behavior using real-time interaction between a human and a VP in conjunction with neurodynamical analyses of spatially resolved high-density electroencephalography (EEG) recordings. A benefit of using the HDC is that the evolving brain dynamics can be correlated with both human and VP movements as well as their coordination. In addition, the paradigm enables an evaluation of how humans reflect on their interaction with the VP and assess their  partner\u2019s humanness and intention. The goal is to expose the brain circuitry hypothesized to relate real-time coordination and ongoing cognitive and emotional aspects of social behavior.As noted above, various neurophysiological markers have been implicated in social processes. Accordingly, EEG analyses were conducted across all frequencies and without predetermined judgment regarding regions of interest. Via this strategy, we aimed to: 1) quantify how the dynamics of social coordination with a VP affects human subjective reports (cooperation\u2009~\u2009competition); 2) identify neuromarkers  associated with sensorimotor coupling ; and 3) investigate the neural correlates of humanness and intention attributed to a VP. Overall, our analyses and results at both neural and behavioral levels go some distance toward resolving previous antagonisms between online and offline modes of social cognition, and rather attest to their complementary nature.About 20 volunteers, 12 males, and 8 females aged between 18 and 33\u00a0years  took part in the study. All were right-handed (Edinburgh Handedness Inventory) with reported normal or corrected-to-normal visual acuity and without self-reported history of neuropsychiatric disease or movement disorder. Participants provided informed consent prior to the research. The study was approved by the Internal Review Board at Florida Atlantic University and conformed to the principles expressed in the Declaration of Helsinki.Participants were seated in a dark Faraday room, with the ulnar side of the right forearm resting against a U-shaped support (21.5\u2009\u00d7\u20098\u2009\u00d7\u20094\u00a0cm) positioned parallel to a table A. Partichttps://github.com/GHFC/SoNeTAA). A java script version of the HDC is available on GitHub: https://github.com/crowd-coordination/web-vpi and can be tested online at http://www.morphomemetic.org/vpi/. The velocity of the human finger was numerically computed using a three-point differentiation algorithm and together with position data plugged into the VP equation .Potentiometer signals corresponding to human finger displacement and position of the VP\u2019s finger were mean-centered, detrended, low-pass filtered using a second-order dual-pass Butterworth with a cutoff frequency of 20\u00a0Hz and normalized. After this preprocessing, we quantified the coordination between human and VP by calculating the continuous relative phase (RP) between their movements (phase estimated with continuous Hilbert transform). To avoid transients and thus separate the inhomogeneous neural activity occurring at onset and offset of the interaction, we removed the first and last seconds of interaction, leaving 8\u00a0s of each trial for analysis. For each of the two halves of the trials, mean RP and the corresponding circular variability were calculated, in order to assess the produced pattern  and its stability, respectively. For each participant, subjective reports of humanness and cooperativeness were Z-score normalized, and performances were quantified through two indices: a phase coordination score equal to the normalized absolute difference between ongoing RP and the RP corresponding to the task condition ; an intention attribution score equal to the normalized difference between perceived cooperativeness and real VP behavior, thus quantifying if the human participant was able to perceive VP\u2019s helpfulness (or not) toward achieving his/her goals. Behavioral variables were analyzed through a repeated measures 2\u2009\u00d7\u20092\u2009\u00d7\u20092\u2009\u00d7\u20092 ANOVA in JASP  having aThe experiment was conducted in a sound-proof Faraday chamber. High-density EEG was recorded using 128 channel EEG caps with Ag-AgCl electrodes  arranged according to an extension of the 10\u201320 system . The sigEmotional arousal was quantified with a bipolar montage of two passive Ag/AgCl electrodes capturing sympathetic changes . We extracted the skin potential response (SPR) normalized magnitude by following the method described in m\u2009=\u20093, a Legendre polynomial order n\u2009=\u200950, and a regularization parameter \u03bb\u2009=\u200910e\u22128  and interpolated using a spherical spline algorithm  with an \u2009=\u200910e\u22128 . Correct\u2009=\u200910e\u22128  on 800-mhttp://neuroimage.usc.edu/brainstorm; Source reconstruction was performed with the free open-source application Brainstorm , two-tailed paired permutation tests, which randomly exchanged the estimated values of coupling between conditions for each participant. We used exhaustive permutations (2^20) to estimate the empirical distribution under the null hypothesis of no difference between the two conditions (n\u2009=\u200920) statistical inference based on paired permutation tests. All randomizations were done for the rejection of the null hypothesis and to control the family-wise error rate at P\u2009=\u20090.05.Student nditions . For cluBehavioral analysis focused on subjective reports (accuracy in cooperative or competitive intention attribution) and coordination measures (stability of the RP during the interaction).During the coordination task, both partners had to settle on a common frequency while being instructed to coordinate with each other either in-phase or anti-phase, two modes known to be stable . In agreP\u2009<\u20090.001, permutation test against chance; 10.6% false-cooperation, 9.1% false-competition), and their subjective reports were successfully modulated by the behavior of the VP during the interaction. The 2\u2009\u00d7\u20092\u2009\u00d7\u20092 repeated-measures ANOVA (VP Behavior [Cooperative/Competitive] by Transition [Yes/No] by Task [In-phase/Anti-phase]) on subjective reports of cooperativeness revealed a main effect of VP behavior \u2009=\u2009579.49, P\u2009<\u20090.001, \u03b7p2\u2009=\u20090.650), showing that the VP was rated more cooperative in the cooperative condition compared with the competitive one. The transition factor also reached significance \u2009=\u20094.25, P\u2009=\u20090.04, \u03b7p2\u2009=\u20090.013), showing that a change in VP behavior during the trial resulted in the VP being rated less cooperative. Finally, there was a main effect of Task \u2009=\u20099.71, P\u2009=\u20090.002, \u03b7p2\u2009=\u20090.030), as well as an interaction between VP behavior and Task \u2009=\u200910.80, P\u2009=\u20090.001, \u03b7p2\u2009=\u20090.033). Post-hoc tests revealed that VP was judged less cooperative for the task anti-phase than in-phase (t(19)\u2009=\u2009\u22123.4, P\u2009<\u20090.001), especially when the trials started with a cooperative VP he cooperative or competitive cf., . Overallative VP .One notable exception occurred when the human task to move in-phase led to a VP deemed less cooperative than when the human was tasked to move anti-phase \u2009=\u200942.45, P\u2009<\u20090.001, \u03b7p2 = 0.123) with competitive being less stable than cooperative behavior; 2) on the organization of the trial, with the first half of the trial less stable than the second \u2009=\u200915.97, P\u2009<\u20090.001, \u03b7p2 = 0.050); and 3) on the presence of a transition in VP behavior, with the presence of a transition resulting in less stability \u2009=\u200919.34, P\u2009<\u20090.001, \u03b7p2 = 0.060). The transition \u00d7 trial-part interaction \u2009=\u200920.47, P\u2009<\u20090.001, \u03b7p2 = 0.063) indicated that RP stability was lowest in the second half of the trials, in cases where VP switched behavior at mid-trial (ps\u2009<\u00a00.001). Note that in all cases, stability was assessed in each half of the trial and after a transient to discard effects from the appearance of the partner and a switch in VP intention. Interestingly, accurate intention attribution was correlated with the stability of the interaction , pointing toward a link between the pattern of sensorimotor coordination and socio-cognitive assessment of the other.The 2\u2009\u00d7\u20092\u2009\u00d7\u20092\u2009\u00d7\u20092 repeated-measures ANOVA  on RP stability revealed that coordinative stability depended: 1) on the cooperativeness of the VP . Despite this prominent dependency on objective variables of cooperativeness, the humanness rating was independent of subjective judgment of cooperation. Indeed, subjective ratings of cooperativeness in both periods of interaction did not show any differences between trials associated with judgments of humanness . Similarly, trials with both parts judged as cooperative did not demonstrate differences in humanness rating compared with trials with both parts judged as competitive . In contrast to intention attribution, judgment of humanness did not depend on RP stability . However, statistical analysis revealed a significant correlation between VP behavior and transition in the judgment of humanness \u2009=\u20097.022, P\u2009=\u20090.008, \u03b7p2\u2009=\u20090.022) as well as an interaction between VP behavior and transition \u2009=\u20097.022, P\u2009=\u20090.008, \u03b7p2\u2009=\u20090.022), suggesting that a drop in humanness rating occurred when VPs were acting in a competitive fashion and, specifically, when VPs sustained their competitive intention throughout the trial  repeated-measures ANOVA on humanness ratings showed a main effect of VP behavior \u2009=\u2009\u22125.58, P\u2009<\u20090.0001; t(19)\u2009=\u2009\u221210.38, P\u2009<\u20090.001; t(19)\u2009=\u20092.95, P\u2009<\u20090.05; t(19)\u2009=\u20093.55, P\u2009<\u20090.05; Power analyses on estimated cortical sources revealed well-known mu suppression in the upper alpha band over primary motor areas during movement \u2009=\u20093.53, P\u2009<\u20090.005; t(19)\u2009=\u20094.56, P\u2009<\u20090.0001; Analysis of cortico-motor coherence with velocity of human movement (\u201cself\u201d) revealed the significant involvement of contralateral primary motor cortex . Functional connectivity in the low-theta band was explored in order to understand how self- and other-related information may be related to cooperative/competitive behaviors or humanness judgment during social interaction. The two contrasts revealed a similar pattern: sensorimotor hubs in the posterior part of the brain, predominantly in the right hemisphere , were coordinated with anterior areas . The present study used the HDC to investigate the neural underpinnings of social interaction and in particular how the brain integrates its own behavior with that of others to support the attribution of humanness and intention. We recorded high-density EEG in humans interacting with a VP parameterized to act in a cooperative or a competitive way. At the behavioral level, our results suggest a link between sensorimotor coupling and intention attribution as shown by the correlation between individual phase coordination scores (stability) and accuracy in detecting VP\u2019s goals . At the brain level, we highlight the recruitment of networks associated with self\u2013other integration, demonstrating a key overlap over right parietal areas.At the behavioral level, our results first demonstrate how interaction with the HDC leads to the successful attribution of intention. Indeed, participants accurately judged the intention of the VP despite the confounding factor of task difficulty arising from the performance of in-phase versus anti-phase coordination (more difficult). The experimental protocol also led to attribution of humanness, although the partner was always a computational model. Participants judged the VP to be human 47.3% of the time. Our data show that the presence of a transition in VP behavior  modulated the attribution of humanness to the VP cf.,  and thatAt the brain level, source analysis reveals multiple brain networks involved in social coordination operating at different frequencies. Motor areas are recruited, as highlighted by a significant decrease of high-alpha/mu (10\u201313\u00a0Hz) power over contralateral and medial Rolandic regions during execution of movement compared with rest A. This rPrevious research has identified the involvement of right parietal cortex, specifically the TPJ for the integration of self and others\u2019 actions . TPJ is Cortico-motor coherence in the theta band also reveals how right parietal sources are coordinated with shared movement velocity , extendiSocial interactions are not solely orchestrated by parietal regions. Understanding the intentions of others is a crucial feature of effective social interaction. The present behavioral results highlight a correlation between sensorimotor performance and the correct attribution of intention. Furthermore, we show through whole-scalp connectivity analysis that large-scale connectivity modulation is associated with both high-  and low-level (sensorimotor) aspects at play during live interaction. The attribution of human intentions to the VP is associated with higher coherence between bilateral occipital areas and between right occipital and parietal areas (coherent with the location of rTPJ) cf., A,C,E, whn\u2009=\u200920) restricts statistical power. Another limitation concerns the use of EEG alone for studying the brain\u2019s functional networks. EEG is a technique with an appropriately high-temporal resolution to conduct the key analyses, especially the cortico-motor coherence, but with a restricted spatial precision. Even though high-density EEG provides a better spatial resolution than regular EEG systems , volume conduction, a biophysical phenomenon defined as the transmission of electric fields from primary sources through biological tissues and recorded by several sensors at different locations , to identify specific features affected in ASDs . The rationale behind this design is that deep phenotyping , from ne"}
+{"text": "Visual search is facilitated when observers encounter targets in repeated display arrangements. This \u2018contextual-cueing\u2019 (CC) effect is attributed to incidental learning of spatial distractor-target relations. Prior work has typically used only one recognition measure (administered after the search task) to establish whether CC is based on implicit or explicit memory of repeated displays, with the outcome depending on the diagnostic accuracy of the test. The present study compared two explicit memory tests to tackle this issue: yes/no recognition of a given search display as repeated versus generation of the quadrant in which the target (which was replaced by a distractor) had been located during the search task, thus closely matching the processes involved in performing the search. While repeated displays elicited a CC effect in the search task, both tests revealed above-chance knowledge of repeated displays, though explicit-memory accuracy and its correlation with contextual facilitation in the search task were more pronounced for the generation task. These findings argue in favor of a one-system, explicit-memory account of CC. Further, they demonstrate the superiority of the generation task for revealing the explicitness of CC, likely because both the search and the memory task involve overlapping processes (in line with \u2018transfer-appropriate processing\u2019). Thus, for example, finding a searched-for \u2018target\u2019 item, such as some product in the supermarket, is facilitated by having found it repeatedly at the same location within a predictable arrangement relative to other items. In a comparable laboratory setting, observers are likewise faster in detecting a target letter embedded in a set of non-target, or distractor, letters when the spatial arrangement of the search items is repeated across trials. Such repeatedly encountered target-distractor arrangements, or \u2018contexts\u2019, come to guide visual search, \u2018cueing\u2019 attention to the target location 2. While contextual cueing is a well-established facilitator in visual search tasks3, there is an ongoing controversy whether cueing is reliant on a unitary\u2014explicit-memory system5, or whether it is more appropriate to assume two independent\u2014implicit and explicit-memory systems supporting contextual cueing of search and recognition of encountered scenes, respectively7. The current experiment used a novel factorial approach8 of employing qualitatively different awareness tests to investigate their ability to reveal explicit contextual cueing and to test which memory model is most likely to explain the observed effect patterns.Humans display an impressive capability for extracting statistical regularities from encountered scenes2 proposed that contextual cueing is an implicit effect\u2014though this has become a controversial issue on both theoretical and methodological grounds . In typical recognition tests of contextual cueing, repeated displays are presented alongside newly generated arrays in randomized order. Participants are instructed to discriminate a given display as repeated versus non-repeated . These yes/no recognition tests typically fail to find statistical evidence of explicit recognition of repeatedly encountered displays , though increasing the test power has been shown to be sufficient to yield above-chance recognition performance10. Furthermore, a meta-analysis by Vadillo et al.4 showed that even though single studies may not show explicit recognition of repeated search displays, the overall evidence points to above-chance recognition performance, again indicating that individual tests are hampered by lack of statistical power. Accordingly, Shanks and collaborators11 concluded that contextual cueing is based on a single, explicit memory system. However, this view was challenged recently by Colagiuri and Livesey\u2019s6 investigation of contextual cueing in very large samples. They found no relationship between cueing and awareness, leading them to conclude that contextual cueing is based on non-conscious learning and that cueing and recognition are driven by two independent memory systems. Arguably, though, all these studies, and their discrepant conclusions, suffer from one shortcoming: the absence of an active manipulation of the type, and with it: diagnostic accuracy, of the explicit test. While previous work examined for explicit recognition of repeated displays using almost exclusively yes/no recognition tasks, the present experiment examined for explicit knowledge of using a different\u2014target-quadrant generation\u2014task12, hypothesized to provide a more sensitive measure than the yes/no task11. Our approach was to compare the accuracy of the generation test with that of the yes/no test on a variety of performance measures derived from different memory models that assume in-/dependence of implicit and explicit processing.In their seminal study, Chun and Jiang2). Two types of explicit tests were used: yes/no recognition versus target-quadrant generation. The yes/no recognition task required participants to judge each repeated (vs. new) display as a repeated versus baseline  display. In the target-quadrant generation task, participants again encountered repeated (vs. new) displays. However, this time the target (in both repeated and baseline displays) was replaced by an additional distractor item. The task was to indicate\u2014or \u2018generate\u2019\u2014the quadrant of the substituted target item, by pressing the response key associated with the respective quadrant. Successful performance of the target-quadrant generation task would strongly rely on memory of the positioning of the target relative to the distractors in its vicinity. A total of eight repeated displays, each with a unique spatial layout, were presented together with non-repeated displays during both the search and explicit memory tasks. We expected memory effects to manifest in both tasks to be performed: during search, activation of acquired context memories by repeated configurations should yield shorter reaction times (RTs) as compared to baseline displays; in the explicit-memory tasks, memory access should improve \u2018recognition\u2019 of repeated displays. Our particular focus was on how spatial memory for repeated displays expressed in the search task would relate to measures of memory obtained in the explicit tasks.The current study was designed to investigate how the memory architecture underlying scene-based spatial learning in visual-search and explicit-recognition tasks is to be characterized. Accordingly, the experiment consisted of two parts: First, participants performed a visual search task in which repeated display layouts were shown together with non-repeated (\u2018baseline\u2019) displays. Thereafter, explicit-memory tests were administered to assess participants\u2019 conscious awareness of the repeated displays . That is, contextual facilitation should manifest in both the visual search and explicit-memory tasks, with the dependent measures in the two tasks exhibiting a significant correlation.The first account assumes the existence of a single memory system underlying both contextual cueing of visual search and recognition of repeated displays9: one is implicit, driving contextual cueing in the visual-search task; and the other is explicit, facilitating conscious retrieval of context cues in the explicit-memory task. Accordingly, there should be no systematic correlation between measures of contextual facilitation obtained in the search and memory tasks.The second model assumes that contextual cueing is supported by two independent memory systems13, it is less clear which perceptual factors, or visual display properties, modulate the learning of individual repeated displays. Olson and Chun14 found visual hemifield differences in contextual cueing: the cueing effect was greater for displays with targets appearing in the right visual field. But the targets\u2019 horizontal display location may not be the only factor impacting the learning of repeated target-distractor arrays. For instance, in a systematic analysis of contextual cueing as a function of the placement of the target in the visual display, Zinchenko et al.15 found that targets located nearer to the display center yielded stronger contextual-cueing effects compared to targets positioned further away.While previous studies agree that, in a given contextual-cueing experiment, only some 30% of repeated displays are actually learnt and thus come to produce a RT benefit in the search task16. Confirmatory evidence for the role of subjective factors in contextual cueing comes from pilot work we conducted in the course of the present study (see pilot study 1 below). The main finding was that people verbally described seemingly random spatial patterns\u2014which were later on, in the main experiment (performed by different observers), utilized as repeated layouts in the search and explicit recognition tasks\u2014according to criteria such as grouping , regularity , or symbolism .Moreover, subjective display properties, such as observers\u2019 judgment of the \u2018goodness\u2019 of the visual display arrangement, are positively related to contextual learningobjective display characteristics  and subjective characteristics , where both these \u2018surface\u2019 properties may influence contextual learning of these displays16.Thus, individual search displays can be \u2018described\u2019 in terms of both Given this, it should be possible to estimate contextual cueing in the search and the explicit-memory tasks  and then (try to) predict the facilitation on the basis of a regression-based classification approach, with objective and subjective display characteristics serving as predictors. Arguably, such a regression-based approach would provide an extra angle to understanding how the memory system/s underlying context effects in search and explicit memory tasks is/are to be characterized. If contextual cueing is supported by a single, explicit, memory system, then the very same predictors should \u201cload\u201d on different measures of the contextual-facilitation effect obtained in different\u2014the visual search and explicit memory\u2014tasks.In summary, analyzing contextual cueing at the level of individual search arrays, while at the same time quantifying these displays in terms of  spatial layout information, opens up new possibilities for the test of the above models on the coupling of contextual cueing in visual search and explicit memory tasks.60 participants took part in the experiment . All reported normal or corrected-to-normal vision and were na\u00efve as to the purpose of the study. The study was approved by the Ethics Committee of the LMU Psychology Department in accordance with the Declaration of Helsinki, and all procedures were carried out in accordance with the declaration\u2019s guidelines and regulations. Participants provided written informed consent prior to the experiment and received either course credit or payment of 9 Euro (~\u200910 USD).2; size: 0.55\u00b0\u2009\u00d7\u20090.55\u00b0) presented on a white screen background (25.40\u00a0cd/m2). There were 11 L-shaped distractor items which were rotated by angles of 0\u00b0 (\u2517), 90\u00b0 (\u250f), 180\u00b0 (\u2513), or 270\u00b0 (\u251b), and one T-shaped target item, which was rotated by either 90\u00b0 (\u252b) or 270\u00b0 (\u2523). Items were placed on four imaginary concentric circles around the center of the display, with radii of 2.19\u00b0, 4.10\u00b0, 6.60\u00b0, and 8.80\u00b0, respectively. Items were positioned such that there were at least three items in each display quadrant. Target locations (in repeated and non-repeated displays) were pseudo-randomized such that targets appeared equally often on ring 2 versus ring 3, in the left versus right display half, and in the upper versus lower display half.The experiment was conducted on a Windows PC with purpose-written experimental control software (in C++). Participants sat in a dimly lit laboratory in front of a 19-inch CRT monitor  with a resolution of 1024\u2009\u00d7\u2009768 pixels (refresh rate: 85\u00a0Hz) at a viewing distance of 57\u00a0cm. Search displays contained 12 black items  in the center of the computer monitor for a variable time interval of 700\u20131500\u00a0ms. After a blank interval of 20\u00a0ms, the search displays appeared. Each display was presented until observers made a speeded response (or a maximum display duration of 5000\u00a0ms had elapsed) by pressing the right or left arrow key of the computer keyboard depending on the corresponding orientation of the target . Correct responses were followed by a blank screen of 500\u00a0ms. In case of response errors, a warning message (\u201cFehler\u201d\u2014German word for error) appeared on the screen for 1000\u00a0ms, which was followed by a another (blank) interval of 1000\u00a0ms until the next trial began. The visual search task comprised 576 trials, divided into 36 blocks of 16 trials each. In each block, there were eight repeated displays together with eight non-repeated (baseline) displays. The repeated displays were identical for all participants and generated at the beginning of the pilot studies (see below). Non-repeated displays were generated anew on each trial. Targets appeared at a fixed set of 16 locations throughout the entire experiment: 8 locations were used for repeated displays, and 8 (other) locations for non-repeated displays. With the latter, we controlled for target location repetition effects across the two types of displays. Thus, any beneficial effects arising from repeated displays could only be attributed to the effects of repeated distractor-target contexts rather than absolute target positions in these displays.Each trial started with the presentation of a black fixation cross  and was performed in close succession to the search task. Each block had eight repeated displays from the search task and eight newly composed (foil) displays, presented in random order. Note that the new displays were also repeated across consecutive blocks of the yes/no task. This manipulation allowed us to equate stimulus repetitions across the two types of  display, so that learning within the yes/no task could itself not improve recognition performance. Each display contained 11 letter \u201cL\u201d distractors  and one (90\u00b0 vs. 270\u00b0) letter \u201cT\u201d target. Participants were asked to indicate whether or not they had seen a given display during the previous search task by pressing the corresponding (Y or N) key on the computer keyboard. Recognition responses were non-speeded and no error feedback was provided.The target-quadrant generation task followed the search task and again consisted of 128 trials . Each block had 8 repeated displays (from the search task) and 8 newly generated (foil) displays. The foil displays were also repeated throughout the generation task, again in an attempt to control learning within the test itself. Further, in foil displays, the distractors substituting the target were also shown at a fixed set of 8 locations (previously used in the search task).Participants were informed that they would again see the repeated displays from the previous search task (together with newly composed foil displays). However, this time the \u201cT\u201d target letter was replaced by a (randomly oriented) \u201cL\u201d distractor item. In response to the test display, participants\u2019 task was to indicate the quadrant in which (in the previous search task) the target \u201cT\u201d had been presented (now substituted by an \u201cL\u201d distractor item). Responses were given on the numeric keypad on the right-hand side of the computer keyboard, using spatially corresponding keys: \u201c7\u201d key for targets located in the top left display quadrant; \u201c9\u201d key for the top right quadrant; and the \u201c1\u201d and \u201c3\u201d keys for targets at the bottom left and right quadrants, respectively. Observers\u2019 responses were non-speeded. No error feedback was given.13 participants  took part in pilot study 1, the aim of which was to investigate which language terms people would use when describing patterns of dot stimuli. These patterns were identical to the eight repeated arrays used in the search/explicit memory tasks. Thus, the very same arrays were used to assess participants\u2019 subjective experience and contextual memory of these configurations  Inter-element grouping\u2014indicating whether speakers \u2018see\u2019 individual dots as aggregated in larger chunk or group/s of items; example descriptions are \u201cmany points but no overall gestalt\u201d, \u201cconnection\u201d, \u201cbisected\u201d, \u201cneed to encircle the dots in subsets\u201d. (3) Regularity\u2014signifying rules or principles that may have led to the construction of the patterns; example descriptions are \u201cthe dot patterns seem to be chaotic through and through\u201d, \u201cdeliberate and not accidental arrangement\u201d, \u201corderly chaos\u201d, or \u201cconfusion\u201d.Participants produced a total of 103 descriptions , which were then classified into broader categories by two experts involved in research on contextual cueing. The resulting classifications were compared and possible discrepancies were discussed with a third expert (TG) to arrive at a single solution. 102 of the original 103 descriptions (=\u200999%) could be classified into 3 larger categories: (1) figurative value of each individual pattern on a scale from 6 (high) to 1 (low). Sheet 2 required them to rate the inter-element grouping of each pattern from 6 (high) to 1 (low). On sheet 3, they had to judge the regularity of the composition the individual patterns using a scale from 6 (systematic) to 1 (random). Prior and during each rating, participants were presented (via video projection) with relevant category-specific example terms/descriptions obtained from pilot study 1 to ensure that they understood the concepts behind each scale. For each pattern and rating, participants were given a fixed time of 10\u00a0s (controlled by a stop clock) before being prompted  to move on to the next pattern. There was a 1-min break between the three subjective ratings.Another sample of 16 (different) psychology students  received the 8 spatial patterns and had to rate them according to the main categories derived from pilot study 1. This was done by presenting them with 3 sheets of papers , each containing the 8 patterns (presented in the same 4\u2009\u00d7\u20092 grid as in the pilot study 1). On sheet 1, participants were asked to rate the p\u2009<\u20090.01 . Given this finding, we compared the full\u20143-factor\u2014model with a constrained\u20142-factor\u2014model, the latter fitting (1) the ratings of symbolism and (2) the averaged ratings of inter-element grouping/pattern regularity . Model comparisons were realized using the Akaike information criterion (AIC)17, with lower AIC values signifying better model fit. The sub-model with factors for symbolism and (combined) regularity of spatial composition outperformed the full model: the AIC value was lower for the sub-model than for the full model, 892 versus 1413. Thus, according to (confirmatory) factor analysis, the two dimensions of symbolism and regularity of spatial composition suffice to describe participants\u2019 rating data. For this reason, we adopted the two-dimensional solution for describing participants\u2019 experiences of spatial patterns and the impact of these subjective factors on contextual cueing and explicit-memory performance. Participant ratings are summarized in Fig.\u00a0The data were then further evaluated by a (confirmatory) factor analysis, with participants ratings as rows and expert categories as columns. To quantitatively determine whether the experts\u2019 category solutions were acceptable, we compared a full factor model  with a model that constrained the number of underlying variables. The latter was based on an a-priori (correlation) analysis of observers\u2019 subjective rating data, which revealed the ratings of inter-element grouping and pattern regularity to have a significant positive relationship, r\u2009=\u20090.27, 2), and Explicit Memory Task . For the yes/no task, we compared observers\u2019 hit responses (correct judgement of repeated display as \u201crepeated\u201d) with their false-alarm responses (incorrect judgement of non-repeated display as \u201crepeated\u201d). For the target-quadrant generation task, explicit knowledge about repeated search arrays was assessed by comparing hit rates (correct detection of the quadrant of the substituted target) between repeated and non-repeated displays. Note that for both repeated and non-repeated displays, targets were substituted by distractors, with the distractors shown at the same fixed sets of 2\u2009\u00d7\u20098 target locations previously used in the search task.We recruited 60 new observers (who had not participated in any pilot study) for the main experiment (see above), consisting of one search and one explicit-memory task: either yes/no recognition or the target-quadrant generation; each 30 participants were randomly assigned to perform one or the other of the latter tasks. Prior to each task, participants received written instructions informing them about the respective task to be performed. For the explicit-memory (but not the search) tasks, the instruction included information about the fact that 50% of the display arrangements presented for recognition had previously been encountered repeatedly during the search task. All observers started the experiment with the visual search task and then went on to perform either the yes/no recognition or the target-quadrant generation task. The main experiment took some 50\u00a0min to complete. The experimental variables were Context , Epoch  function, where the critical parameter indicative of learning is provided by the (negative) exponent of this function. In the subsequent single-display analysis, we determined learnt displays by applying a two-parameter power function of the form 18) to RTs for each individual repeated display . Parameter i corresponds to the intercept of the RT\u2009\u00d7\u2009epoch function, and parameter s to the (negative) slope of the function; x represents the search epoch (1\u20136). After quantifying the slopes for each individual display (and observer), we calculated the difference in slopes between a given repeated display and the mean slope obtained from all non-repeated displays. This was based on the observation that in visual search tasks, RTs typically decrease with increasing epoch number for both repeated and non-repeated displays , while this practice-dependent RT facilitation is typically greater for repeated displays . When subtracting the (negative) exponents of the function relating RTs to epoch number between repeated and non-repeated displays, negative difference values would thus indicate \u2018true\u2019 context learning .Chun and JiangContextual learning of individual displays was also assessed in the explicit tasks. Specifically, for the yes/no task, contextual cueing was estimated by comparing the hit rate from each repeated display (correct recognition of repeated display as \u2018repeated\u2019) with the mean false-alarm rate obtained from all non-repeated displays (erroneous recognition of non-repeated displays as \u2018repeated\u2019). Explicit performance in the target-quadrant generation task was evaluated on the basis of the comparison between hit rates to individual repeated displays (correct judgement of the [substituted] target quadrant) with the mean hit rate obtained from non-repeated displays.20. In case of non-significant effects, Bayes analyses were performed in order to quantify the evidence for the null hypothesis. Bayes Factors were calculated using the package BayesFactor21. BF10 values lower than 1 provide weak evidence and values lower than 0.30 substantial evidence for the null hypothesis22. Error trials and trials with extreme RTs  were discarded . The first five trials in the search and explicit memory tasks served as practice trials (data not recorded).Data analysis was performed using Rp\u2009<\u20090.05 (significant context\u2009\u00d7\u2009epoch interaction). The magnitude of contextual cueing (RT non-repeated display minus RT repeated display) in the first half of the experiment (epochs 1\u20133) was 30\u00a0ms, which compares with an effect of 45\u00a0ms in the second half \u2009=\u20092.51, p\u2009<\u20090.01, Cohen\u2019s d\u2009=\u20090.32, 95% CI ). Importantly, contextual cueing effects were statistically indistinguishable between observers who later participated in the yes/no and, respectively, the generation task, F\u2009=\u20091.40, p\u2009=\u20090.22, BF10\u2009=\u20090.14 (non-significant context\u2009\u00d7\u2009epoch\u2009\u00d7\u2009group interaction): the mean contextual-cueing effect was 38\u00a0ms for observers who performed the yes/no task \u2009=\u20095.05, p\u2009<\u20090.01, Cohen\u2019s d\u2009=\u20090.26, 95% CI ), and 37\u00a0ms for observers who completed the generation task \u2009=\u20095.21, p\u2009<\u20090.01, Cohen\u2019s d\u2009=\u20090.29, 95% CI ). Thus, it is unlikely that differences in the ability of the two memory tests to reveal evidence for explicit cueing is attributable to differences in the overall strength, or magnitude, of contextual facilitation achieved in the search task. See also Fig.\u00a0Repeated displays elicited faster RTs than non-repeated displays, an effect that became more pronounced as the experiment progressed, F5,290)\u2009=\u20093.78, 90\u2009=\u20093.78p\u2009=\u20090.08, Cohen\u2019s d\u2009=\u20090.28, 95% CI , though there was only inconclusive evidence for the null hypothesis, BF10\u2009=\u20090.82.In the yes/no recognition test, conducted after the search task, the hit rate (correct recognition of repeated displays as repeated) was higher than the false alarm rate (erroneous recognition of non-repeated display as repeated), 49.9% versus 46.2%, one-tailed t(29)\u2009=\u20091.80, p\u2009<\u20090.01, Cohen\u2019s d\u2009=\u20090.69, 95% CI .For observers who performed the target-quadrant generation task, the ability to consciously recollect a repeated display was assessed by comparing their hit rates between repeated and non-repeated displays. A hit means that observers correctly indicated the quadrant of the substituted target. Since observers could solve this task only by chance in non-repeated displays , chance performance in the memory test is indicated by comparable performance between the repeated and non-repeated conditions. However, a one-tailed t-test confirmed the hit rate to be significantly higher for repeated than for non-repeated displays: 31.8 versus 27.7%, t(29)\u2009=\u20093.01, p\u2009=\u20090.39). This suggests that, in principle, both tests have power to reveal evidence of explicit memory for repeated displays. Since the recognition and generation tasks differed with regard to baseline\u2014chance\u2014performance (50 vs. 25%), in order to ensure comparability between the two types of test, we normalized test performance by relating individual participants\u2019 scores to chance performance. That is, for the recognition task, we first computed a difference score  for each participant and then divided this score by her/his false-alarm rate (=\u2009baseline performance). For the generation task, scores were obtained by calculating the difference between individual participants\u2019 hit rate for repeated displays and their hit rate for non-repeated displays and dividing this score by their hit rate for (baseline) non-repeated displays. The normalized effect scores were 0.18 and 0.09 for the generation and yes/no tasks, respectively; that is, compared to the yes/no task, the generation was able to detect twice as many responses as being driven, or \u2018facilitated\u2019, by explicit context memory. Again, however, the difference was not significant .Although the effect size was numerically greater in the generation versus the recognition test (0.28 vs. 0.69), the difference was not significant . Reliability coefficients were calculated by dividing the (128) explicit-memory trials into four epochs  so as to obtain reasonably stable estimates of conscious display recognition in each epoch (consisting of 2\u2009\u00d7\u20098 old and 2\u2009\u00d7\u20098 new displays). This yielded four recognition scores per participant , which were then divided into two halves using an odd\u2013even split and correlations were computed.Interestingly also, the two explicit measures of contextual facilitation were unaffected by test precision: mean split-half reliability estimated by the Spearman\u2013Brown formula was 0.61, and this measure was near-equivalent for recognition and generation, r\u2009=\u20090.61 and r\u2009=\u20090.62, respectively  accuracy measures presented above, namely, that the generation test has higher diagnostic accuracy than the recognition test in revealing evidence of explicit cueing.Another strong prediction following from single-memory accounts is that different measures of contextual memory should exhibit a significant positive correlation. Indeed, as can be seen from Fig.\u00a0search task yielded significant (linear) regression models: F\u2009=\u20094.06, p\u2009<\u20090.01 for the yes/no group, and F\u2009=\u20095.08, p\u2009<\u20090.01 for the target-quadrant generation group. As summarized in Table p values were quite high (>\u20090.18), that is, they bore no systematic relationship with the contextual-cueing effect obtained in the search task. Significant regression models were also found for explicit-memory performance: yes/no recognition, F\u2009=\u20092.47, p\u2009<\u20090.05, target-quadrant generation, F\u2009=\u20097.13, p\u2009<\u20090.01, though these model fits were qualitatively different from those in the search task. In more detail, explicit memory performance correlated significantly with the subjective display parameter of symbolic value , in both the yes/no recognition task and the target-quadrant generation tasks  and the subjective parameters  on contextual cueing during the An alternative way to look at the data is to compare multiple-regression models with different underlying factors and examine which model/s best fit contextual facilitation in the search and explicit-memory tasks. In doing so, we also tested another class of\u2014mixed\u2014regression models, in addition to \u2018standard\u2019 models, allowing the models\u2019 intercept to vary across different repeated displays (and participants). This mixed-model approach appears justified given the same set of (eight) repeated displays was used in the current study\u2014thus, measures of contextual facilitation may be bound to these displays (and participants). Effectively, in the mixed-effect models, we treated individual repeated displays and participants as random factors; the fixed factors were our objective and subjective displays parameters.Figure\u00a0search task, a model comparison demonstrated that sub-models with (only) target-to-center distance and horizontal position outperformed the full baseline model. This effect was seen with both  regression baseline models. Concerning performance in the explicit-memory tasks, almost all sub-models had higher AIC values than the full baseline models (meaning that the full baseline model outperformed the sub-models), except the sub-model with target-center distance, height:width ratio, and figurative value, which performed better than the (standard-regression) baseline model.For contextual facilitation in the In sum, analysis of the relationship between display properties and contextual cueing demonstrates that one set of\u2014objective\u2014display features is responsible for cueing in search tasks, while both sets of\u2014objective and subjective\u2014features influence performance in the explicit-memory tasks. For observers who performed the target-quadrant generation task, there was also a correspondence in the objective display feature of target-center distance, which could be used to predict contextual cueing in both the search and explicit-memory tasks. These findings were validated by a systematic regression-model comparison approach, which showed that sub-models involving the factor target-center distance outperformed the (full-factor) baseline models in the search and generation tasks.Contextual cueing refers to expedited visual search in repeated stimulus configurations. Despite this RT facilitation, observers seem to be poor in discerning the repeated patterns in (surprise) recognition tests performed immediately after the search task. This dissociation has been attributed to distinct unconscious and conscious memory systems driving search and recognition, respectively.To distinguish between two- and one-system accounts of memory in contextual cueing, we used the novel approach of systematically testing the relationship between context-based RT facilitation in the search task and participants\u2019 awareness of repeated search arrays in the memory task. Further, we compared and contrasted two statistically powerful explicit tests that hitherto have been used only in isolation: a yes/no recognition test and target-quadrant generation test. Furthermore, we evaluated the spatial properties of individual repeated arrays using objective and subjective descriptors and determined contextual-facilitation effects in search and explicit-memory tasks at the level of individual repeated arrays. This enabled us to test predictions about the relationship between measures of contextual facilitation obtained in the search and memory tasks, as well as examining for common versus separate regression coefficients for contextual- facilitation effects in these tasks.4. Accordingly, the generation test appears particularly apt in revealing explicit memory of repeated distractor-target arrangements in search tasks.Overall, our findings are in line with predictions derived from a one-system account. There was a search advantage for targets in repeated as compared to novel displays. This advantage was also observable in the target-quadrant generation (memory) task: observers were able to discriminate the quadrant of the substituted target in repeated displays well above chance level. Further, there was a significant correlation between measures of contextual facilitation in the search and explicit target-quadrant generation tasks. Additional linear-regression analysis revealed that this correlation was likely due to the search and generation tasks receiving support from common context representations relating to the placement of the target at more central versus more peripheral display locations. In contrast, signal-detection measures of explicit-memory for repeated displays and correlations between contextual facilitation in the search and memory tasks were less pronounced overall for the yes/no recognition test, even though this test was statistically as powerful as the quadrant-generation test 25. According to this framework, the \u2018success\u2019 of the single memory system in facilitating conscious performance critically depends on the match of information required in the search and conscious-awareness tasks. The superiority of generation over recognition performance would then be attributable to greater similarity in terms of the processing requirements between the initial search and the subsequent memory task. In both tasks, observers had to localize the (substituted) target of their search; that is, both tasks rely on the same target-position-related mental knowledgebase.The differential power of the two tests to reveal evidence of explicit contextual facilitation may be best understood within the transfer-appropriate processing (TAP) framework26, the idea being that repeated encounters of a stimulus on a later occasion induce subjective fluency, which suffices to judge this stimulus as old. Successful recognition may thus be supported by (fluency) processes that are different from the contextual representations facilitating reaction times and accuracy in the visual search (and the target-quadrant generation) task. Consistent with this, the regression analysis presented above indicated that successful recognition was influenced, or driven, by perceptual properties of the to-be-judged test displays, such as the figurative value of the test displays or the regularity of their composition, which were, however, qualitatively different from the objective parameters that drove performance in the search task.In the yes/no recognition task, by contrast, observers encounter test displays in which all items, the target as well as the distractors, are visible and they have to simply indicate whether they believe they had seen a given display already during the previous search task. Given that a target is present in the (yes/no) test display, a recognition response may be given on the basis of other processes than those at work in the actual search and the target-quadrant generation task. For instance, observers may rely on their familiarity with the test displays. This is a kind of mere-exposure effect29. Assuming that the encoding of potentially search-guiding distractor-target relations occurs at the time point at which the target is detected30, it is not surprising that observers develop such more local context representations. Since we imposed no constraints on how our participants performed the search31, it is likely that they scanned the displays with a relatively narrow focus of attention, thus acquiring the local target context. The quadrant-generation task reinstated this local attentional set (scrutinizing the item arrangement within each quadrant to determine which one might have contained a target in the previous search), thus aiding the retrieval of the acquired, local context representations. However, it is also possible to make participants perform the search with a more distributed attentional set, which has been shown to foster the learning of the more global item arrangements15 see also Refs.35. It is conceivable that when contextual learning takes place with a more distributed attentional set , global organizational properties of the search displays become more prominent in the acquired memory representation, so that the yes/no recognition test  may outperform a target-quadrant generation test. Finding such a complementary pattern to that demonstrated in the present study would add support to a TAP-based account of conscious recognition performance.Of note, the above account in terms of the TAP framework is only a post-hoc attempt to coherently explain the current findings. However, it makes predictions that can be tested in future research. Prior (eye-movement) studies have shown that, in the standard \u201cT\u201d versus \u201cL\u201d search task , the contextual-cueing effect typically arises from the learning of only a few distractors within the local vicinity  of the target36. Applying this notion to the present visual-search and generation-test scenario: distractor-target representations will, at a first stage, be retrieved rapidly and automatically from long-term context memory, without conscious awareness\u2014leading to contextual facilitation in the search task. This is followed by second, slower, retrieval stage at which memory contents become consciously accessible and can thus inform explicit responses. These accounts attribute an important function to focal attention in the transition of information from the first to the second stage, with attention enhancing  memory signals in the same way as it enhances the processing of external stimuli. Given that performing the generation task requires attentional scrutiny of the various display quadrants, it is conceivable that memory representations associated with the local target quadrant  are amplified by focal attention above some threshold for conscious report10. This would apply less to the yes/no recognition task, in which focal attentional engagement would be lower overall. A comparison of the response times in our two explicit-memory tasks provides tentative evidence for this idea: although participants were not instructed to respond as fast as possible, they took considerably longer to make their decisions in the generation, as compared to the recognition, task: 3,961 versus 2,319\u00a0ms, t(39.38), p\u2009<\u20090.01, Cohen\u2019s d\u2009=\u20090.85, 95% CI , consistent with increased attentional processing in the former task. Accordingly, focal-attentional scrutiny may boost (conscious) remembering.\u2014We acknowledge, though, that the role of focal attention in mediating conscious retrieval of learnt distractor-target relations needs to be corroborated in purpose-designed research.Although the present results favor a one-system account of contextual cueing, they are consistent with variants of this account that  posit the involvement of functionally independent\u2014un-/conscious\u2014retrieval operations37. Prior studies were inconclusive as to whether contextual learning involves an implicit or an explicit memory system, though the balance of evidence suggested a role of consciously accessible memory in contextual cueing10. Here, we show that (success in) revealing explicit knowledge of distractor-target relations  critically depends on the type of explicit-memory test employed: active \u2018quadrant-generation\u2019 tests are superior to passive \u2018yes/no recognition\u2019 tests. These results have implications for the memory architecture underlying context effects in visual search and explicit recognition. In particular, we suggest that both objective  and subjective  display properties come to be integrated in the memory for distractor-target relations during the search task. Because of this, significant correlations between different measures of the cueing effect obtained in search and explicit-memory tasks heavily rely on the specificity of the explicit test. The \u2018target-quadrant generation\u2019 and \u2018yes/no recognition\u2019 tasks involve different processing requirements and thus benefit from different types of\u2014more spatial versus more conceptual\u2014contextual information, where facilitation of search is predicted  by the more spatial factors. Given this, future studies would be well advised to employ an explicit generation task that matches the typical, spatially focused processing requirements of the search task in order to investigate the memory representations underlying contextual cueing.Contextual cueing is an important predictive-coding mechanism, helping us to rapidly detect and respond to target objects in recurrent scenes"}
+{"text": "Moreover, CHD1 deletion predicts shortened BCR-free survival in pT2 patients and cancer-specific survival in all patients. In vivo, CHD1 loss increases spontaneous pulmonary metastasis formation in two distinct PCa models coupled with a higher number of multicellular colonies as compared to single-cell metastases. Transcriptome analyses revealed down-regulation of the PCa-specific metastasis suppressor and TGF\u03b2 signaling regulator PMEPA1 after CHD1 depletion in both tested PCa models. CHD1 loss increases the risk of postoperative metastasis in R0-resected PCa patients and promotes spontaneous metastasis formation in vivo.The outcome of prostate cancer (PCa) patients is highly variable and depends on whether or not distant metastases occur. Multiple chromosomal deletions have been linked to early tumor marker PSA recurrence  after radical prostatectomy (RP), but their potential role for distant metastasis formation is largely unknown. Here, we specifically analyzed whether deletion of the tumor suppressor CHD1 (5q21) influences the post-surgical risk of distant metastasis and whether CHD1 loss directly contributes to metastasis formation in vivo. By considering >6800 patients we found that the CHD1 deletion negatively influences metastasis-free survival in R0 patients (HR: 2.32; 95% CI: 1.61, 3.33;  The clinical behavior of prostate cancer (PCa) ranges from slowly growing indolent tumors to highly aggressive metastatic disease and accordingly leads to variable clinical outcomes for patients. While clinical factors, such as Gleason Score and prostate-specific antigen (PSA) levels, have proven useful for risk stratification and in guiding treatment decisions about PCa, significant clinical heterogeneity remains . Thus, tDeletions in chromosome 5q21 are among the most frequent ~10%) chromosomal deletions in PCa and include the gene for chromodomain-helicase-DNA-binding protein-1 (CHD1). CHD1 acts as a chromatin remodeling protein that directs lineage-specific transcription and keeps DNA regulatory regions in an open and transcriptionally active state , 10. In % chromosFrom a clinical perspective, the loss of CHD1 has been found to correlate with higher Gleason grade, tumor stage, and postoperative biochemical relapse (BCR) in a cohort of more than 2000 PCa patients and suggested as a predictor for poor prognosis . Recent Although considerable interest in the prognostic and therapeutic potential of CHD1 deletion in PCa is currently growing, the potential implications of CHD1 deletion for distant metastasis formation that are responsible for cancer-specific death in PCa patients remain to be determined.In this study, we investigated an expanded cohort of more than 6800 PCa patients who underwent radical prostatectomy (RP) to determine by multivariate analyses the potential influence of the CHD1 deletion on the postoperative metastasis-free survival (MFS), BCR-free survival, and cancer-specific survival (CSS). To assess the potential functional role of CHD1 for metastasis, we investigated whether CHD1 loss promotes distant metastasis formation in vivo by using xenograft mouse models that reflect the entire metastatic cascade and develop spontaneous micro-metastases in the lungs of immunodeficient mice. Finally, RNA sequencing was performed to identify at the transcriptome level novel candidates that may explain the effect of CHD1 loss on PCa metastasis.n\u2009=\u2009502), implausible values (n\u2009=\u200957), and incomplete follow-up data (n\u2009=\u2009512) were excluded resulting in 6831 patients available for adjusted survival analyses. Baseline characteristics of the study population are summarized in Table For the present study, fluorescence in situ hybridization (FISH) data for CHD1 were available from 7902 patients who underwent RP at our institution . By combining the FISH dataset with the clinical outcome database we determined the predictive value of the CHD1 deletion for the oncological outcome after RP. Patients with (neo)adjuvant androgen deprivation therapy  while control xenografts mainly developed single-cell metastases . Further samples of single disseminated tumor cells (DTC) and multicellular colonies in the lungs are shown in Suppl. Fig. SBased on our clinical analyses, we next determined the functional role of CHD1 depletion for metastasis formation in vivo using ARCAP-M as well as PC-3 xenografts Fig. . XenograIn order to elucidate the underlying molecular effects eliciting the phenotype of increased spontaneous lung metastasis in vivo, which was common among both tested models after CHD1-KD, ARCAP-M and PC-3 control and CHD1-KD samples were analyzed by RNA-seq. As illustrated in Fig. In sharp contrast to our in vivo findings, in vitro assays for tumor cell proliferation and metastatic properties rather indicated less metastatic potential of CHD1-KD PCa cells. In particular, there was no difference in cell proliferation under conventional cell culture conditions 2D)  alone has no significant influence on MFS or CSS, which might explain why the percentage of N+ patients is not increased in the CHD1-deleted subset. These findings suggest that lymph node and distant metastasis formation are not necessarily related to each other, which is supported by the literature . In siliInterestingly, the number of pulmonary metastases was significantly increased after CHD1-KD in two spontaneous metastasis PCa xenograft models, resembling the predictive value of CHD1 deletion for poor oncological outcome in the clinical setting. The PC-3 model represents AR-negative, PTEN-deleted PCa while ARCAP-M represents AR-positive, PTEN-wildtype PCa. Therefore, the increase in metastasis upon CHD1 loss was observed irrespective of the AR and PTEN status. Further studies are required to determine whether the prognostic role of CHD1 loss is independent of the AR signaling activity and PTEN status in patients since recent publications indicate a close relationship between CHD1 and AR, CHD1 and resistance to AR-targeted therapy as well as CHD1 and PTEN \u201324. In aHistological examinations of the lungs revealed a change in the morphology of spontaneous metastasis where, consistent with previous studies , the preTranscriptome analyses of 3D tumoroids revealed down-regulation of PMEPA1 upon CHD1-KD in both tested models. PMEPA1 is a known suppressor of PCa metastasis that regulates TGF-\u03b2 signaling, a well-known determinant of metastasis . AccordiMoreover, this study is limited by the lack of transcriptome data from the xenograft primary tumors (due to a high proportion of necrotic areas in ARCAP-M xenografts). Therefore, the transcriptome data revealed in this study  cannot be directly linked to functional data. Nevertheless, the emerging picture of increased TGF-\u03b2 signaling in the CHD1-KD tumoroids could be validated by increased pSMAD2 levels in the corresponding xenograft tumors of both models. Of note, PMEPA1 is also a direct AR target gene  and CHD1Our data show that determining the CHD1 deletion status in surgically treated patients helps to predict the risk of metastasis in R0 patients independent of established clinico-pathologic parameters such as preoperative PSA, pT stage, pN status, Gleason Score, and BCR. As a possible explanation we demonstrate improved metastatic outgrowth in CHD1-depleted human PCa xenografts. Transcriptome analyses uncovered candidate molecules known to regulate PCa metastasis formation that were affected by CHD1 depletion.n\u2009=\u20097 902). Patients with (neo-)adjuvant androgen deprivation therapy (n\u2009=\u2009502) and implausible values (n\u2009=\u200957) were excluded from analyses. For construction of PCa prognosis tissue microarrays (TMA), please see previous publications [Patients underwent RP between 1998 and 2012 using an open retropubic approach or robot\u2010assisted laparoscopic approach , and categorical variables are represented as frequencies and percentages. Because death was present as a competing risk, we used cause-specific Cox proportional hazards models to determine the effect of CHD1 on the three outcomes time to BCR, time to metastasis, and time to cancer-specific death. All models were further adjusted for age, PSA, Gleason Score, pN status, pT stage, year of RP, and surgical margin. For time to metastasis and time to cancer-specific death, preceding BCR was a further adjusting variable. Moreover, all significant two-way interactions of CHD1 with adjusting variables were added and kept in model if significant (backwards selection based on likelihood ratio tests). Results are presented as cause-specific HR together with 95% confidence intervals (CI). We assessed proportional hazards assumption by visual inspection of log\u2013log plots and tested it on the basis of Schoenfeld residuals. As the proportional hazards assumption was violated for the year of surgery, all models were stratified for categorized year of surgery.For the outcomes of in vivo studies, linear models were used with inclusion of interaction term (shNeg/shCHD1*PC-3/ARCAP-M) if significant and adjustment for growth period, tumor weight and number of CTC where applicable and significant.p\u2009<\u20090.05 was considered to be statistically significant. All analyses were performed using STATA 16 (StataCorp 2019).All models present available case analyses. A two-tailed The molecular database of the Institute of Pathology of UKE included FISH data for the CHD1 deletion status, which were used for statistical analyses. Sample collection and FISH methodology on TMAs have been described before and were approved by the local ethics committee  . FISH onPC-3 and ARCAP-M cells were obtained from ATCC and Novicure, respectively, and cultured as described before . Cells wn\u2009=\u20099 per group in the PC-3 model, n\u2009=\u20097 per group in the ARCAP-M model) as previously described [CHD1-KD and control PC-3 and ARCaP-M cells were subcutaneously xenografted into immunodeficient pfp\u2212/\u2212/rag2\u2212/\u2212 mice and primary tumors, blood and lungs were harvested as described before , 38. Theescribed . Histoloescribed . Pulmonan\u2009=\u20093 each). Established tumoroids were subjected to RNA extraction and RNA sequencing was performed as described [q-value <\u20090.05). For validation, reverse transcription was performed using the Qiagen Omniscript RT Kit and PCR was performed with SsoFast EvaGreen Supermix on a CFX96 System . Primer sequences for RUNX3 were fw-GACTGTGATGGCAGGCAATG and rev-GGGTGAAACTCTTCCCTCGC, for PMEPA1 fw-GCAACTGCAAACGCTCTTTGT and rev-GGACCGTGCAGACAGCTTGTA. Gene expression was normalized to a control gene (SNRPD3) and displayed normalized to shNeg controls.3D tumoroids were generated by cultivating PC-3 and ARCAP-M cells with or without CHD1-KD in poly-HEMA-treated cell culture flasks  antibody (Merck#ab3849-I) in a 1:640 working dilution . Dewaxed formalin-fixed paraffin-embedded sections were pre-treated with Fast Enzyme  for 5\u2009min at room temperature. The primary antibody was incubated for 60\u2009min at room temperature and unbound antibody was removed by multiple washing steps afterwards. Biotinylated swine-anti-rabbit was used as secondary antibody; antibody complexing, visualization, nuclei counterstaining, and isotype controls were conducted as described above.Supplementary InformationSupplementary Figure S1Supplementary Figure S2Supplementary Figure S3Supplementary Figure S4Supplementary MaterialSupplementary MaterialSupplementary MaterialSupplementary Materialuncropped WBCt values qPCR RUNX3Ct values qPCR PMEPA1a"}
+{"text": "In the late 1970s, case reports indicated that some people were sensitive to wheat but did not have coeliac disease (CD) . This coAutoimmune diseasesOver a period of twelve months, 486 patients were identified with NCGS from centres\u00a0in Italy . The diaAnother study from Italy investigated the prevalence of autoimmune disorders among a retrospective group of 131 patients and a prospective group of 42 cases with NCWS . The diaThe frequency of autoimmune disorders was determined in 91 patients with NCWS, 76 blood donors, and 55 individuals with IBS . Of thosNeuropsychiatric disordersThe most common neurological disturbance found among a group of 334 patients with NCGS was peripheral neuropathy (54%), followed by cerebellar ataxia (46%) and encephalopathy (10%) . These cWhether gluten might affect mental state in NCGS was addressed in a study of 22 patients with IBS but without CD, whose symptoms were controlled on a GFD. These patients were given three dietary supplement challenges of gluten, whey, and placebo (diet not supplemented) each for 3 days followed by a wash-out period . Gluten HeadachesThe prevalence of headaches comprising migraine, tension headache cluster headache, hemicrania continua, and trigeminal neuralgia, was determined in 188 patients with CD, 25 with gluten intolerance, 111 with inflammatory bowel disease, and 178 control subjects . This waFibromyalgiaFibromyalgia is a debilitating condition of unknown cause with symptoms that include chronic pain, sleep disturbance, irritability, poor concentration, and fatigue. Symptomatic treatments are only partially effective. Twenty patients with this condition, in whom a diagnosis of CD was excluded by negative anti-tissue transglutaminase antibody results and no villous atrophy in duodenal biopsies, were given a GFD . In all Low back painA hypothesis was advanced that NCGS may be associated with chronic low back pain related to spondyloarthritis which may be alleviated by a GFD , 27. OneReproductive system The frequency of gynaecological\u00a0symptoms and recurrent cystitis was evaluated in 68 women with NCWS diagnosed by a double-blind placebo-controlled wheat challenge . ControlMost of those with NCWS (59%) admitted having gynaecological\u00a0symptoms, which is significantly more than for the other groups. Menstrual irregularities were significantly more common in patients than in the controls, and patients suffered significantly more from recurrent vaginitis and dyspareunia. Recurrent cystitis was significantly more frequent in the NCWS group (29%) than in the other groups. Of interest, recurrent vaginitis and cystitis were not associated consistently with infection, and this is still to be explained. On a wheat-free diet for twelve months, menstrual problems resolved in 46% and recurrent vaginitis in 36% of cases. Further evaluation of gynaecological\u00a0disorders by means of a wheat-free diet is warranted. Cutaneous disordersDermatitis was present in 18% of patients with a presumptive diagnosis of NCGS . SeventeA brief account of co-morbidities associated with NCGS is presented. The list of conditions, already impressive, will undoubtedly lengthen as time goes by. Awareness that wheat sensitivity might account for unexplained symptoms in some individuals without CD or wheat allergy that may resolve on a GFD is important if optimum care is to be provided for a growing cohort of patients.The authors declare that they have no conflict of interest."}
+{"text": "The aim of this study was to develop and evaluate a machine vision algorithm to assess the pain level in horses, using an automatic computational classifier based on the Horse Grimace Scale (HGS) and trained by machine learning method. The use of the Horse Grimace Scale is dependent on a human observer, who most of the time does not have availability to evaluate the animal for long periods and must also be well trained in order to apply the evaluation system correctly. In addition, even with adequate training, the presence of an unknown person near an animal in pain can result in behavioral changes, making the evaluation more complex. As a possible solution, the automatic video-imaging system will be able to monitor pain responses in horses more accurately and in real-time, and thus allow an earlier diagnosis and more efficient treatment for the affected animals. This study is based on assessment of facial expressions of 7 horses that underwent castration, collected through a video system positioned on the top of the feeder station, capturing images at 4 distinct timepoints daily for two days before and four days after surgical castration. A labeling process was applied to build a pain facial image database and machine learning methods were used to train the computational pain classifier. The machine vision algorithm was developed through the training of a Convolutional Neural Network (CNN) that resulted in an overall accuracy of 75.8% while classifying pain on three levels: not present, moderately present, and obviously present. While classifying between two categories (pain not present and pain present) the overall accuracy reached 88.3%. Although there are some improvements to be made in order to use the system in a daily routine, the model appears promising and capable of measuring pain on images of horses automatically through facial expressions, collected from video images. Recognizing pain correctly in animals is essential in order to guarantee their welfare and to provide successful and rapid treatment when needed , 2. UntrEvaluating pain correctly can be a challenging task. It requires ability and training from the observer in order to detect pain-related changes in behavioral or physiological parameters of the animal . In addiFacial cues are used in order to assess pain and other emotional states in humans, mostly on patients that are unable to verbalize to their doctors what they are feeling, such as infants and patients with cognitive impairment, for example , 5, 6.The study of facial expressions initially proposed by Charles Darwin showed that there are similarities in the facial expressions of humans and non-human animals . Beyond The systematic use of facial expressions as a tool to assess pain in non-human animals was initially proposed in 2010 when a mouse grimace scale was developed , 11, 12.The use of automated systems in veterinary practice, animal behavior assessment, and breeding systems has increased, with emphasis on, among others, the use of machine vision that associates image capture sensors with algorithms using Artificial Intelligence methods, such as those belonging to the Machine Learning framework tools \u201319. Due Given this background, the aim of this study is to develop a computational automated classifier capable of detecting pain in horses using cameras in order to capture and evaluate their facial expressions based on the Horse Grimace Scale .The methodology followed the steps presented in the flowchart . Seven hVideo images were collected from seven horses of approximately one year of age  that underwent routine surgical castration, for management reasons, unrelated to the current experiment. Castration was requested by the University of S\u00e3o Paulo, owner of the animals, that gave to the experimenter\u2019s permission to collect video data. The surgical procedure followed the standard protocol for sedation, analgesia, anesthesia and pain management carried out at the veterinary hospital of the School of Veterinary Medicine and Animal Science of the University of S\u00e3o Paulo . The horThe animals were monitored side by side inside the feeder station using a camera system positioned in front of the feeder, for two days before and four days after the procedure, at four distinct time points of the day: 7 am, 10 am, 12 pm and 4 pm, aiming to capture images of the animals while presenting distinct levels of pain. The images collected resulted in 320 videos of 30 minutes each, acquired using Intelbras VHD 1220 B\u2013G4 Multi HD cameras.All the animals were treated with the same postoperative treatment, which included systemic administration of benzathine penicillin , flunixin meglumine , and anti-tetanus serum . The post-castration follow ups were carried out in the morning (7 am) and in the afternoon (12 pm), before the video recordings. The scrotum wounds were washed with soap and water and treated with penicillin-based ointment twice a day. The protocol was reviewed and approved by the Ethical Committee on the use of animals (CEUA number: 6603170419). All the animals filmed were property of the University of Sao Paulo and the written consent for this study was obtained.The videos were processed through App. 1 in order to automatically detect motion and extract frames (images) of each horse at different moments, resulting in 185672 images. Then, 3000 images were selected manually by visual inspection in order to use only the ones that were in the right position, with a lateral view of the horse\u2019s head, in order to evaluate pain through facial expression Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0PartlyReviewer #2:\u00a0PartlyReviewer #3:\u00a0Partly**********2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #2:\u00a0NoReviewer #3:\u00a0N/A**********3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0NoReviewer #3:\u00a0Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0NoReviewer #3:\u00a0No**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a00.The manuscript presents and discusses the practical applicability of CNN for the automated detection of post-operation(castration) pain of horses. The work presented involved the design of a shallow 2-conv-layer CNN for the classification of manually cropped images of horse faces, extracted from videos recorded before and after the castration surgery. The importance and relevance of the work are properly outlined in the introduction. The work reported a significant performance enhancement with the ensemble prediction using voting system, compared to individual CNN trained on a single face region of interest (ROI).Nevertheless, the manuscript seems written in a hurry. Expression of sentences were not properly proof-read by the authors prior to submission.For example, in Lines 101-108 there are duplication and badly organized phrases. Lines 133-137 are of different font than the other paragraphs.However, there could still be valuable research contributions with following questions addressed, which have arised in the review process. In addition, the HGS-labelled image dataset generated in this study could potentially chip in to enhance the variation of publicly available HGS dataset for research.Question 1:Lines 126-130:How do 7 horses, for (2+4) days, for 4 times a day, result in 1252 videos?(7 horses x 6 days x 4 times/day = 168 videos) Were multiple recording cameras used for every horse?Question 2:It is commendable and helpful for reviewing that the authors have clearly provided the details like the CNN architecture, CNN kernel size, and the width and height of input images in Table 2 and Table 3.Could the author explain why shallow CNN of only 2 convolutional layers were used? Couldn't a few additional convolutional layers benefit the feature extraction and abstraction capability of the model as the input are raw images and the output demanded is a highly abstract emotional expression of animal?Question 3:It is again commendable that authors honestly and clearly reported the low Recall performance for the presence of pain (esp. for the obvious pain) in each facial subcategory. This is important as the low recall indicates the failed detection of obvious pain which is of greater concern in pain management. This may reflect the insufficience of each individual facial category to serve in pain detection by the presented CNN model.Has the author not considered increasing the reliability of HGS with independent labelling performed by more than only one trained-observer (as reported in line 159)?Question 4:For contents in Lines 202-207 & Lines 252-259:Based on which image pool was the voting/ensemble model weight-tuned? Was it using the image pool that each member CNN of the ensemble model was trained on (as that presented in Table 1 & 3) or another separate image pool? Or was the weight-tuning also based on the pool of 30 images reported in Table 7 and Table 8 ? The authors has not explicitly reported the image dataset used for the ensemble/voting weight-tuning process.If this ensemble voting model with weight ratio of 3:1:1 for eye:ears:mouth&nostril is applied back onto the very original image dataset presented in Table 1 before these images are cropped into ROI, what is the performance of the model is terms of accuracy, precision and recall?The weight tuning process (which is a key step resulting in the pain classification performance surge) should be analyzed and discussed in greater details.Reviewer #2:\u00a0The paper aims at employing artificial intelligence in identifying the existence of pain and its level in horses. Although the problem addressed by the paper is exciting and carries great future potential in opening research avenues, the paper still needs much work to be publication worthy. I have the following concerns:1. The writing of the paper needs revision. There are many repetitions that should have been omitted after the authors decided on the final shape of the paragraph. The first paragraph of the data collection section (starting line 101) is a prime example. These are not style mistakes but rather genuine writing/editing flaws. See line 58.2. The authors need to enroll a computer science specialist with knowledge in AI. She/he will contribute to better experiments and to writing in the proper computer science jargon. This is a problem with the current manuscript as it is written by non-specialists.3. The data collection section, details of the drugs given are not necessary for the contribution of the paper .4. Section III.II, the number of images 185.000 should be written as 185000, and there is no need for approximately as this is a simple count. The exact number can be easily included.5. The authors need to elaborate more on the time and effort to inspect 185000 images to select 3000 of them (if not randomly). This does not seem right.6. The approach to select the proper images could be better than just inspecting the individual frames, which carry a lot of repetitions especially at 30 frames per second video rate.7. In general, the AI approach need to be driven by a computer scientist so that many of the issues in this paper could be ironed out. For example, the number of subjects  is too small and may lead to overfitting of the model.8. The font size in paragraph on line 133 need to be consistent with the paper .9. It is not clear how the system combines the result from the three body parts to form a judgement on pain. The current approach seems overly simple.10. Numbering of sections need to better.Reviewer #3:\u00a0The manuscript \u2018Pain assessment in horses using automatic facial recognition through deep learning-based modeling\u2019 is an interesting and timely manuscript. The results seem indeed promising to be able to record facial expressions of pain automatically and this is clearly worthwhile for practice.However, I believe some aspects need to be addressed with more detail and there are a couple of things I do not understand which may need clarification first before the manuscript may be accepted for publication in PLOS ONE.Below, you will find my arguments for the answers I have given to the questions that are part of the PLOS ONE review process and additional detailed feedback.Title: I am not sure recognition is the right word to use. To me facial recognition would be that a computer can identify animal 1 from 2 or can tell this is an ear or a mouth. But in this study the assessment was aimed to say that if the ear was positioned like this, there is no pain present. That seems to be something different?AbstractLine 2: \u2018The aim of the study was ....\u2019 instead of \u2018The aim of the study is ....\u2019?Lines 6 (and 60): Yes, clear that training is important for using the HGS. However, a computer model needs to be trained too and if this is done not properly, it does not really help us forward. So not sure to what extend a computer model is an advantage then?Lines 8 (and 64-66): True, but a person may not always be needed to be present? The animal can also be monitored from cameras for instance. So this is not always a problem for evaluation, I think.Line 15: \u2018process was applied\u2019 and \u2018methods were used\u2019 instead of \u2018.... is\u2019 and \u2018.... are\u2019? May apply at other sentences too.IntroductionLine 28:  instead of [1][2]Lines 33 and 56: A space is missing before the reference. Please check whether a space is missing at other places perhaps too.Line 55: The word \u2018if\u2019\u2019 is not needed, I think.Lines 59, 105 and 174: I think here is one space too many. Please check whether an extra space is present at other places perhaps too.Line 77: Full stop is missing after the references.Materials and MethodsLines 88 and 92: I am not sure I understand what the authors mean with application exactly. To be able to reproduce the study, more details on this method may be needed to give.Lines 101-105: Please check these lines as things are said twice here.Line 125: What was the total length of the castration procedure? May be good to add to show the reader it was done as quickly as possible.Line 130: \u2018videos of 30 minutes\u2019 instead of \u2018videos with 30 minutes\u2019?Line 130: With 1252 videos, this means you have about (1252 / 7 horses / 6 days / 4 time points =) 7 videos with a total of 3.5 hours of footage around a time point? That seems sufficient, I am just wondering how to visualize this so to say as there is for example only 2 hours in between time point 10 am and 12 pm. When was a video then considered to belong to a certain time point? Or do I not understand this correctly?Lines 133-137: Seems to be in a different letter font?Lines 135 and 137: May be good to add when exactly on a day this was done, as I think it should not have interfered with making the videos of Line 130?Lines 147-148: What is exactly part of the 4th and 5th parameter? You have to guess a bit where the 4th ends and the 5th begins.Line 157/Fig. 2: I would like to suggest to take another picture as example for the mouth and nostrils parameter for moderately present. As I do not really understand what I am looking at here, I am afraid. If possible, a more clear one as used for not present and obviously present would definitely help.Lines 159-161: Was the pain assessment solely based on the HGS? Or also based on other behavioral or physiological parameters? In other words, how did the authors know the horse was really in pain? The horses were given post-operative analgesia, so perhaps they did not feel so much pain? For training and testing a computer model this may not be such an issue, but for practice it is. The ears, for instance, could also be turned backwards due to focusing on a sound and not related to pain, and I think that such false warnings to the veterinarian or horse owner is not desired. Or it is the case that only if all three parameters are scored as pain present by the model, a warning is given?Lines 165-166: I am sorry, but I do not understand how the authors can have a final database of 4847 images if 3000 were selected in the first place? In addition, summing up 2379, 1436 and 1035, I get 4850 images. Somethings seems to be not entirely right here.Line 173: \u2018were built\u2019 instead of \u2018was built\u2019https://arxiv.org/pdf/1909.12605.pdf;https://www.nature.com/articles/s41598-020-70688-6;https://www.mdpi.com/1424-8220/19/5/1188/htm Perhaps it depends on what exactly the model needs to be trained in, but it may be good to add here why the authors know/feel these numbers are sufficient.Lines 177-181: I am not an expert on this yet, but what I learned is that others used much more images/frames for training (and testing) the model. Please see for instance: Line 195/Table 2: Fig. 5 is not included in the manuscript?Lines 202-203: More details on the voting process would be interesting and relevant to give with respect to be able to reproduce the study.Lines 205-206: \u2018Thus, a variety of ... was tested\u2019 instead of \u2018Thus, it was tested a variety of .....\u2019 makes more sense to me.Results and DiscussionLine 215: I would like to suggest to add \u2018obviously\u2019 to this line after \u2018being\u2019.Line 219: It took me some time to figure out where the numbers in Table 4 came from, until I realized that this was based on the test frames which was 237 images for the ears . It would be good to repeat that somewhere here, I think. Please, be precise and clear which numbers are total and which used for training, validation and testing as the numbers given in Lines 214-215 are the overall total and not the ones used to get Table 4 and that may give a biased picture to the reader. May apply to Lines 231-233, 236-237 and 244-245 as well.In addition, are there not any results to mention for the validation part of the study?Line 230: I would like to suggest to rephrase \u2018on the eye\u2019 as it feels as strange formulating in this way.Lines 232 and 245; I would like to suggest to rephrase this as \u2018moderately pain present, and xx of obviously pain present\u2019, because that is more clear.Line 270: I would add \u2018clearly\u2019 or \u2018obviously\u2019 before \u2018in pain\u2019.Line 286: \u2018in horses\u2019 instead of \u2018on horses\u2019Line 289: Indeed a larger databank would be worthwhile. Do the authors have suggestions on the amount of images desired here?Line 293: Can the authors elaborate a bit more on what this bias would mean if present?Line 294: Nice to know the authors have in mind to include more behaviours. Do the authors have specific suggestions for these behaviours?ConclusionLine 303: Increasing the quality was not mentioned before, or was it? If not, I believe one cannot raise new aspects in the conclusion, so please include the quality in the discussion first as well.**********what does this mean?). If published, this will include your full peer review and any attached files.6. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 26 Jun 2021Dear Dr. Humaira Nisar and reviewers,Thank you very much for your comments. They were extremely helpful in order to improve the quality of our manuscript.In the document below we are describing how we have answered the questions and how we did carry out the necessary corrections to the manuscript.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdfWe have reviewed the manuscript based on the PLOS ONE\u00b4s style requirements.2. In your Methods section, please provide additional details regarding participant consent from the owners of the animals. In the ethics statement in the Methods and online submission information, please ensure that you have specified (1) whether consent was informed and (2) what type you obtained . If the need for consent was waived by the ethics committee, please include this information.We have added this information to our Methods section on the manuscript. (Lines 136 \u2013 139).http://journals.plos.org/plosone/s/data-availability.3.In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see Our data are available in the Mendeley Repository: , \u201cAutomatic Pain Assessment in Horses\u201d, Mendeley Data, V1, DOI: 10.17632/t8rtzcgwxm.1).http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.Upon re-submitting your revised manuscript, please upload your study\u2019s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see Our data are available in the Mendeley Repository: , \u201cAutomatic Pain Assessment in Horses\u201d, Mendeley Data, V1, DOI: 10.17632/t8rtzcgwxm.1).http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: We will update your Data Availability statement to reflect the information you provide in your cover letter.4.Thank you for stating the following financial disclosure:\"The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.\"At this time, please address the following queries:a. Please clarify the sources of funding  for your study. List the grants or organizations that supported your study, including funding received from your institution.b. State what role the funders took in the study. If the funders had no role in your study, please state: \u201cThe funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.\u201dc. If any authors received a salary from any of your funders, please state which authors and which funders.d. If you did not receive any funding for this study, please state: \u201cThe authors received no specific funding for this work.\u201dPlease include your amended statements within your cover letter; we will change the online submission form on your behalf.5. Please upload a copy of Figure 5, to which you refer in your text on page 18. If the figure is no longer to be included as part of the submission please remove all reference to it within the text.In the manuscript there is no Figure 5 included. All the references pointing to it on the text were removed.Additional Editor Comments:The manuscript aims to develop an automated method for the detection of post-operation pain of horses using convolutional neural networks.The topic and the work is very interesting.However reviewers have major concerns about the technical aspects of the paper, as many important parameters have not been explained appropriately. Which is probably because of the reason that the paper writing also needs a major improvement.The reviewers have given detailed comments which will be very useful in improving the quality of this manuscript. Hence based on the reviewers recommendation i will recommend a major revision.Comments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: PartlyReviewer #2: PartlyReviewer #3: Partly________________________________________2. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: YesReviewer #2: NoReviewer #3: N/A________________________________________3. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.Reviewer #1: YesReviewer #2: NoReviewer #3: Yes________________________________________4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #2: NoReviewer #3: NoReviewer #1: 0.The manuscript presents and discusses the practical applicability of CNN for the automated detection of post-operation(castration) pain of horses. The work presented involved the design of a shallow 2-conv-layer CNN for the classification of manually cropped images of horse faces, extracted from videos recorded before and after the castration surgery. The importance and relevance of the work are properly outlined in the introduction. The work reported a significant performance enhancement with the ensemble prediction using voting system, compared to individual CNN trained on a single face region of interest (ROI).Nevertheless, the manuscript seems written in a hurry. Expression of sentences were not properly proof-read by the authors prior to submission.Thank you for all the observations, they were very helpful during our editing process. The manuscript has now been reviewed by a native English speaker which we believe has helped improve the readability of the text.For example, in Lines 101-108 there are duplication and badly organized phrases. Lines 133-137 are of different font than the other paragraphs.Apologies, the text has been corrected.However, there could still be valuable research contributions with following questions addressed, which have arised in the review process. In addition, the HGS-labelled image dataset generated in this study could potentially chip in to enhance the variation of publicly available HGS dataset for research.The dataset generated in this study is available in the Mendeley data repository as we agree that the lack of datasets, that could be used for studying pain in animals is very limiting for robust studies. We do hope that these data will facilitate data sharing.Question 1:Lines 126-130:How do 7 horses, for (2+4) days, for 4 times a day, result in 1252 videos?(7 horses x 6 days x 4 times/day = 168 videos) Were multiple recording cameras used for every horse?This information has been corrected in the manuscript (lines 128-130)The actual number is 320 videos of 30 minutes duration each. (7 horses x 6 days x 4 times/day (more than a video per time point since the videos had a maximum length of 30 minutes). Thank you for pointing out our mistake.Question 2:It is commendable and helpful for reviewing that the authors have clearly provided the details like the CNN architecture, CNN kernel size, and the width and height of input images in Table 2 and Table 3.Could the author explain why shallow CNN of only 2 convolutional layers were used? Couldn't a few additional convolutional layers benefit the feature extraction and abstraction capability of the model as the input are raw images and the output demanded is a highly abstract emotional expression of animal?Indeed, we consider it important to show the configurations and final architecture so that the method can be replicated.We agree that the more convolutional layers the better, but as convolutional layers are added, the number of input resources for subsequent layers is reduced and the processing demand increases significantly. Our goal is to show the method's viability, that's why we haven't advanced in testing other architectures. We hope that our methods can inspire future work that explores other architectures.Question 3:It is again commendable that authors honestly and clearly reported the low Recall performance for the presence of pain (esp. for the obvious pain) in each facial subcategory. This is important as the low recall indicates the failed detection of obvious pain which is of greater concern in pain management. This may reflect the insufficience of each individual facial category to serve in pain detection by the presented CNN model.Has the author not considered increasing the reliability of HGS with independent labelling performed by more than only one trained-observer (as reported in line 159)?Indeed, the analysis of the performance in each facial subcategory is relevant.We have considered having more trained observers performing the labeling and we understand that this can improve the overall accuracy of the method. We have discussed this information in the text (Lines 304 \u2013 307). However, we plan to carry out work, on this area, on for future research, since in this study our aim was to evaluate if this method would be useful. Now that we have this initial answer it is possible for us and other scientists to improve the details of the system, and perhaps exchange information and create solid partnerships.Question 4:For contents in Lines 202-207 & Lines 252-259:Based on which image pool was the voting/ensemble model weight-tuned? Was it using the image pool that each member CNN of the ensemble model was trained on (as that presented in Table 1 & 3) or another separate image pool? Or was the weight-tuning also based on the pool of 30 images reported in Table 7 and Table 8 ? The authors has not explicitly reported the image dataset used for the ensemble/voting weight-tuning process.If this ensemble voting model with weight ratio of 3:1:1 for eye:ears:mouth&nostril is applied back onto the very original image dataset presented in Table 1 before these images are cropped into ROI, what is the performance of the model is terms of accuracy, precision and recall?The weight tuning process (which is a key step resulting in the pain classification performance surge) should be analyzed and discussed in greater details.What is shown in Table 1 is the number of cutouts made in original complete images. Automatic pain classification on the original image has not been implemented. This requires the development of another method , in which the automatic search for the clippings of interest in the original image or video would be implemented, and then the proposed method would be applied. In our case, this process was performed manually, but for a final automatic system this development would be necessary.Thank you for your observation, we agree that the voting model needed to be explained in more details. We have added explanation of the voting process, weight adjustments and image selection in the manuscript, (lines 207 \u2013 216).Reviewer #2: The paper aims at employing artificial intelligence in identifying the existence of pain and its level in horses. Although the problem addressed by the paper is exciting and carries great future potential in opening research avenues, the paper still needs much work to be publication worthy. I have the following concerns:1. The writing of the paper needs revision. There are many repetitions that should have been omitted after the authors decided on the final shape of the paragraph. The first paragraph of the data collection section (starting line 101) is a prime example. These are not style mistakes but rather genuine writing/editing flaws. See line 58.Thank you for your observations. These corrections were important and have been done. Also, the manuscript has now been reviewed by a native English speaker.2. The authors need to enroll a computer science specialist with knowledge in AI. She/he will contribute to better experiments and to writing in the proper computer science jargon. This is a problem with the current manuscript as it is written by non-specialists.The presented work is strongly multidisciplinary and our challenge was to create a report that could communicate the proposal and the results to scientists from different areas, such as computer science, veterinary and animal science. I would like to count on your understanding for this challenge since one of our aims is to show for other animal scientists and veterinarians how it is possible to have amazing outcomes when associating knowledge from the animal health area with computer science technology.3. The data collection section, details of the drugs given are not necessary for the contribution of the paper .Although the details of the drugs given may not be necessary from the perspective of the system development, we believe that this information could be relevant for other scientists working in the veterinary and animal science areas as it could interfere in the expression of pain.4. Section III.II, the number of images 185.000 should be written as 185000, and there is no need for approximately as this is a simple count. The exact number can be easily included.The information has been corrected in the manuscript (lines 141 \u2013 143).5. The authors need to elaborate more on the time and effort to inspect 185000 images to select 3000 of them (if not randomly). This does not seem right.A computer program was used that, based on motion detection, selected frames in the videos. After this process, images with quality and representativeness of each pain level were manually selected, in order to select only the ones that made the pain evaluation possible. It was a very demanding task that took months of work, but we have managed to do it. We attempted in the text to clarify the information.6. The approach to select the proper images could be better than just inspecting the individual frames, which carry a lot of repetitions especially at 30 frames per second video rate.As answered in the previous question, in order not to have to inspect all the frames captured by the camera, we have used an application software that extracted frames only when motion was detected . Then, the resulting frames were selected in order to get only the ones that were possible to evaluate pain through facial expressions. Of course, this is still a very demanding process, however we wanted to make sure that we got all the images possible in order to result in a good image database.7. In general, the AI approach need to be driven by a computer scientist so that many of the issues in this paper could be ironed out. For example, the number of subjects  is too small and may lead to overfitting of the model.We agree that having more subjects would be ideal. Between these 7 seven subjects that we managed to include in this study, we had animals with different coat colors and different breeds, in order to improve the variability in the facial characteristics that the system would interpret. However, our proposal is novel and our goal with dissemination is to show its potential, and thus inspire other groups of scientists who can develop the work further. Right now, we have already been working on future developments for models with more subjects and a larger database. However, these ongoing improvements would benefit from the successful results that we would like to have feedback, from the current study.8. The font size in paragraph on line 133 need to be consistent with the paper .It was corrected, thank you.9. It is not clear how the system combines the result from the three body parts to form a judgement on pain. The current approach seems overly simple.Thank you for your observation, we agree that the voting model needed to be explained in more details. We have added explanation of the voting process, weight adjustments and image selection in the manuscript, (lines 207 \u2013 216).10. Numbering of sections need to better.We have reviewed the manuscript based on the PLOS ONE\u00b4s style requirements and corrected it.Reviewer #3: The manuscript \u2018Pain assessment in horses using automatic facial recognition through deep learning-based modeling\u2019 is an interesting and timely manuscript. The results seem indeed promising to be able to record facial expressions of pain automatically and this is clearly worthwhile for practice.However, I believe some aspects need to be addressed with more detail and there are a couple of things I do not understand which may need clarification first before the manuscript may be accepted for publication in PLOS ONE.Below, you will find my arguments for the answers I have given to the questions that are part of the PLOS ONE review process and additional detailed feedback.Title: I am not sure recognition is the right word to use. To me facial recognition would be that a computer can identify animal 1 from 2 or can tell this is an ear or a mouth. But in this study the assessment was aimed to say that if the ear was positioned like this, there is no pain present. That seems to be something different?Thank you for these observations, they were very helpful to improve the manuscript.We totally agree with this aspect related to the title. We have corrected the title for: Pain assessment in horses using automatic facial expression recognition through deep learning-based modeling.AbstractLine 2: \u2018The aim of the study was ....\u2019 instead of \u2018The aim of the study is ....\u2019?The text was corrected.Lines 6 (and 60): Yes, clear that training is important for using the HGS. However, a computer model needs to be trained too and if this is done not properly, it does not really help us forward. So not sure to what extend a computer model is an advantage then?To create models based on supervised machine learning, training is required. However, after the construction of the final model , it can be used in any place indefinitely, being part of a computer vision system. On the other hand, when we are training people to apply the pain scale, we end up depending on their availability to evaluate the animal, which will not be the same as the system that could work full time, without supervision.Lines 8 (and 64-66): True, but a person may not always be needed to be present? The animal can also be monitored from cameras for instance. So this is not always a problem for evaluation, I think.We agree that a person's evaluation through a camera won't lead to a possible bias to the animal altering its pain expression due to a threatening stimulus. However, the idea is to create an automatic system that doesn't depend on human availability, since it would require large amounts of time to constantly evaluate each animal from time to time. The system would be able to do this task uninterruptedly.Line 15: \u2018process was applied\u2019 and \u2018methods were used\u2019 instead of \u2018.... is\u2019 and \u2018.... are\u2019? May apply at other sentences too.It was corrected.IntroductionLine 28:  instead of [1][2]It was corrected.Lines 33 and 56: A space is missing before the reference. Please check whether a space is missing at other places perhaps too.It was corrected.Line 55: The word \u2018if\u2019\u2019 is not needed, I think.It was corrected.Lines 59, 105 and 174: I think here is one space too many. Please check whether an extra space is present at other places perhaps too.It was corrected.Line 77: Full stop is missing after the references.It was corrected.Materials and MethodsLines 88 and 92: I am not sure I understand what the authors mean with application exactly. To be able to reproduce the study, more details on this method may be needed to give.It was complemented in the manuscript that \u201capplication\u201d is referring to a \u201capplication software\u201d. Line 86.Lines 101-105: Please check these lines as things are said twice here.It was corrected.Line 125: What was the total length of the castration procedure? May be good to add to show the reader it was done as quickly as possible.Thank you for your observation, we agree that this information is an important concern. The total length of the procedure was approximately 40 minutes (time considering anesthesia and recovery) including 20 minutes of the surgery procedure itself.This information was added to the manuscript (lines 123 \u2013 124).Line 130: \u2018videos of 30 minutes\u2019 instead of \u2018videos with 30 minutes?It was corrected. (Line 129).Line 130: With 1252 videos, this means you have about (1252 / 7 horses / 6 days / 4 time points =) 7 videos with a total of 3.5 hours of footage around a time point? That seems sufficient, I am just wondering how to visualize this so to say as there is for example only 2 hours in between time point 10 am and 12 pm. When was a video then considered to belong to a certain time point? Or do I not understand this correctly?This information has been corrected in the manuscript (lines 128-130)The actual number is 320 videos of 30 minutes duration each. (7 horses x 6 days x 4 times/day (more than a video per time point since the videos had a maximum duration of 30 minutes).Lines 133-137: Seems to be in a different letter font?It was corrected.Lines 135 and 137: May be good to add when exactly on a day this was done, as I think it should not have interfered with making the videos of Line 130?Post-castration follow ups were carried out from 07:00 am. Images were never collected when the presence of humans was recorded. It is possible that the images were collected and used for the study after the evaluations were carried out, however this should not have interfered with the measures obtained. Thank you for the useful question.We have added this information to the manuscript (lines 134 \u2013 136).Lines 147-148: What is exactly part of the 4th and 5th parameter? You have to guess a bit where the 4th ends and the 5th begins.We agree that this was not clear in the manuscript. We have corrected it (Lines 146 \u2013 148).Line 157/Fig. 2: I would like to suggest to take another picture as example for the mouth and nostrils parameter for moderately present. As I do not really understand what I am looking at here, I am afraid. If possible, a more clear one as used for not present and obviously present would definitely help.In the picture of pain moderately present for the Mouth and nostrils parameter it is possible to notice that, in comparison to the pain not present image for the same parameter, the line between upper and lower lip (mouth column) is shorter, (but not as short as in the pain obviously present example). The mouth is slightly strained and so are the nostrils. However, we agree that this interpretation can be quite difficult, so we also added this information to the figure 2 legend in the manuscript. (Lines 157 \u2013 161).Lines 159-161: Was the pain assessment solely based on the HGS? Or also based on other behavioral or physiological parameters? In other words, how did the authors know the horse was really in pain? The horses were given post-operative analgesia, so perhaps they did not feel so much pain? For training and testing a computer model this may not be such an issue, but for practice it is. The ears, for instance, could also be turned backwards due to focusing on a sound and not related to pain, and I think that such false warnings to the veterinarian or horse owner is not desired. Or it is the case that only if all three parameters are scored as pain present by the model, a warning is given?The reviewer's remarks are important. This is an initial work that seeks to show the potential of the proposed method. This method would only notify the presence of pain if there is more than one of the parameters indicating that state, therefore minimizing false warnings due to a change in only one of the parameters, for example the ears reacting to sound. The study was based solely on the published and validated HGS , and the question was related to the ability of a computer system to detect the changes. For a diagnosis to implement a treatment schedule, for example, threshold for responses could be used.Lines 165-166: I am sorry, but I do not understand how the authors can have a final database of 4847 images if 3000 were selected in the first place? In addition, summing up 2379, 1436 and 1035, I get 4850 images. Somethings seems to be not entirely right here.Each one of the original 3000 images of the horse\u00b4s full head has been used to generate image clippings for each one of the parameters, that is why it is possible to have more than 3000 images when adding up all the classes and parameters. We have corrected the mistake in the summing up and also added this explanation to the manuscript since we agree that this was not clear (Lines 169 \u2013 172).Line 173: \u2018were built\u2019 instead of \u2018was built\u2019It was corrected.https://arxiv.org/pdf/1909.12605.pdf;https://www.nature.com/articles/s41598-020-70688-6;https://www.mdpi.com/1424-8220/19/5/1188/htm Perhaps it depends on what exactly the model needs to be trained in, but it may be good to add here why the authors know/feel these numbers are sufficient.Lines 177-181: I am not an expert on this yet, but what I learned is that others used much more images/frames for training (and testing) the model. Please see for instance: The reviewer's remarks are important. This is a preliminary work that seeks to show the potential of the proposed method. We have been working now on expanding the image bank to refine the computational model , however, we needed to make sure that the system would be successful and promising in order to be able to gather resources for all the possible improvements. We also aim to spread the word to inspire other groups of scientists who can evolve with the work, and create potential collaborative arrangements.Line 195/Table 2: Fig. 5 is not included in the manuscript?Apologies, it was corrected. Where it was saying Fig. 5 is actually Table 3. (Line 200 \u2013 203 \u2013 Table 2).Lines 202-203: More details on the voting process would be interesting and relevant to give with respect to be able to reproduce the study.Thank you for your observation, we agree that the voting model needed to be explained in more detail. We have added explanation of the voting process, weight adjustments and image selection in the manuscript, (lines 207 \u2013 216).Lines 205-206: \u2018Thus, a variety of ... was tested\u2019 instead of \u2018Thus, it was tested a variety of .....\u2019 makes more sense to me.It was corrected.Results and DiscussionLine 215: I would like to suggest to add \u2018obviously\u2019 to this line after \u2018being\u2019.It was corrected.Line 219: It took me some time to figure out where the numbers in Table 4 came from, until I realized that this was based on the test frames which was 237 images for the ears . It would be good to repeat that somewhere here, I think. Please, be precise and clear which numbers are total and which used for training, validation and testing as the numbers given in Lines 214-215 are the overall total and not the ones used to get Table 4 and that may give a biased picture to the reader. May apply to Lines 231-233, 236-237 and 244-245 as well.Thank you for this observation. This information was indeed not clear as it could be. We have added the details to precise the testing dataset used in the manuscript in lines (225 \u2013 229) (241 \u2013 244) (255 \u2013 258).In addition, are there not any results to mention for the validation part of the study?Through the process of building models using artificial intelligence, databases are partitioned, with a fraction of the database being reserved for model building and validation and another part for the final performance evaluation. In our case representing 80%, 10% and 10% respectively.Line 230: I would like to suggest to rephrase \u2018on the eye\u2019 as it feels as strange formulating in this way.It was corrected. Line 238.Lines 232 and 245; I would like to suggest to rephrase this as \u2018moderately pain present, and xx of obviously pain present\u2019, because that is more clear.It was corrected.Line 270: I would add \u2018clearly\u2019 or \u2018obviously\u2019 before \u2018in pain\u2019.It was corrected.Line 286: \u2018in horses\u2019 instead of \u2018on horses\u2019It was corrected.Line 289: Indeed a larger databank would be worthwhile. Do the authors have suggestions on the amount of images desired here?There is no definitive answer, further research is needed. We are working to have a bank with 20000 images.Line 293: Can the authors elaborate a bit more on what this bias would mean if present?The aim is to minimize the impact of individual evaluation failures by using a larger number of evaluators. This information was added in the manuscript in order to make it more clear in lines (304 \u2013 306).Line 294: Nice to know the authors have in mind to include more behaviours. Do the authors have specific suggestions for these behaviours?Our ongoing research at the veterinary teaching hospital has offered the opportunity to gather a large dataset on images obtained from clinical cases. Our goal is to explore further information on level of activity, eating, drinking, among other behaviors. Some behaviors that could also be important to be taken into account when evaluating pain are sleep, posture, facial expressions related to stress or aggression, posture, tail movement and others.ConclusionLine 303: Increasing the quality was not mentioned before, or was it? If not, I believe one cannot raise new aspects in the conclusion, so please include the quality in the discussion first as well.We have included this aspect in the discussion too in line 301.AttachmentResponse to Reviewers.docxSubmitted filename: Click here for additional data file. 16 Jul 2021PONE-D-21-11680R1Pain assessment in horses using automatic facial expression recognition through deep learning-based modelingPLOS ONEDear Dr. Lencioni,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Aug 30 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at\u00a0https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:\u00a0We look forward to receiving your revised manuscript.Kind regards,Humaira NisarAcademic EditorPLOS ONEAdditional Editor Comments:Based on the reviewers comments, the manuscript is not ready for publication yet.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0(No Response)Reviewer #3:\u00a0(No Response)**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0PartlyReviewer #3:\u00a0Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0N/AReviewer #3:\u00a0N/A**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #3:\u00a0Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #3:\u00a0Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0\u3010Question 1 follow-up\u3011:Authors' response is accepted. Corrective action has been made.\u3010Question 2 & 3 follow-up\u3011:Authors have responded by saying further future work will be done in these directions.It is okay for Question 3 not to be addressed with corrective research action as it will require almost another full round of research work apart from the video recording.\u3010Question 4 follow-up\u3011:According to Table 1, the datasets are highly imbalanced  with vast majority of the images being under absence of pain. So, the focus of performance analysis would naturally be put on the Recall and Precision of the categories with pain (moderate pain and obvious pain). After all, this model is for the purpose of pain assessment.Using only one of the three facial regions , the system's pain detection Recall performance was from around 27%-67% as recorded in Tables 4, 5, and 6. This high-accuracy low-recall performance could be due to the vastly imbalanced traininng image pool, with the CNN parameters being tuned to favor the detection of the absence of pain. Perhaps the authors could consider improving the balance of the dataset, or providing counter-measure for this issue.The balance of the dataset is important especially for the test dataset. Out of the 237 test images in the ear category, 198 of them are under the absence of pain. The model performance tested using such an imbalanced test set is likely not properly reflecting the true accuracy of the model.It was reported that only 10 random images  were used for the performance testing of the final ensemble voting model. Are there any valid reasons for why the authors would not allocate a greater amount of images for the final performance test? Just for instance, at a ratio of 6:1:1:1:1 for the following purposes:- 60% :- 10% :- 10% :- 10% (for ensemble voting weight tuning):- 10% , instead of using only the same 10 images out of the 3000 for both the voting-weight tuning and final testing.Furthermore,\u3010Page 12. Lines 223-227\u3011The same images were used for tuning the \"voting-weight\" ratio and for the final ensembled performance test. This is not a correct practice. By doing so (using the same images for tuning and testing), the reported weight ratio was not properly validated and may not be well applicable onto wider variations of pain expression.As the authors have responded to my Question 2 & 3, saying that \"in this study our aim was to evaluate if this method would be useful\" and \"hope that our methods can inspire future work that explores other architectures\", the main concern may not be on reporting very high classification accuracy. However, it is important to present an analysis report that is technically and statistically sound.\u3010Additionally\u3011,For facilitating the review process of the contribution of this paper, it would be helpful to include a systematic literature review on others' previously-published relevant research and their relevant research achievement, in order to present a clearer overall picture of current state of research in this subject of interest. For instance, the automated decoding of expression or pain in horses. Or the automated decoding of expression or pain in other animals, if the reported works on horses are currently too limited.Reviewer #3:\u00a0I would like to thank the authors for their effort to revise the manuscript according to the reviewers\u2019 suggestions, and generally I am satisfied with the revisions made. I do have, however, some last suggestions and questions. If the authors revise the manuscript accordingly, I will accept the manuscript for publication.Last suggestions and questions:L5: Scale with a capital S instead of a small s?L64: Either \u2018a potential threatening stimulus\u2019 or \u2018potential threatening stimuli\u2019L98: Images with a small i instead of a capital I?L101: space is missing between was and requested. In L103 is a space missing as well.L129: I would say \u2018in 320 videos of 30 minutes each\u2019 instead of \u2018in 320 videos each of which was 30 minutes in duration\u2019.L135: I would like to thank the authors for including the time here. However, the time is equal to the first observation point of the day. I assume that the post-operative procedures were done first and video recordings started thereafter? In addition, the penicillin-based ointment was applied twice a day. When was the second time?L157/Fig. 2: Although the extra explanation in the figure caption helps, I still find it difficult to see where the mouth and nostrils are in the picture of this parameter in the moderately pain option. I mean for not present and obviously present the nostrils are clearly on the right-side and the mouth on the left, but this is very vague for the in between pain option. Also, in the other two pictures, there is clearly some background beneath the mouth making it clearly standing out from the background/other body parts, but this seems not the case in the picture I have concerns with. If the authors would have a different and clearer picture, that would be great. Otherwise it might work to give even more explanation in the caption regarding e.g. whether the nostrils are on the left or right for instance.L170: all instead of both?L253-254: Here ear and eye in singular, but earlier in plural. Good to make this consistent?L299: Perhaps add here to the manuscript and not only in reply to the reviewers some words about that this work is \u201cpreliminary work that seeks to show the potential of the proposed method. [...] We also aim to spread the word to inspire other groups of scientists who can evolve with the work, and create potential collaborative arrangements.\u201d. In this way the authors show that they are, for instance, aware of the model\u2019s shortcomings at this stage in the process. Thus, that it is a work in process.**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 28 Aug 2021Dear Dr. Humainara Nisar and reviewers, Thank you very much for your comments, we have addressed all the points with extreme attention and we believe that now the manuscript has improved even more. We would like to thank you again for such important considerations.In the document below we are describing how we answered the considerations and changes on the manuscript.Additional Editor Comments:Based on the reviewers comments, the manuscript is not ready for publication yet.[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1: (No Response)Reviewer #3: (No Response)________________________________________2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: PartlyReviewer #3: Yes________________________________________3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: N/AReviewer #3: N/A________________________________________4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.Reviewer #1: YesReviewer #3: Yes________________________________________5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #3: Yes________________________________________6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1: \u3010Question 1 follow-up\u3011:Authors' response is accepted. Corrective action has been made.\u3010Question 2 & 3 follow-up\u3011:Authors have responded by saying further future work will be done in these directions.It is okay for Question 3 not to be addressed with corrective research action as it will require almost another full round of research work apart from the video recording.Thank you for understanding the limitations to address question 3. We are committed to continue this area or research and your comments are certainly valuable to improve our future work.\u3010Question 4 follow-up\u3011:According to Table 1, the datasets are highly imbalanced  with vast majority of the images being under absence of pain. So, the focus of performance analysis would naturally be put on the Recall and Precision of the categories with pain (moderate pain and obvious pain). After all, this model is for the purpose of pain assessment.Using only one of the three facial regions , the system's pain detection Recall performance was from around 27%-67% as recorded in Tables 4, 5, and 6. This high-accuracy low-recall performance could be due to the vastly imbalanced traininng image pool, with the CNN parameters being tuned to favor the detection of the absence of pain. Perhaps the authors could consider improving the balance of the dataset, or providing counter-measure for this issue.The balance of the dataset is important especially for the test dataset. Out of the 237 test images in the ear category, 198 of them are under the absence of pain. The model performance tested using such an imbalanced test set is likely not properly reflecting the true accuracy of the model.It was reported that only 10 random images  were used for the performance testing of the final ensemble voting model. Are there any valid reasons for why the authors would not allocate a greater amount of images for the final performance test? Just for instance, at a ratio of 6:1:1:1:1 for the following purposes:- 60% :- 10% :- 10% :- 10% (for ensemble voting weight tuning):- 10% , instead of using only the same 10 images out of the 3000 for both the voting-weight tuning and final testing.Thank you for all your relevant considerations, they were really helpful in order to improve the quality of the manuscript. We agree that ideally the classes should have a more balanced design aiming to an even better and more robust outcome for the reported system. We discussed in the manuscript that working with images of animals, especially in pain models, brings the associated challenges to work with small datasets. That is why we chose to use all the images possible for each model, even though this would result in an unbalanced model the training for each was the best that we were able to do. We are developing now on our current research, ways to improve the dataset and as a result we should be able to improve the system with a more balanced model adding more images. We have made changes in our final algorithm to address the issues raised regarding the number of images and the performance test, which we will discuss in detail in the next question, since it is also related to the tuning process.Furthermore,\u3010Page 12. Lines 223-227\u3011The same images were used for tuning the \"voting-weight\" ratio and for the final ensembled performance test. This is not a correct practice. By doing so (using the same images for tuning and testing), the reported weight ratio was not properly validated and may not be well applicable onto wider variations of pain expression.As the authors have responded to my Question 2 & 3, saying that \"in this study our aim was to evaluate if this method would be useful\" and \"hope that our methods can inspire future work that explores other architectures\", the main concern may not be on reporting very high classification accuracy. However, it is important to present an analysis report that is technically and statistically sound.We would like to thank the reviewer for the important comments. We were able to make improvements to our system and we believe that now our results are more robust and accurate. As a solution for these concerns, we chose to substitute the voting system for a machine learning method, based on Artificial Neural Network (ANN-based classifier) and a Perceptron feedforward and multi-layered architecture, with a sigmoid transfer function in the hidden layer and a linear transfer function in the output layer. The Levenberg-Marquardt backpropagation method and mean squared error were employed to measure the performance using k-fold cross validation of 10. In addition to that, we have improved our database for the process of training and testing of the classifier, that went from a total of 30 images to 120 images on the new model. With these changes, the overall accuracy of the final model was slightly lower than the previous, however we believe that it was worth in order to address all the topics discussed previously. Again, thank you for your comments \u3010Additionally\u3011,For facilitating the review process of the contribution of this paper, it would be helpful to include a systematic literature review on others' previously-published relevant research and their relevant research achievement, in order to present a clearer overall picture of current state of research in this subject of interest. For instance, the automated decoding of expression or pain in horses. Or the automated decoding of expression or pain in other animals, if the reported works on horses are currently too limited.Recently we came across the article  that offers a comprehensive review on the complexities of assessing pain in horses using automatic methods. We have added this article in the manuscript to present a clearer overall picture of this research topic.Reviewer #3: I would like to thank the authors for their effort to revise the manuscript according to the reviewers\u2019 suggestions, and generally I am satisfied with the revisions made. I do have, however, some last suggestions and questions. If the authors revise the manuscript accordingly, I will accept the manuscript for publication.We are very happy to hear that and we would like to thank you for the previous and current revisions, that were extremely helpful to improve the manuscript.Last suggestions and questions:L5: Scale with a capital S instead of a small s?We have corrected it in the Manuscript.L64: Either \u2018a potential threatening stimulus\u2019 or \u2018potential threatening stimuli\u2019We have corrected it in the Manuscript.L98: Images with a small i instead of a capital I?We have corrected it in the Manuscript.L101: space is missing between was and requested. In L103 is a space missing as well.We have corrected it in the Manuscript.L129: I would say \u2018in 320 videos of 30 minutes each\u2019 instead of \u2018in 320 videos each of which was 30 minutes in duration\u2019.We have corrected it in the Manuscript.L135: I would like to thank the authors for including the time here. However, the time is equal to the first observation point of the day. I assume that the post-operative procedures were done first and video recordings started thereafter? In addition, the penicillin-based ointment was applied twice a day. When was the second time?We would like to thank you for this observation. This information was not clear in the manuscript, so we added the observation that the follow ups were carried out before the video recordings in the morning (7am) and in the afternoon (12 pm).L157/Fig. 2: Although the extra explanation in the figure caption helps, I still find it difficult to see where the mouth and nostrils are in the picture of this parameter in the moderately pain option. I mean for not present and obviously present the nostrils are clearly on the right-side and the mouth on the left, but this is very vague for the in between pain option. Also, in the other two pictures, there is clearly some background beneath the mouth making it clearly standing out from the background/other body parts, but this seems not the case in the picture I have concerns with. If the authors would have a different and clearer picture, that would be great. Otherwise it might work to give even more explanation in the caption regarding e.g. whether the nostrils are on the left or right for instance.Thank you for this observation. We have changed the image and believe that it is better to understand all the information now.L170: all instead of both?We have corrected it in the Manuscript.L253-254: Here ear and eye in singular, but earlier in plural. Good to make this consistent?We have corrected it in the Manuscript.L299: Perhaps add here to the manuscript and not only in reply to the reviewers some words about that this work is \u201cpreliminary work that seeks to show the potential of the proposed method. [...] We also aim to spread the word to inspire other groups of scientists who can evolve with the work, and create potential collaborative arrangements.\u201d. In this way the authors show that they are, for instance, aware of the model\u2019s shortcomings at this stage in the process. Thus, that it is a work in process.Thank you for this observation, we have added this information to the manuscript.________________________________________7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #3: NoAttachmentResponse to reviewers.docxSubmitted filename: Click here for additional data file. 15 Sep 2021PONE-D-21-11680R2Pain assessment in horses using automatic facial expression recognition through deep learning-based modelingPLOS ONEDear Dr. Lencioni,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Oct 30 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at\u00a0A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.Please include the following items when submitting your revised manuscript:https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: We look forward to receiving your revised manuscript.Kind regards,Humaira NisarAcademic EditorPLOS ONEJournal Requirements:Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article\u2019s retracted status in the References list and also include a citation and full reference for the retraction notice.Additional Editor Comments (if provided):[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0(No Response)Reviewer #3:\u00a0All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0PartlyReviewer #3:\u00a0(No Response)**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0N/AReviewer #3:\u00a0(No Response)**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #3:\u00a0(No Response)**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #3:\u00a0(No Response)**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0I think the revised manuscript is acceptable for publication.Thanks to the authors for their passionate research contribution and professional effort at revising the manuscript in order to address the reviewers' comments.Nevertheless, I have 3 comments  as below:_______________________________________________________________________________________Comment 1:\u3010line 220 in manuscript (or line 225 in manuscript with tracked changes)\u3011- resulting in (instead of resulting on)_______________________________________________________________________________________Comment 2:\u3010lines 272-274 in manuscript\u3011\"The final value for the number of neurons in the hidden layer, the learning rate and the momentum hyperparameters were 5, 0.3 and 0.2 respectively.\"If it is possible, it could be valuable to report the final weights and biases of the 5 hidden nodes, since the weights and biases of these 5 hidden nodes carry information regarding the relative significance of 3 facial regions and the number of nodes  are not too large too be presentable._______________________________________________________________________________________Comment 3 :- Referring to \u3010lines 217-219\u3011 & \u3010lines 223-225\u3011 of the manuscript with tracked changes or \u3010lines 216-218\u3011 & \u3010lines 219-221\u3011 of the manuscript,\"The Levenberg-Marquardt backpropagation method and mean squared error were employed to measure the performance using k-fold cross validation of 10\" and\"Forty complete original images were randomly selected of animals from each class: no pain, moderately present pain and obviously present pain, resulting on 120 complete images.\"But the results reported in Table 7 and Table 8 contained all the 120 images and this is not the averaged results of the 10-fold cross validation.May I know how the 10-fold validation was conducted and why the results reported is not the averaged 10-fold cross-validated result?Using 120 images for 10-fold cross validation, each fold of validation should have only 12 validation images, not the 120 as reported in Tables 7 & 8. Or has the author presented the summation of the 10-fold cross-validation, instead of the average? This should be clarified in the Table's caption or the content of manuscript to avoid confusion._______________________________________________________________________________________End of RecommendationReviewer #3:\u00a0(No Response)**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 21 Sep 2021Dear Dr. Humainara Nisar and reviewers, Thank you very much for your important considerations, we have addressed all of them and we hope that the manuscript is now acceptable for publication.In the document below we are describing how we answered the considerations and carried out the suggested changes on the manuscript.Journal Requirements:Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article\u2019s retracted status in the References list and also include a citation and full reference for the retraction notice.We reviewed the reference list and we understand that it is complete and correct.Additional Editor Comments (if provided):[Note: HTML markup is below. Please do not edit.]Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1: (No Response)Reviewer #3: All comments have been addressed________________________________________2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.Reviewer #1: PartlyReviewer #3: (No Response)________________________________________3. Has the statistical analysis been performed appropriately and rigorously?Reviewer #1: N/AReviewer #3: (No Response)________________________________________4. Have the authors made all data underlying the findings in their manuscript fully available?The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.Reviewer #1: YesReviewer #3: (No Response)________________________________________5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1: YesReviewer #3: (No Response)________________________________________6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1: I think the revised manuscript is acceptable for publication.Thanks to the authors for their passionate research contribution and professional effort at revising the manuscript in order to address the reviewers' comments.Nevertheless, I have 3 comments  as below:_______________________________________________________________________________________Comment 1:\u3010line 220 in manuscript (or line 225 in manuscript with tracked changes)\u3011- resulting in (instead of resulting on)Thank you for your comment. It was corrected in the manuscript._______________________________________________________________________________________Comment 2:\u3010lines 272-274 in manuscript\u3011\"The final value for the number of neurons in the hidden layer, the learning rate and the momentum hyperparameters were 5, 0.3 and 0.2 respectively.\"If it is possible, it could be valuable to report the final weights and biases of the 5 hidden nodes, since the weights and biases of these 5 hidden nodes carry information regarding the relative significance of 3 facial regions and the number of nodes  are not too large too be presentable.Thank you for your comment.All generated models and the buffer results were added to the data repository. Lencioni, Gabriel; Sousa, Rafael; Sardinha, Edson; Romero, Rodrigo; Zanella, Adroaldo (2021), \u201cAutomatic Pain Assessment in Horses\u201d, Mendeley Data, V3, doi: 10.17632/t8rtzcgwxm.3Comment 3 :- Referring to \u3010lines 217-219\u3011 & \u3010lines 223-225\u3011 of the manuscript with tracked changes or \u3010lines 216-218\u3011 & \u3010lines 219-221\u3011 of the manuscript,\"The Levenberg-Marquardt backpropagation method and mean squared error were employed to measure the performance using k-fold cross validation of 10\" and\"Forty complete original images were randomly selected of animals from each class: no pain, moderately present pain and obviously present pain, resulting on 120 complete images.\"But the results reported in Table 7 and Table 8 contained all the 120 images and this is not the averaged results of the 10-fold cross validation.May I know how the 10-fold validation was conducted and why the results reported is not the averaged 10-fold cross-validated result?Using 120 images for 10-fold cross validation, each fold of validation should have only 12 validation images, not the 120 as reported in Tables 7 & 8. Or has the author presented the summation of the 10-fold cross-validation, instead of the average? This should be clarified in the Table's caption or the content of manuscript to avoid confusion.https://www.cs.waikato.ac.nz/ml/weka/mooc/dataminingwithweka/transcripts/Transcript2-5.txt).Thank you for your comment. We carried out the suggested changes in order to address these issues. We believe that the title of table 7 and 8 could lead to this confusion. We have changed the title of both tables and explained in the methods section that the performance metrics were based on the average values of all the folds. ________________________________________7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1: NoReviewer #3: Nohttps://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, AttachmentResponse to reviewers.docxSubmitted filename: Click here for additional data file. 4 Oct 2021Pain assessment in horses using automatic facial expression recognition through deep learning-based modelingPONE-D-21-11680R3Dear Dr. Lencioni,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Humaira NisarAcademic EditorPLOS ONEAdditional Editor Comments :Thank you very much for responding to the reviewer comments which has resulted in significant improvement. The manuscript is now ready for publication. Congratulations.Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0N/A**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0(No Response)**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article (If you choose \u201cno\u201d, your identity will remain anonymous but your review may still be made public.Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.Reviewer #1:\u00a0No 11 Oct 2021PONE-D-21-11680R3 Pain assessment in horses using automatic facial expression recognition through deep learning-based modeling Dear Dr. Lencioni:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Humaira Nisar Academic EditorPLOS ONE"}
+{"text": "Nous rapportons le cas d'un cancer bronchique r\u00e9v\u00e9l\u00e9 par un acanthosis nigrigans du visage. Ce mode de r\u00e9v\u00e9lation qui est rare, peut pr\u00e9c\u00e9der de plusieurs mois le diagnostic de n\u00e9oplasie sous-jacente. Cette observation souligne l'int\u00e9r\u00eat de rechercher un cancer primitif pulmonaire en cas d\u00b4acanthosis nigrigans. L'acanthosis nigrigans (AN) est une dermatose rare qui est souvent associ\u00e9e \u00e0 des affections b\u00e9gnines, principalement au diab\u00e8te par insulino-r\u00e9sistance. Dans des cas exceptionnels, il peut accompagner une n\u00e9oplasie profonde dont l\u00b4identification s'av\u00e8re parfois difficile. Nous rapportons dans cette observation le cas rare d'un ad\u00e9nocarcinome bronchique m\u00e9tastatique r\u00e9v\u00e9l\u00e9 par un AN du visage.Informations du patient: il s\u00b4agit d\u00b4un patient \u00e2g\u00e9 de 58 ans, tabagique chronique \u00e0 raison de 40 paquets ann\u00e9es, a consult\u00e9 en dermatologie pour l\u00b4apparition de fa\u00e7on sym\u00e9trique au niveau des deux pommettes de plaques irr\u00e9guli\u00e8res, pigment\u00e9es, verruqueuses, de couleur brun\u00e2tre devenant de plus en plus sombre, indolores et augmentant progressivement de taille. Un bilan biologique demand\u00e9 \u00e9tait normal \u00e0 savoir une glyc\u00e9mie \u00e0 jeun et une cortisol\u00e9mie de 8h00. Le patient a \u00e9t\u00e9 mis sous traitement symptomatique, une cr\u00e8me \u00e0 base de vitamine A \u00e0 \u00e9t\u00e9 prescrite. Trois mois plus tard, l\u00b4\u00e9volution a \u00e9t\u00e9 marqu\u00e9e par l\u00b4accentuation des l\u00e9sions dermatologiques du visage et l\u00b4installation d\u00b4une toux productive avec h\u00e9moptysie de faible abondance, associ\u00e9e \u00e0 des n\u00e9vralgies cervico-brachiales droites, \u00e9voluant dans un contexte de fl\u00e9chissement de l\u00b4\u00e9tat g\u00e9n\u00e9ral.R\u00e9sultats cliniques: l'examen clinique pleuropulmonaire a objectiv\u00e9 un syndrome de condensation apical de l\u00b4h\u00e9mithorax droit. L'examen cutan\u00e9o-muqueux a montr\u00e9 des plaques pigment\u00e9es, brunes, \u00e9paisses et papillomateuses , accompagner (61%) ou suivre (21%) l\u00b4apparition d\u00b4une n\u00e9oplasie interne . La path%, accompet al. [La coexistence de l\u00b4AN et du cancer bronchique est rare, le premier cas a \u00e9t\u00e9 rapport\u00e9 en 1914 . Curth eet al.  ont largLa n\u00e9oplasie constitue l\u00b4origine de l\u00b4acanthosis nigricans dans 20% des cas, et dont il peut \u00eatre le mode r\u00e9v\u00e9lateur. Par cons\u00e9quent, si un patient accuse une apparition soudaine de l'AN, nous devons faire une anamn\u00e8se et un examen clinique minutieux \u00e0 la recherche d\u00b4une tumeur maligne sous-jacente."}
+{"text": "Objective: This study aimed to investigate the efficacy and safety of antegrade dissection re-entry (ADR) technique in the percutaneous coronary intervention (PCI) to open chronic total occlusion (CTO) lesions.Methods: The baseline, angiographic results, PCI success rate, and major adverse cardiac events (MACE) during the 12 months of follow-up were compared between 48 patients who did not use ADR in the treatment of CTO lesions (control group) and 50 patients who used ADR (treatment group).Results: The control group comprised 48 patients who had 52 CTO lesions, and the treatment group comprised 50 patients who had 58 CTO lesions. The success rate of PCI in the treatment group  was significantly higher than in the control group, where six patients had in-stent restenosis  that were all recanalized. The mean PCI time , X-ray exposure time , contrast agent dosage , MACE incidence during the 12 months of follow-up  and recurrent myocardial infarction incidence  were significantly lower in the treatment group than in the control group. The differences were all statistically significant.Conclusion: It is safe and effective to use the ADR technique in PCI for coronary artery CTO lesions. The technique shortens the operation time, reduces the radiation dose of doctors and patients and the use dose of contrast agents, and improves patients' prognoses. TM balloon, and, later, StingrayLP balloon and Stingray puncture guidewire) is specially designed for CTO lesions. In the FAST-CTO trial  of the coronary artery is defined as an occlusion lasting >3months, in which the thrombolysis in myocardial infarction (TIMI) level of forward blood flow of the occluded segment is 0. If ipsilateral collateral or collateral vessels are present, although the TIMI level of blood flow in the distal vessels is > 0, it can also be defined as CTO . The lesTO trial , 5, and TO trial \u201310. At pn = 50) and the control group (n = 48). For patients in the treatment group, ADR was used in PTI, while in the control group, ADR was not used during the treatment CTO lesions. The enrolled patients included those in which ADR-devices technique failed to reentry. This study was approved by the Ethics Committee of the Binzhou People's Hospital  and performed in accordance with the Declaration of Helsinki. All patients provided written informed consent prior to the study.In this randomized control trial, a total of 98 patients who had CTO lesions and were planned to receive PCI treatment at the Binzhou People's Hospital and the Second Affiliated Hospital of Nanchang University were recruited from January 2017 to December 2018. These patients were randomly divided into two groups: the treatment group ((1) Complete occlusion of \u22651 blood vessel, (2) occluded vessel diameter \u22652.5 mm, (3) in-stent CTO lesions, (4) no serious diffuse lesion in the vessels far from the occluded segment, and the landing zone does not affect large branches of blood vessels, and (5) the length of the occluded segment is >20 mm .The guidewire passes through the occluded segment into the true lumen of the distal segment.TM balloon was sucked three times using a 2-ml screw syringe, expelling air from the side hole. Pure contrast reagent was inhaled into the StingrayTM balloon under negative pressure, and the StingrayTM balloon was delivered along the guidewire. The guidewire was withdrawn, and the balloon was filled with 6 atm (1 atm = 101.325 kpa) of contrast agent, allowing the StingrayTM balloon to be filled under the intima and encircle the blood vessels. There are two 180\u00b0 opposite outlets on the StingrayTM balloon, one of which points to the true lumen of blood vessels when being filled. At this time, fluoroscopy was performed in different positions. When the StingrayTM balloon presented with the \u201cmonorail sign,\u201d the Stingray puncture guidewire (or Conquest Pro guidewire) was used to penetrate the vascular intima. When the contralateral angiography confirmed that the guidewire was located in the true lumen of the blood vessel in at least two positions, the StingrayTM balloon was sucked and deflated, trapping was removed, the microcatheter expanded, and the working guidewire was switched to the distal true lumen to complete the subsequent PCI operations ], and compared between the two groups using non-parametric rank-sum tests. Count data were expressed as percentages (%) and compared using a Chi-square test. P < 0.05 was considered statistically significant.Data were statistically analyzed using software SPSS19.0. Normally distributed measurement data were expressed as mean \u00b1 standard deviation (x \u00b1 SD) and, then, compared between the two groups using a P > 0.05 for all; The differences in age, gender, risk factors, hypertension, hyperlipidemia, and disease history between the two groups were not statistically significant (P > 0.05). The success rate of PCI in the treatment group  was significantly higher than that in the control group. The difference was statistically significant. The mean PCI time , X-ray exposure time , and contrast agent dosage  were significantly lower in the treatment group than in the control group  Stingray guidewire could not penetrate the true lumen . Other possible reasons for failure apart of the devices related ones included repeated attempts to open CTO, serious calcification of CTO entrance, and no obvious collateral circulation.The failure in the treatment of six lesions are summarized as follows: (1) The CrossBoss catheter failed to pass through the diseased segment of CTO; (2) the StingrayThe reasons of CTO failure in the control group included tortuosity, calcification, occlusion, and insufficient collateral circulation in the occluded segment.P > 0.05). The incidence of MACE  and recurrent myocardial infarction  in 12 months of follow-up in the treatment group were significantly lower than those in the control group. The differences were statistically significant  technique, and retrograde CART technique. In the United States, 35\u201340% of patients with CTO lesions are treated with antegrade guidewire upgrade technique. Approximately 20% of patients are treated with retrograde guidewire upgrade technique, and 30% of patients received ADR treatment . The appADR technique  addresseP < 0.001), and the incidence of 30-day MACE was similar . Mogabgab (P = 0.13) and the incidence of MACE  were not significantly different from those of standard PCI. This confirms that the ADR technique has good safety results in CTO treatment.A meta-analysis of using ADR technique to recanalize CTO lesions revealed that the success rate of recanalization of CTO was 77%, and the risk of surgical complications did not increase . A FAST-Mogabgab  conducteP = 0.047) was significantly higher than that in the control group, which greatly improved the success rate of antegrade recanalization of CTO lesions. In addition, PCI duration, X-ray exposure time, and contrast agent dosage were reduced. The risk of contrast-induced nephropathy was also reduced. The results of the present study suggest that ADR can improve the prognosis of patients 12 months after the operation and reduce the incidence of MACE, which has some advantages compared with the traditional operation method.In the present study, ADR was used in 58 CTO lesions of 50 patients. The success rate of PCI in the treatment group  seeking the tangent position that makes the StingrayTM balloon present with \u201cmonorail sign,\u201d to determine the direction of the true lumen of blood vessels by retrograde coronary angiography, using Stingray guidewire to puncture into the true lumen, and the Pilot200 exchanged to guide the wire into the true lumen at a distance; and (5) exchanging the Stingray guidewire for a working guidewire through Corsair microcatheter, thereby completing the subsequent routine PCI treatment. The disadvantages of this process are as follows: (1) The CrossBoss catheter or Knuckle-boss technique may cause a large subintimal hematoma at the distal end of some CTO lesions. As a result, the StingrayTM balloon cannot point to the vascular true lumen. Stingray guidewire cannot penetrate the true lumen, so when the antegrade guidewire was too close to the true lumen, we tried to use Corsair microcatheter. The external diameter of the head end of a Corsair microcatheter is 0.87 mm, and the external diameter of the body is 0.93 mm. This is equivalent to the external diameter of a CrossBoss catheter (1 mm) and has the advantage of tapering the head end, so it will not cause a significant subintimal hematoma; and (2) there is a probe with a length of 0.18 mm at the head end of Stingray guidewire. The pre-molding angle of the head end is only 28\u00b0, making it difficult for the guidewire to return to the true lumen in some cases. In this study, the Conquest Pro guidewire was chosen as the puncture guidewire, and success was achieved. We modified the surgical procedures introduced by the teams from Europe and the United States and achieved success.At present, there is a lack of experience in the large-scale use of the ADR technique in China, and some major cardiac intervention centers need to learn from the technical methods of European and American countries. ADR technical processes in European and American countries are as follows : (1) BasTM balloon channel is well-prepared, the tissue of CTO lesions is soft, and the patients with distortion and calcification of blood vessels need a recanalization of the channel with a CrossBoss catheter. The StingrayTM balloon being parallel to the vascular cavity is the most important factor for the success of the puncture. If there are severe, unusual plaques in the landing area, or small lumen or StingrayTM balloons located in vascular angulation, it is necessary to replace the flat and thicker segment of the lumen for puncture. If the true lumen of the blood vessel is not clear, we can only slide the StingrayTM balloon back and forth for trial-and-error puncture; and (3) if the landing area fiber cap is tough and the Stingray guidewire cannot penetrate into the true lumen, we can try to stick, swap or replace Conquest Pro12 and Conquest Pro8-20 guidewire, so it can slide forward and puncture at the weak point in front. The large hematoma causes the StingrayTM balloon to float in it, unable to provide stable support. In addition, the lumen near the landing area is pressed, resulting in a puncture failure. In this case, a Corsair microcatheter can be introduced for aspiration of the hematoma, or the Conquest Pro guidewire can also be used to slide forward for puncture.The measures that could be used to prevent failure in the treatment are as follows: (1) Subintimal small balloon expansion or Knuckle-wire technique can be used; (2) Corsair microcatheter can be used if the StingrayOur experience for ADR is summarized as follows: (1) It is important to prevent the formation of hematoma and control the expansion of hematoma in ADR; (2) avoiding too many, or forcing an antegrade coronary angiography, if possible, means that high selective angiography or contralateral coronary angiography can be performed via ipsilateral collateral vessels; (3) avoiding frequent and large angle rotating guidewire; and (4) in cases of parallel guidewire technique, once it is found that the hematoma extends to the distal end, the strategy conversion should be considered in time.There are some limitations to the current study. First, we did not perform power analysis to determine sample size. Second, the number of patients recruited to this study was relatively small. Further investigations with larger samples size and a multi-center design are needed to verify the results from the current study.In conclusion, our study shows that ADR shortens the operation time, reduces the radiation dose of doctors and patients and the use dose of contrast agents, and improves patients' prognoses. Therefore, the ADR technique may be a safe and effective technique in PCI treatment for coronary artery CTO lesions.The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by Ethics Committee of Binzhou People's Hospital. The patients/participants provided their written informed consent to participate in this study.XW and DZ: conception and design of the research. XW and CF: acquisition of data. XW and HL: analysis and interpretation of the data. DZ and SL: statistical analysis. XW and JL: writing of the manuscript. JC and CF: critical revision of the manuscript for intellectual content. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
+{"text": "The balance between goal-directed behavior and habits has been hypothesized to be biased toward the latter in individuals with cocaine use disorder (CUD), suggesting possible neurochemical changes in the putamen, which may contribute to their compulsive behavior.n\u00a0= 21; control participants: n\u00a0= 22), we also measured glutamate and glutamine concentrations in the left putamen using ultra-high-field (7T) magnetic resonance spectroscopy. We hypothesized that increased habitual tendencies in patients with CUD would be associated with abnormal glutamatergic metabolites in the putamen.We assessed habitual behavior in 48 patients with CUD and 42 healthy control participants using a contingency degradation paradigm and the Creature of Habit Scale. In a subgroup of this sample  in the putamen in patients with CUD, which was significantly related to the level of self-reported daily habits.Patients with CUD exhibit enhanced habitual behavior, as assessed both by questionnaire and by a laboratory paradigm of contingency degradation. This automatic habitual tendency is related to a reduced glutamate turnover in the putamen, suggesting a dysregulation of habits caused by chronic cocaine use. Drug addiction is widely regarded as a chronically relapsing disorder, characterized by persistent drug- seeking despite the harm it causes and the declining pleasure gained from drug use . This beA predominance of the habit system can be tested experimentally by manipulations that either render goal-directed actions meaningless  or make the outcome undesirable . As habits are affected by neither manipulation, individuals with a strong habit system would continue responding irrespective of these manipulations. We have recently shown that appetitive instrumental performance in patients with CUD was indeed unaffected by outcome devaluation, pointing toward strengthening of the appetitive habit system . HoweverIf CUD is associated with increased habit formation, one would expect this to be reflected also in patients\u2019 daily habits. Contrary to experimentally induced habits, habitual responses in daily life have often been practiced over prolonged periods. Although these behaviors may have initially been goal directed, through repetition they become autonomous of the goal, so that entering the associated environment is sufficient to trigger the behavior. The Creature of Habit Scale (COHS) ,18 measuHabits are subserved by different networks from goal-directed actions, involving sensorimotor regions of the striatum (putamen) and connected sensory and motor cortices . SpecifiThe aim of this study was threefold: 1) to provide complementary evidence for increased habit formation in patients with CUD using a contingency degradation paradigm, which, to the best of our knowledge, has not yet been used in humans with CUD; 2) to evaluate the relationship between experimentally induced habits and self-reported habitual tendencies; and 3) to both quantify glutamate, glutamine, and GABA concentration in the putamen using ultra-high-field MRS and establish their relationship with habitual tendencies. We hypothesized that patients with CUD would show increased habitual tendencies, as measured both objectively by a contingency degradation paradigm and by self-report. We further hypothesized that increased habitual tendencies are associated with altered concentrations of glutamate and GABA metabolites in the putamen.In light of the predominance of male cocaine users , we recrPatients with CUD had been actively using cocaine for an average of 13 years (SD\u00a0\u00b17.7), and most (87%) were using the drug on a daily basis. Patients with CUD reported moderate-to-high levels of cocaine-related compulsivity [Obsessive-Compulsive Drug Use Scale , mean S and 20-iet\u00a0al.  how often they would pick up a 20 pence coin lying on the street . We thenet\u00a0al. , which cr 500 ms . This acr 500 ms \u2014before iAfter completion of the behavioral task, half of the sample  underwent whole-brain T1-weighted MR and single-voxel proton MRS scanning at the Wolfson Brain Imaging Centre, University of Cambridge (United Kingdom) using a 7T Magnetom-Terra scanner . Only participants without MR contraindications such as metal implants, tattoos, or claustrophobia were invited for the scan, but they did not differ from the rest of the sample on any demographic or behavioral variables . The sca3 voxel was placed manually over the left putamen using anatomical landmarks  sequence  . Metabolites between 0.5 and 4.2 parts per million  were quantified using LCModel (version 6.2-3)   with watDemographic and behavioral data were analyzed using SPSS version 25 . Differences between conditions were analyzed using repeated-measures analysis of covariance models with level of contingency degradation  as the within-subject factor and group (control/CUD) as the between-subject factor. Mean years of education were included as a covariate to control for differences in educational achievements between the groups. Where assumptions of heterogeneity of covariance were violated, degrees of freedom were corrected using the Greenhouse-Geisser approach. Group differences of questionnaire data, rating scores, and metabolite concentrations were determined using univariate and multivariate analysis of variance models, respectively. All statistical tests were two-tailed and the significance level was set at .05.r\u00a0= .463, p\u00a0= .002), they were included as a covariate in the analysis. In terms of habitual tendencies (as measured by COHS), patients with CUD reported to engage in daily routines to the same degree as control participants  but scored significantly higher on automaticity than control participants  the longer they had been using cocaine  .As shown in p\u00a0= .02) . PatholoF1.6,138.5\u00a0= 5.1, p\u00a0= .012), indicating that both groups were able to respond according to the action-outcome association . As shown in r\u00a0= \u22123.1, p\u00a0= .042) . This response pattern was also mirrored by the group-by-contingency interaction in participants\u2019 causality judgments  .In line with our principal behavioral prediction, we found a significant main effect of contingency degradation on response rate  . Notably\u00a0= .048) , suggestF1,87\u00a0= 4.8, p\u00a0= .031), as a quarter of patients with CUD (25%) exhibited a habitual strategy  compared with 7% of the control group (Fisher\u2019s exact p\u00a0= .026). This goal-to-habit ratio correlated with participants\u2019 self-reported automaticity  . The ratio scores of the partially degraded condition were not significantly different between the two groups .We also calculated a ratio score for the two conditions  to test our hypothesis of strong habitual control in CUD patients. As shown in \u00a0= .029)  but not t41\u00a0= 0.40, p\u00a0= .692), which is why we did not include volume as a covariate in the analysis. Two MRS spectra of patients with CUD were excluded because of poor quality. As shown in F1,39\u00a0= 4.6, p\u00a0= .039; d\u00a0= 0.64) and the glutamate-to-glutamine ratio . Concentrations of glutamine  and GABA  were not significantly different between groups. These results were not explained by differences in scan quality; water linewidth, signal to noise, and metabolite Cram\u00e9r-Rao lower bound were not different between the two groups   . There was also no relationship between these metabolites and contingency degradation performance, the duration of cocaine use, or the number of tobacco cigarettes smoked . Putamen volume was not associated with glutamate-to-glutamine ratio, behavioral performance, or self-reported automaticity .The demographics and questionnaire scores of the two subgroups undergoing MR scanning are shown in o groups . The glu\u00a0= .034) ; this re\u00a0= .623) , but theA key finding of this study is that patients with CUD had no problems learning action-outcome associations , but theConsistent with our hypothesis, we observed in patients with CUD greater habitual responding during contingency degradation than their non\u2013drug-using peers. As shown in Partial degradation of the action-outcome contingency was, in both groups, insufficient to change their causal beliefs and their instrumental actions significantly. Given that contingency information is calculated through the overall probability of an action producing an outcome ,58, it iSensitivity to action-outcome contingencies involves a number of brain regions including the ventromedial prefrontal cortex for encoding outcome value ,63, the In keeping with our previous work suggesting modulatory effects of stimulant drug exposure on automatic, environmentally triggered behavior , patientThe significant reduction in glutamate concentration in the putamen and the low glutamate turnover in patients with CUD is in keeping with previously published findings in CUD, suggesting a substantial downregulation of glutamate neurotransmission, including widespread reduction in glutamate receptors ,76,77 anDespite the significant reduction in the glutamate-to-glutamine ratio in patients with CUD, their glutamine levels were not measurably different from control participants . GlutamiN-acetylcysteine can recover goal-directed from habitual behavior  ,84, and behavior  and rescbehavior .The strengths of the study include the assessment of habits both objectively using a contingency degradation paradigm and subjectively by self-report in a large sample and the significant correlation between the two . We succN-acetylcysteine normalizes glutamate concentrations in the dorsal anterior cingulate cortex (Metabolic measurements were obtained at ultra-high-field strength (7T), which allowed us to measure concentrations separately from their precursors, i.e., providing information not only about glutamate turnover but also about glutamate synthesis. The inclusion in the study of just male patients with CUD who were actively using cocaine may limit the generalizability of our findings to women with CUD and individuals in recovery. Limitations further include the lack of functional brain data such as resting-state or task-related activation to evaluate the functional implications of glutamate concentration and the restriction of metabolic measurements to just the putamen. We are also unable to determine the precise cortical  origin of the apparent reduction of glutamate transmission. In light of the performance of patients with CUD during contingency degradation\u2014a task that requires monitoring of reinforcement contingencies\u2014measuring glutamate concentration in the caudate nucleus and perigenual anterior cingulate cortex would be of particular interest. It is possible, for example, that a general reduction in glutamate transmission in the caudate may impair goal-directed behavior, which would then indirectly increase habitual control . Our fine cortex  and can e cortex . HoweverThese results add to the growing evidence indicating that cocaine addiction has profound effects on corticostriatal glutamate neurotransmission  associat"}
+{"text": "The experimental results are supportive of the reported core\u2013shell model comprising an achiral carbon core that is enclosed within an amorphous shell contributing to the chiral luminescence. The luminescence anisotropy and wavelength could be tuned by varying the experimental conditions such as temperature and pH. The chiral emissive properties of the nanoparticles could be demonstrated in free-standing polymeric films revealing their potential to be used as chiral light emitting agents in optical devices, data storage and security tags. Being the first observation of intrinsic circularly polarized luminescence from a range of carbon nanodots, both in the solution and solid state, we envisage that the work will open new avenues for the investigation of excited stated chirality at the nanoscale.Since the observation of chirality at the nanoscale, research focused towards the design and synthesis of optically active nanomaterials has been at a brisk pace. In this regard, carbon based zero dimensional nanomaterials have attracted vast attention due to their rich optical properties, abundance of raw materials, minimal environmental hazardousness, good solubility, and ease of surface modification. However, efforts focused towards the synthesis of chiral carbon nanodots exhibiting optical activity both in their ground and excited states are rather scarce. Herein, we report a facile synthetic approach for the preparation of three sets of intrinsically chiral carbon nanodots that exhibit intense circularly polarized luminescence. Synthesis under optimized conditions using  A facile approach using simple biomolecules as precursors is adopted for the synthesis of three sets of optically active carbon nanodots that exhibited circularly polarized luminescence in both solution state and in solid films. Since its inception, the growth of nanoscale chirality has been at a brisk pace and optical activity is being unravelled in a variety of new materials.4 These include organic5 and inorganic nanostructures such as semiconductor quantum dots (QDs),6 perovskite nanocrystals,7 carbon nanomaterials,8 plasmonic materials,9\u201311 and metal or covalent organic frameworks and their assemblies.12,13 Among them carbonaceous materials have attracted vast interest due to their abundance, environmentally benign nature, low photobleaching, biocompatibility and the ability to form covalent bonds with different hybridization states.14 Herein, we focus our interest on the fabrication of a set of chiral carbon nanodots (CNDs), a zero-dimensional carbon-based nanomaterial typically of size less than 10 nm, exhibiting intense optical activity both in its ground and excited states.Chirality is a unique geometric property covering different hierarchical scales ranging from subatomic particles through molecules to galaxies.15\u201317 While the latter approaches have been well explored, the fabrication of materials possessing intrinsic chirality has remained a challenge.18 Synthesis of inherently chiral materials is of extreme importance as deep knowledge on their optical activity could help unravel the mysteries related to the origin of homochirality in nature.19 Circular dichroism (CD) has been extensively used for the investigation of ground state chirality in molecules and materials.20 However, circularly polarized luminescence (CPL), the luminescence counterpart of CD, is gaining vast attention in recent years due to its potential to explore the excited state chirality.21,22 In this regard, CPL properties of various nanomaterials such as semiconductor QDs and perovskite nanocrystals have been investigated.23 The chiral emissive properties of CNDs have also been studied by exploiting template-assisted methods.24 Zheng et al. reported multicolour CPL using cellulose nanocrystals as templates25 whereas Ru et al. adopted a supramolecular approach using polymers to achieve CPL.26 We have recently demonstrated multicolour CPL from CNDs appended on chiral gel as templates.27 However, direct synthesis of intrinsically chiral emissive CNDs has remained a challenge and a few investigations in this direction have reported zero CPL for chiral CNDs.28,29 Hence, research focused towards intrinsically chiral CNDs and optimization of their synthesis strategies for enhanced excited state optical activity is new. Herein, we for the first time report the synthesis of different sets of CNDs that exhibit chiral light emission both in the solution and solid state. Adopting a facile synthetic approach, a general design strategy is developed for the synthesis of CPL active CNDs  generation of intrinsic chirality due to structural distortion, (ii) chiral induction through functionalization of ligands, and (iii) template-assisted chirality.ive CNDs .30 Herein, we use a combination of citric acid along with biologically important chiral molecules  as precursors for the synthesis of optically active CNDs   scale\" fill=\"currentColor\" stroke=\"none\"><path d=\"M0 440 l0 -40 320 0 320 0 0 40 0 40 -320 0 -320 0 0 -40z M0 280 l0 -40 320 0 320 0 0 40 0 40 -320 0 -320 0 0 -40z\"/></g></svg>O stretching of amidic functional groups formed during the hydrothermal synthesis. This peak is more intense for Thr-CNDs, indicating the presence of more CO groups on the surface. Peaks at 1580 and 1620 cm\u22121 can be attributed to the N\u2013H bending and CO stretching of the amide groups, respectively. A peak at 1450 cm\u22121 associated with C\u2013N stretching is more pronounced for all the samples. Peaks observed in the region 900\u20131200 cm\u22121 are attributed to the C\u2013O, C\u2013N, and C\u2013H bonds which are more intense for Cys-CND and Glu-CND samples. A small peak at 1159 cm\u22121 could be attributed to the C\u2013S bond  indicate that the hydrogen atoms experience a different environment and slow rotation in the Cys-CNDs  . Citric lu-CNDs) . The morlu-CNDs) . The avelu-CNDs) . Zeta polu-CNDs)  and S2\u2020.lu-CNDs)  and S3\u2020.Cys-CNDs .31 Simil2 hybridised aromatic domain whereas the band at 351 nm could be ascribed to the n\u2013\u03c0* transitions of the carboxyl group as well as the CN/CS bonds of the aromatic CND core.34 Analogous spectral profiles were observed for the CNDs synthesized using threonine and glutathione . All three sets of CNDs exhibited gabs values in the range of 10\u22124  which is given by glum = 2(IL \u2212 IR)/(IL + IR), where IL and IR are the intensities of the left- and right-circularly polarized light, respectively.41 The CNDs exhibited a glum value of 8 \u00d7 10\u22124 and \u22127 \u00d7 10\u22124 at 432 nm for the particles synthesized using d- and l-cysteine respectively. The observed glum is well within the range of what has been reported for organic molecules or other chiral nanosystems. The CPL and CD peaks exhibit similar sign and anisotropy values confirming the retention of the chiral orientation of nanoparticles in their ground and excited states.The ground state chirality of the CNDs was analysed using CD spectroscopy. Mirror image CD signals with positive sign for the  profile . The spe Table S3. The majt 350 nm . The CPL42 The fluorescence in CNDs synthesized using citric acid and cysteine has been reported to be due to the formation of intermediates like 5-oxo-3,5-dihydro-2H-thiazolopyridine-3,7-dicarboxylic acid (TPDCA) that either undergoes polymerization and carbonization or attaches to the carbon core to form the CNDs.43\u201345 To verify the contribution of TPDCA to the chiral anisotropy of CNDs, TPDCA was independently synthesized and characterised (see ESIvide infra).The origin of fluorescence in CNDs has been a matter of debate.d see ESI. While Td see ESI. To furtd see ESI. The chid see ESI. Hence, 46 On further increasing the reaction time, the carbonization of the surface occurs along with the breakdown of chiral derivatives present on the surface which in turn leads to the reduction in optical activity. Similar investigations on the effect of reaction temperature showed a gradual increase in CPL intensity that saturated at 180 \u00b0C followed by a decrease at further higher temperatures (vide infra). Under optimal reaction conditions, the nanoparticles form a carbonaceous core that is surrounded by a luminescent chiral shell. With increasing reaction time (or temperature), a gradual decrease in the intensity of the CPL signal is observed and this can be attributed to a higher degree of carbonization that break up the chiral structure of the ligands incorporating into the central carbon core.8In addition to the role of reaction precursors, the optical activity is strongly dependent on synthetic conditions applied. Hence, to study the role of experimental parameters, and to obtain enhanced luminescence anisotropy from the particles, we tried to vary the reaction conditions. To investigate the correlation of reaction time with the chiroptical properties, CNDs were synthesized by varying the duration of the reaction . An initial increase in the CPL intensity was observed up to 90 min, which diminished with a further increase in reaction time . These oeratures  and S14\u2020d- and l-threonine were observed at the corresponding luminescence wavelengths . A similar bathochromic shift could be achieved in CPL and luminescence profiles accompanied by a slight quenching  suggest that the CNDs are stable over a broad pH range.34 Hence, changes in external parameters could establish the stability of chiral CNDs under varying conditions. Moreover, the position and intensity of the CPL signals could be successfully tuned to some extent.Further investigations were carried out to tune the CPL signals. To achieve this, the synthesized Cys-CNDs were subjected to varying temperature and pH. The temperature dependent CPL studies showed that the absorption and CD remained unchanged upon heating the Cys-CNDs to 90 \u00b0C Fig. S18a. In cont Fig. S19. The obsglum values as well as the sign of CPL in the films were in agreement with the observations in the solution state  suggests that the chiral derivatives undergo a higher degree of carbonization by breaking the chiral structure and subsequently incorporating into the central carbon core. The results prove that the selection of precursors and optimization of reaction conditions are crucial to the formation of a carbon core supported by a chiral luminescent surface that exhibits efficient luminescence anisotropy. Hence, the studies pave a new pathway for the development of a carbon-based nanosystem to accomplish efficient chiral light emission.Based on the above results and discussions, the reported core\u2013shell model of CNDs could be adopted to explain chirality evolution in these materials. As per the prescribed model, CNDs are composed of an achiral carbon core that is enclosed within an amorphous shell comprising fluorophores and conjugated structures which have abundant heteroatoms . The chiIn summary, a facile strategy was adopted for the synthesis of three sets of optically active CNDs. Reaction of the chiral precursors with citric acid under optimized conditions resulted in the formation of Cys-CNDs, Thr-CNDs and Glu-CNDs that exhibited chirality both in the ground and excited states. The chiral emission was demonstrated both in the solution state and in solid polymeric films of the nanoparticles. The evolution of chirality with respect to the reaction time and temperature was investigated to validate the core\u2013shell structure composed of the carbon core and chiral shell. The CPL activity of CNDs could be tuned as a function of temperature and pH revealing the potential of the material in sensory applications. The demonstration of chiral light emission in CNDs coupled with their various other advantages, such as abundance of raw materials, ease of synthesis, good solubility, low toxicity, ease of surface modification, and resistance to photobleaching, makes these materials excellent candidates for application in display devices, optical data storage, security tags and biosensing.All experimental details are added to the ESI file.\u2020S. M. and K. L. R. contributed equally to the work. J. K. conceived and coordinated the project. S. M. and K. L. R. carried out the experiments. All authors analysed the data. S. M. and J. K. prepared the manuscript. All authors have given approval to the final version of the manuscript.The authors declare no conflict of interest.SC-014-D2SC05794H-s001"}
+{"text": "This paper deals with the detection of small magnetization using a thin film magneto-impedance sensor with subjecting to strong normal field. The sensor was made by soft magnetic amorphous thin-film with uniaxial magnetic anisotropy in the width direction of the element. It was reported that the sensor has very high sensitivity, such as pico-tesla order, when it is driven by hundreds of MHz. In this paper, a sensitive measurement method aiming for detection of a small particle or a cluster of nano-particles, having low-remanence, is proposed. The point is the application of strong normal field in the measurement area including sensor element and particle. The normal strong field is applied in the normal direction of the sensor plane in the value almost hundreds of mT. Instead of such strong normal field, the sensor keeps high sensitivity, because of the demagnetizing force in the thickness direction. A theoretical estimation for clarifying an efficiency of the method, experimental results of sensor property and sensitivity with subjecting to the normal field, and also a confirmation of detection of a small particle using the proposed method is reported. As a special mention, detection fundamentals when a applied surface normal field has a distribution and also a particle would run through in the vicinity of sensor is discussed. Detection of small magnetic particle is important for avoiding a contamination of industrial and chemical products. It is also important for detecting magnetic nano-particles included in cells and biomolecules for medical and healthcare technology .For industrial cases, inspection of all items in manufacturing processes is desirable for the recent advanced manufacturing systems, aiming at a reduction of product\u2019s defects, a detection of damaged machine tools, and a tuning of the processing conditions. For example, the detection of small conductive particle is important for avoiding a contamination of high-capacity battery, such as Li-ion secondary batteries. The inclusion of conductive particle in the insulation layer, which is called \u201cseparator\u201d of Li-ion battery, causes an extraordinary heating while operation. Our pre-liminary study for the magnetic property of small particle, which was actually sampled from raw material of Li-ion battery, shows that it contains a certain amount of low-remanence magnetic particle. The particle would be assumed to come from a naturally included in graphite minerals and also tool steel chips of grinding machines. This type of battery is getting used in the field of air-plane power-supply or life support robots. The extraordinary heating or unexpected shutdown of the system has a possibility to make a disaster. Even if a very rare inclusion of such small particle, it would be recognized as a serious problem. Therefore, full inspection of small particle, such as under one hundred micro-meters diameter, while fabrication process is needed for Li-ion separator. The detection must be applicable for a kind of roll-to-roll method with the width of the separator sheet more than 1 m and the running speed more than 100 m/min. Another example of detecting a magnetic small piece is a detection of metal contaminant in Aluminum material or product. Based on recent needs for recycling natural resources, Aluminum recycled metal is widely used in industrial products, such as an automobile engine. An inclusion of iron chips in Aluminum products have a certain possibility of inducing tool brakeage in post-process, such as drilling. It also has a possibility of tearing a sealing resin, when the contaminant chip appears on the surface of seal flange.\u00ae, a kind of Super Paramagnetic Iron Oxide (SPIO) nano-particle, is well known that it is used for a contrast-enhancement of the Magnetic Resonance Imaging (MRI). It consists of a mixture of Fe2O3 and Fe3O4 nano-particles having a paramagnetic property. It has a bio-compatibility against human body, therefore many trials of medical application using Iron Oxide magnetic nano-particles have been studied recently, such as a magnetic separation [A recent progress in medical technology utilizes magnetic nano-particles to be able to introduce in a human body. The Resovistparation . A detecparation . A high The giant magneto-impedance effect and sensor is recently attracted huge attention for the field of biosensing, healthcare, and industrial monitoring application, due to an easiness of harnessing it in industries as an actual system. The complicated measurement protocols, expensive equipment, and requisite for cryogenic temperatures for the other sensitive magnetic sensors, such as nuclear magnetic resonance and superconducting quantum interference, have prevented them from adopting it in industries.\u00ae, which consists of a mixture of Fe2O3 and Fe3O4 nano-particles, is well-known that it has a paramagnetic property, then, a cluster of this nano-particle has also low-remanence property.The senor system, which is proposed in this paper, consists of a combination of thin film magneto-impedance (MI) sensor  and highRecent study on sensing a micrometer-sized magnetic bead or nano-particle was for detection or identification for biomolecules. Some of them tried to detect a certain amount of deposited beads on sensor surface  or densiIn this study, a method of detection of small magnetic particle, which has low-remanence property, using a thin film magneto-impedance sensor is investigated. The point of this study is the application of strong static normal field in the measurement area including both sensor element and small particle. This paper composed of a theoretical estimation for clarifying efficiency of the proposed detection method, an experimental measurement of sensor property and sensitivity of the sensing system, while exposed in the surface normal field, and a confirmation of detection of small particle using this method, especially in the vicinity of sensor element. This paper shows a comprehensive fundamentals of magnetic particle detection using thin film MI sensor operated in a strong surface normal magnetic field.This paper is constructed based on a Japanese paper of technical meeting , which wm is the magnetic moment, r is the vector of particle position.Firstly, in order to make clear the efficiency of the proposed method, a theoretical analysis is carried out. z = const. is shown in Equation (2).For simplify the equation, it is restricted in X-Z plane. I is the magnetization, V is the volume of particle.It is supposed that the magnetization in the volume of particle is a constant value. Then,xB as a function of X position. In this case z = 1 mm, particle diameter is 65 \u03bcm, and magnetization I = 0.2 T. The profile has one maximum and one minimum point and each point is on x = \u00b1z/2, which is obtained from x/dxdB = 0.xB as a function of z, in case of particle diameter 50 \u03bcm. The magnetization of the particle is 0.1 T, 0.4 T, and 1.0 T respectively. From this result, the sensor of 10\u22129 T sensitivity can detect the particle with 50 \u03bcm of diameter and 0.1 T of magnetization within the distance of z = 7.5 mm. From Equation (2) the xB is proportional to magnetization I.xB as a function of z, in case of particle magnetization 1.0 T. The diameter of the particle is 20 \u03bcm, 65 \u03bcm, and 200 \u03bcm respectively. From this result, the sensor of 10\u22129 T sensitivity can detect the particle with 20 \u03bcm of diameter and 1.0 T of magnetization, within the distance of z = 6.5 mm. From Equations (2) and (3) the xB is proportional to the cube of the particle diameter.These results show, in order to detect a tens of micrometer magnetic particle by a sensitive sensor, the particle must be magnetized almost saturation, that is why application of strong normal field is needed, and placed it in the vicinity of the sensor.The previous subsection described a case in which the magnetic field at the sensor position was uniform and independent of sensor element position. This situation arises when the distance between the sensor and the magnetized particle is large enough.In this subsection, a discussion is made for the case when a magnetized particle is running in the vicinity of sensor element.The high-frequency impedance of the magneto-impedance sensor is well-known that it is caused by the skin-effect in the sensor element. The skin-depth of the current flow changes as a function of high-frequency permeability of the soft magnetic sensor element. In case of a frequency range which is larger than roughly MHz, the permeability appears based on a magnetization vibration, instead of the magnetic domain wall movement.Hk. The direction of easy axis of the magnetic anisotropy lies in width direction in this Figure. Based on our study, the domain variation depends on the easy-axis direction. In case of the easy-axis directing along the in-plane inclined direction, a domain wall movement appears and the area ratio of the contiguous domain changes as a function of applied field. The applied field is in the direction of element\u2019s longitudinal axis. The left schematic of 85Nb12Zr3 element is roughly 20 \u03bcm to 50 \u03bcm which is narrow enough compared with the whole element length, 1000 \u03bcm to 2000 \u03bcm, then a positional variation of magnetic field, which is applied in the sensing direction, has a possibility to effect on the partial element impedance proportionally changing to the external field within a continuous strip element.L mm length sensor, which is placed from x = 0 to x = L, the total impedance is expressed as Equation (4)Based on the assumption mentioned above, the whole impedance of the sensor element is assumed to estimate as an integral of partial impedance of the element as shown in x.Here, The following experimental results and discussions in this paper are constructed based on this equation.This section reported an effect of magnetic field variation on a sensor impedance, when a strip of thin film magneto-impedance sensor is placed in a surface normal magnetic field and detects a vertically magnetized magnetic small particle in the vicinity of the sensor. This section discusses about two viewpoints. The former explains an effect of distribution of the normal magnetic field for the sensitivity, and the latter reports and discusses a result of actual particle detection running in the vicinity of the sensor element.Variation of the MI-curve and the sensitivity of the sensor are experimentally measured as a parameter of the normal field. The MI-curve means the variation of sensor impedance as a function of external magnetic field applied along the in-plane sensing direction, which is the X direction in 85Nb12Zr3 film was RF-sputter deposited onto soda glass substrate and then micro-fabricated into rectangular elements by lift-off process. The dimensions of the element are ranging from 1000 \u03bcm to 2000 \u03bcm of length, 20 \u03bcm to 50 \u03bcm of width, and 1.35 \u03bcm to 2.15 \u03bcm of thickness. The element was annealed in magnetic field in order to induce uniaxial magnetic anisotropy. The direction of the magnetic anisotropy was controlled by the direction of the magnetic field. In this study, the magnetic field during annealing, 240 kA/m, 673 K, was oriented in short-side axis, therefore width direction, of the element.The sensor element was fabricated by a thin film process. An amorphous CoH| is ranging from 5 to 15 Oe , the Im(Z) has negative and minimum value for the case of Hk, and after that decreases as the X-direction field increases. This high-frequency permeability arises from the vibration of momentum which is explained by perturbation theory. From the result of unchanged impedance around zero fields, in spite of the surface normal field application, it is supposed that the normal field, within the value of our experiment, has no effect of enhancement or decline of permeability, therefore it has slight effect for changing the direction of momentum or changing the perturbation potential distribution. On the other hand, the decrement of maximum value means that the normal field has an effect of decline permeability. With consideration of decrement of |min Im(Z)|, the normal field is supposed to have an effect of decline permeability both real and imaginary within the range where the impedance change rapidly until the area around it has maximum. The details of this consideration would be a future subject of this study.The magnetic domain of element was Landau-Lifshitz-domain when both the X-direction field and normal field is zero. The magnetization process of the element which has uniaxial easy axis in width direction is magnetization rotation. x.There is another explanation for the change of MI-curve caused by applying normal field. Our measurement apparatus has un-uniformity of X-direction field within the length of the sensor, more than several Oe. This un-uniformity also has the effect of making the impedance profile flat. It is based on x pieces as shown in normalH is shown as follows;Whereas if a normal field with distributed vector in X-direction is applied, the applied field on the sensor element has a distributed profile in X direction . This diThe result in Based on these discussions, a generating apparatus of the surface normal magnetic field which can make more uniform in X-direction and stronger in Z-direction and can control them individually is effective for clarify the mechanism of the sensor surface normal field.f0, which is called \u201ccarrier-signal\u201d, is divided into two. One is inputted to the sensor, and the reflection signal from the sensor is introduced to the right side divider. Another signal is set in the same amplitude and opposite phase as the sensor reflection signal. Consequently, the combined signal come out from right divider is a carrier eliminated signal. When the ac magnetic field fac is applied to the sensor, the output signal has spectrum of f0 \u00b1 fac, which is known as side-band spectrum. The merit of this circuit is the very low noise level in the side-band frequency, because of the effect of carrier-suppressing. In this study, the sensitivity of the sensor with subjecting to the surface normal field is evaluated by using this circuit. The sensor element is the same one as measured in The sensor system in this study is a combination of thin film MI sensor and high-frequency measurement circuit. A well-known combination is with the carrier- suppressing circuit . Figure f0, from port-1 to port-3 and from port-2 to port-1. The leakage signal reduces the sensitivity especially when the sensing AC field, fac, has a low frequency. It induces the deviation of frequency between the f0 and fac to be reduced, then it makes difficult to detect the signal separately. The performance of the driving circuit for low frequency signal would be improved using a logarithmic amplifier IC-chip, which was tried in this paper in Our original proposal in the circuit was an application of high-frequency circulator. It has a merit of reducing number of connected cables, which is to make as 1-cable, then a reduction of connected electrode-pads and a space reduction of connected cable with the thin film small sensor. It also has a demerit of decreasing sensitivity, due to a signal loss of the circulator itself and an existence of leakage carrier-signal, The high-frequency devices shown in 1/2 in this case. 1/2. These results show that the 83.2 kA/m normal field has slight effect of degradation for the sensor sensitivity.dZ/dH at the bias point represents the sensor sensitivity. A comparison of ratios of sensitivity which is shown in dZ/dH in dZ/dH, which is the same design rule as ordinary magneto-impedance sensor.This work was a basis of the following developments of both the sensor driving circuit using a chip-sized high frequency devices  and alsoHz is less than 5% within 2.5 mm from the center of the area. The sensor element is the same one above mentioned, the length is 1 mm.In this experiment, detection of magnetic small particle using a single sensor strip was carried out. The particle, which has 65 \u03bcm diameter and 1 T saturation magnetization, was detected by the sensor with subjecting to 83.2 kA/m normal field. M-H loop of the particle is shown in I = 0.2 T, is placed on x = 0, y = 0, and z = 0.5 mm. The detection of magnetic field was carried out on X-axis. This profile is calculated by Equation (2). Based on this X-field distribution, a consideration is made for an estimation of impedance of whole element of the 1 mm length sensor. The magnetic field induced by the magnetized particle is localized and the effect is changed as a function of particle position, which was shown in The consideration of the measurement result on Impedance variation of the sensor is shown in collinear approximation in the vicinity of bias point. The field on sensor made by 65 \u03bcm particle is so small that this assumption in reasonable. Based on the measured sensor property with applying normal field, The element impedance is estimated by the following equation. The estimation is based on the same assumption as Equation (4). The element position and dimensions are the same as shown in ThenHx is analytically obtained based on the equation of magnetic dipole, Equation (2), when a particle is placed in x\u2019Here Then A result of numerical estimation is shown in y in case of x = 0, i.e., the position of impedance peak for z = 0.5 mm. The application of the surfase normal field makes the measured whole particle magnetize in the same direction Z. This makes the estimation of interaction between the sensor and the particle easy.In this study, a detection of adjacent particle from the sensor element was investigated using differential sensor. The sensor we used was a pair of meander shaped thin film MI sensors, adjacently located on a glass substrate, which is shown in X-axis on different Y-position as a parameter was carried out.For the purpose of confirming the edge effect precisely, measurements of linearly scan along the y = 1 and y = \u22121 are the position of outer end strip of the meander sensor. The y = 0.5 and y = \u22120.5 are at the middle of each meander sensor. The particle height was 1.5 mm in this case. This result also shows that the extreme value of sensor output appears at the edge of the sensor element, x = 0. It is confirmed the validity of the proposed estimation procedure of sensor impedance in case of the magnetic particle is placed in the vicinity of the thin film MI sensor element.This measurement was carried out using the apparatus shown in This paper discussed detection fundamentals of magnetic small particle using thin film magneto-impedance sensor. In this study, the particle is magnetized in vertical direction relative to the flat substrate plane of the sensor. There is an application of strong vertical magnetic field in the measurement area including sensor element for the purpose of detecting a low-remanence magnetic particle simultaneously with magnetization. The variation of sensor impedance, which is determined by a magnetic field coming from the particle, was estimated and formulated both the case of far distance and also the case of in the vicinity of sensor element. In case of far distance, the field is estimated using the equation of magnetic dipole. Whereas in the case of adjacent distance, the effect of magnetic field distribution on a sensor strip must be take into consideration using an assumption of impedance integral of partial strips of sensor element. This assumption was experimentally confirmed in two cases. One is the effect of distributed field for the sensor sensitivity. A distribution must be minimized for preventing sensitivity decrement. The other is that it is predicted that the extreme value of sensor impedance would be obtained when a particle is placed just above the sensor longitudinal edge. This phenomenon was confirmed in the both case of single sensor and also differential meander shaped sensor.This paper is constructed based on a Japanese paper of technical meeting  and Japa"}
+{"text": "A detection system for magnetic inclusions of large bulk, such as that of a whole human body, is proposed in this paper. The system consists of both a uniform magnetic field generating apparatus capable of the insertion of a whole human body and also of a high-sensitivity magnetic sensor array installed in the strong magnetic field. The system can detect the magnetic inclusion simultaneously through its magnetization, which is advantageous for detecting low-remanence magnetic materials, such as a cluster of nanoparticles. The thin-film magneto-impedance sensor was reported to be capable of tolerating strong magnetic fields of more than 3000 Gauss (0.3 T) in the substrate\u2019s normal direction and can retain its sensitivity even in strong fields. Through a combination of both uniformity of strength and the placement of its directionally aligned, static magnetic field in a particular measurement area and its array of single-dimensional thin-film magneto-impedance sensors, it was reported that it can estimate a magnetic sample\u2019s 3D position by using a simple equation. The aim of the system developed in this study is to nondestructively detect a cluster of magnetic nanoparticles in a human body and also to detect the position and the concentration of the clustered magnetic particles. In this paper, a prototype system consisting of a magnetic field generator with an area of W500 mm \u00d7 L400 mm \u00d7 H210 mm and a uniform magnetic field of 370 Gauss (37 mT) is reported. It also reported that the thin-film magneto-impedance sensor installed in the system verified the detection of 2 mm \u00d7 1 mm small ellipsoidal magnetic chips at a distance of 27 mm from the sensor element. A thin-film magneto-impedance sensor ,3,4,5,6 \u00ae, a kind of super paramagnetic iron oxide (SPIO) nanoparticle, is well known for its use in contrast-enhancement for magnetic resonance imaging (MRI). It consists of a mixture of Fe2O3 and Fe3O4 nanoparticles having paramagnetic properties. It has a bio-compatibility with the human body, thus many trials of medical applications using iron oxide magnetic nanoparticles, such as those for magnetic separation [In this study, a uniform and strong magnetic field generator for a particular large volume applicable to a human body scan is proposed, in which both the position and the volume of the magnetic concentration are possible to estimate. Recent progress in medical technology utilizes magnetic nanoparticles that can be introduced into the human body. Resovistparation , magnetiparation , magnetiparation , and hypparation , have beIn this section, a magnetic field generator which is capable of applying a whole human body scan with a combination of a thin-film magneto-impedance sensor for detecting the magnetic leakage field from a cluster of magnetic nanoparticles is proposed, and the concept of this system is introduced.h, is calculated by the equation h = 2 \u00d7 XSP when the chips are run through just above the sensor, where XSP is a position of extreme value of the measured magnetic waveform obtained by the sensor. h and the position of extreme point XSP is h = 2 \u00d7 XSP. The position of extreme point XSP is an important parameter for position estimation [h\u2019/2, where h\u2019 is the height of the expected maximum measurement area of a magnetic piece. In this study, the height of the measurement area was assumed to be 225 mm, which is available from the human body. The average value of the chest depth of a Japanese male is reported to be 212 mm [The study induced an analytical equation for estimating 3D position based on the equation for a magnetic field generated by a magnetic dipole. The resultant estimation shows that the height of the small piece, timation . Then, te 212 mm . Owing tIn our proposed system, the magnetic sensor is a thin-film magneto-impedance sensor driven by 400 MHz high-frequency electric circuit . The merIn this section, an actual fabrication of the proposed system is shown. Verifications of the structure of the generated magnetic field and also verification of the sensor installation set in the strong magnetic field with the sensing direction perpendicular to the strong magnetic field are shown here. The structure of the magnetic field generating apparatus which was designed and fabricated in this study is explained.An experimental confirmation of the fabricated magnetic field distribution was carried out and reported here. It confirms the wide area uniformity of the magnetic field and also that the magnetic field is at the sensor position which is suitable for sensor operation.z was measured by the feeding Hall probe at a constant speed of 100 mm/s. The original point of the measurement coordinates was set in the middle of the surface of the lower homogenization plate. The measurement area ranges from \u2212300 mm to +300 mm in the feeding Y-direction, from \u2212500 mm to +500 mm in the width X-direction and from +38 mm to +174 mm in the vertical Z-direction. The position on the carrying table in which the Hall probe was set just above the surface was with z = 38 mm.From here, the measurement results of the generated magnetic field by our proposed system are shown.z = 38 mm, which is just above the upper surface of the carrying table. The Bz suddenly rose up almost above the edge of the homogenization plate, which was y = \u00b1225 mm, and there was an almost flat Bz area above the plate. The value at the center of the plate was 370 G (37 mT). The waving variation existed around the top of the table in which the variation range was lower than 2%. In this case, the Bz was apparently constant as a function of transverse position x.z = 93 mm, which is 20 mm lower from the vertical middle height. In this case, the value of the center position was the same value, Bz = 370 G (37 mT), as the previous result. The field value gradually decreased as it got closer to the edge of the homogenization plate. At the edge of the transverse range, x = \u00b1300 mm, the value was 330 G (33 mT), which was 11% decreased from the center value. This was expected by the preliminarily carried out magnetic field simulation and was caused by the effect of magnetic flux line expansion outward from the strong area.z. The horizontal axis represents the feeding position Y, and the vertical axis represents the flux density Bz. The transverse position was fixed at x = 0, which was on the center line. The parameter z ranged from z = 38 mm to z = 174 mm, which was within the distance between the homogenization plates, 225 mm. The result show that the vertical flux density was almost the same value independent of the height position. Of special note, the value of the central position was a constant 370 G (37 mT). A slight difference existed at around the fringe area of the homogenization plate. This result shows a verification that our proposed structure is able to generate an almost constant vertical magnetic field of 370 G (37 mT) within a W500 mm \u00d7 L400 mm \u00d7 H210 mm area, with degradation in the fringe area of less than 10% compared with the center value.85Nb12Zr3 amorphous thin film, the bias field is roughly 17 Oe (1.35 kA/m). In order to utilize a high-sensitivity magnetic sensor having a tolerance against the strong field directed in the substrate\u2019s surface normal direction of the thin-film MI sensor, the bias field is indispensable. In this section, the concept of the formation of the bias field structure in this system, which is suitable for a sensor array configuration having multiple sensors in a line at intervals, is introduced.From here the magnetic structure designed for controlling the bias field of the MI sensor is explained. As shown in the previous explanation of this paper, the MI sensor needs a particular bias field for operation. In the case of our sensor, which is made of CoThe method of bias field adjustment was introduced in the previous section in this paper, which was carried out using the sensor position controlling mechanism along the tangential direction of the surface of the homogenization plate. The sensor driver circuit in our proposal made it possible to adjust the sensor position mechanically in the strong magnetic field, which is more than 20 times larger compared with the bias field. The magnetic field generating apparatus was designed for this purpose. It has a distributed vertical field just above the middle law of the magnet array. The distribution has a partial vector along the Y-direction which changes as a function of the Y-position. If this distribution has a particular range of magnetic field, the bias field control is realized.For the purpose of verifying the bias field generation in this system, magnetic field simulation was carried out due to the difficulty of the actual measurement of it inside the vertical strong field.z as a function of the feeding directional Y-position. The measurement is the same result as is shown in z = 38 mm and z = 93 mm. The simulated results are shown by dashed lines and the measurements are shown by solid lines. The simulation was carried out using Maxwell 3D . The results are in good agreement. Therefore, the simulation is a reliable estimate of the field distribution in the vicinity of the homogenization plate. The sensor element is designed to be set at z = 5 mm in this system due to a mechanical restriction, which is a 5 mm altitude from the surface of the lower homogenization plate. A difficulty in the precise measurement of magnetic flux density comes from the difficulty in accessing the Hall probe to the surface of the homogenization plate in a strong magnetic field with a strict position arrangement against the coordinate axis.z = 5 mm. The horizontal axis represents the Y-position, which is the feeding direction. The original point is the central position of the homogenization plate. In this system, the sensor is able to move mechanically, in parallel with the Y-axis, by keeping the sensing direction in the Y-direction using a sliding plate onto which is mounted a sensor element. y = \u221240 mm and y = +40 mm, and the variation range corresponds to the bias field from By = \u221220 G (\u22122 mT) to +20 G (+2 mT). It also shows that this controlling field is kept within the transversal position range, with x = \u00b1300 mm. Based on x = 0 corresponds to the middle position between the plate magnets, the x = 150 mm corresponds to the position 30 mm from the center of a plate magnet, and the x = 300 mm corresponds to the position at the center of a plate magnet. This variation range for By is suitable for applying the sensor bias field to our sensor element, having the bias point at about 17 Oe (17 G (1.7 mT) in air circumstances). In this case, it is possible to set the bias field at a suitable value when the position of the sensor element is set at about y = 30 mm. The actual fabricated magnetic structure has the possibility to include material non-uniformity and also to include dimensional and attachment mechanical error. Even in this case, our proposed system can adjust the bias point by controlling the sensor position by monitoring the sensor output signal that indicates sensor impedance.x, as a function of the feeding Y-position in the range of the bias controlling line. The Bx field is in the transverse direction to the sensing direction. If it is the in-plane transverse direction of the thin-film element, then a particular weakness exists against the magnetic field in this direction. Our sensor element is capable of tolerating transverse fields of more than 50 Oe (50 G (5mT) in air conditions). This simulated result shows that the sensor element is able to set and work within the range x = \u00b1300 mm.Based on the results in this section, the proposed magnetic field generation apparatus is capable of applying a suitable bias field to the area of the sensor array installation. The bias point can be set by controlling the Y-position of each element aiming at a particular, suitable magnetic bias field by monitoring the sensor output. The range of the controlling field is designed as a suitably larger value of the bias field in order to include the uncertainty of the material\u2019s non-uniformity and also dimensional and attachment errors.In this section, an experimental verification of the measurement system in this paper is reported. A single thin-film magneto-impedance sensor was installed in the magnetic field generating structure reported in this paper, and it confirmed the validity and operational performance of the system.The thin-film magneto-impedance sensor and driver circuit which were used in this study were the same ones which were reported previously by us . A singlt = 0, where a step-up signal was detected, and it stopped at time t = 105 s, where a step-down signal was detected. The feeding speed in this study was 10 mm/s. The sensor can detect 1 mG in the feeding direction as 0.1 V output. The measured result in this figure shows an increasing tendency as a function of time, and then as a function of the table position. The reason for this increasing tendency was the existence of a steel plate at the bottom of the feeding table that was used to fix it mechanically to the feeding actuator. The variation range was almost 2.3 V of sensor output, corresponding to a 23 mG variation in static magnetic field in the sensor\u2019s sensing direction.In this section, the target specifications of the system developed for medical applications is discussed.From the view point of sensor sensitivity, a prior study utilized a Hall probe which had a sensitivity of 1 \u03bcT for detecting magnetic nanoparticle concentrations . It achi\u2013shaped element.Regarding the size of the sensor element, the smaller element size has higher precision in position and size estimation, especially when the detected particle is becoming nearer to the sensor element. The reason is the spatial distribution of the detected magnetic field coming from the magnetized particle. The 1 mm sensor element in this paper has a disadvantage from this view point. A newly developed, small size magneto-impedance sensor would be applicable . AdditioFrom the view point of the realization of the sensor array using multiple sensors, the development of a small unit of the sensor\u2019s driver circuit having a low noise and high-sensitivity is indispensable. A fundamental concept of the driver circuit was already proposed, as shown in this paper, and thus an effort towards miniaturization is the point of future development.The sensor\u2019s driver circuit which was used in this experiment was the same one as in the previous report ,21,22. T\u03d5 20 \u03bcm magnetic sphere can be detected by a sensor having a 10\u22128 T sensitivity at a distance of 3 mm. In order to expand the consideration for the case of a cluster of nanoparticles, we have to consider the dispersed magnetic particles in a particularly shaped volume. Dispersion of the particle concentration inside the volume also needs to be considered, and these are expected as subjects of future study.The detection limit of this measurement system is discussed as the final aspect of this paper. It is easily understood that the limit is determined by the sensor sensitivity and also the strength of the magnetic dipole, with the latter having the same meaning as the magnetic moment of the measured sample. The magnetic moment is derived from a multiplication of the magnetization and the sample volume. It is also affected by the distance between the magnetic moment and the sensor. With increasing distance, the strength of the magnetic field coming from the magnetic moment at the sensor position decreases. In order consider the system sensitivity, we have to consider three parameters: sensor sensitivity, the magnitude of the magnetic moment and the detection distance. The fundamental equation for this consideration is a simple one, which was already discussed in our previous work ,23. Figu\u22127 T) at the sensor, was detected at a distance 27 mm from the sensor.A uniform and strong magnetic field generator was developed which is applicable to a human body scan. A sensor system in combination with a uniform strong magnetic field and also an array of thin-film magneto-impedance sensors within the strong magnetic field was designed, fabricated, and experimentally evaluated. The magnetic field in the measurement area was uniform in strength and was directionally aligned with a structure having adequate volume to insert a human body. The thin-film sensor was set in the vicinity of the magnet with its sensing direction perpendicular to the strong magnetic field. This system has the ability to detect a stray field of magnetic particles and also to estimate their 3D position and concentration. As a result, a prototype of a magnetic field generator with an area of W500 mm \u00d7 L400 mm \u00d7 H210 mm and with a uniform magnetic field of 370 Gauss was developed, and a thin-film magneto-impedance sensor was installed in it. Experimental verification showed that the 2 mm \u00d7 1 mm ellipsoidal small magnetic chip, which generated about 1 mG (10"}
+{"text": "Lianhua Qingwen capsule (LHQW) can attenuate lung injury caused by influenza virus infection. However, it is unclear whether the intestinal microbiota plays a role in LHQW activity in ameliorating viral infectious pneumonia. This study aimed to investigate the role of intestinal microbiota in LHQW activity in ameliorating viral infectious pneumonia and its possible mechanisms.via network pharmacology and verified through molecular docking, molecular dynamics simulation, and free binding energy calculations.A mouse model of influenza A viral pneumonia was established by intranasal administration in BALB/c mice. Detection of influenza virus in the lungs, pathological examination of the lungs and small intestine, and biochemical detection of inflammatory indices were performed. The effects of LHQW on intestinal microbiota were evaluated by 16S rRNA gene sequencing. The key components and targets of LHQW were screened Bacteroidetes, Muribaculaceae_unclassified, and Streptococcus decreased significantly. LHQW treatment reduced the viral load in the lungs, rescued body weight and survival, alleviated lung and intestinal mucosal barrier injury, reversed the reduction in the intestinal microbiota alpha diversity, and significantly increased the abundance of Bacteroidetes and Muribaculaceae. Network pharmacological analysis showed that six active herbal medicinal compounds from LHQW could regulate the intestinal microbiota and inhibit the immune-inflammatory response through the Toll-like receptor (TLR) and nuclear factor-\u03baB (NF-\u03baB) signalling pathways in the lungs.Body weight decreased, inflammatory factor levels were disturbed, and the lung and intestinal mucosal barriers were significantly injured in the infected group. The alpha diversity of the intestinal microbiota decreased, and the abundance of These results suggest that LHQW is effective for treating influenza A virus infectious pneumonia, and the mechanism is associated with the regulation of the TLR4/NF-\u03baB signalling pathway in the lungs by restoring intestinal microbiota and repairing the intestinal wall. The new strain overcomes existing immunity in humans, leading to a new influenza epidemic , H1N1, and H3N2. Human seasonal influenza virus A can generate new strains epidemic . Anotherepidemic . If the epidemic . Due to epidemic ; therefoLianhua Qingwen capsule (LHQW), a traditional Chinese medicine compound, has complex components and various effects . The LHQAccording to TCM theory, the lung and large intestine interact in terms of physiological, pathophysiological, and immune functions. Both belong to the mucosal immune system, although the intestine and respiratory tract are two separate organs. The latest research has indicated that changes in intestinal microbial composition and function are correlated with the development of lung diseases (\u201cintestine\u2013lung axis\u201d) . MoreoveThis study aimed to investigate the role of intestinal microbiota in LHQW activity in ameliorating viral infectious pneumonia and its possible mechanisms. In this study, 16S rRNA was used to analyze the characteristics of the intestinal microbiota. Computer-aided design technology was used to integrate disease, drug-related genes, and proteins for comprehensive analysis to explore the relationship between microbes and respiratory diseases mediated by LHQW through the \u201cintestine-lung axis\u201d and the potential molecular mechanism of the major active components and targets of LHQW.A total of 90 SPF BALB/c mice aged between 6 and 8\u2009weeks  were used in this study. Mice were purchased from Qinglongshan Animal Farm, Jiangning District, Nanjing. The same pathogen-free room was used to accommodate all the mice at 18\u201325\u00b0C and 50\u201360% humidity. All animal experimental procedures strictly followed the protocol approved by the Ethics Committee of Wannan Medical College (YJS-2020-10-006).Anti-TLR4 rabbit pAb , anti-NF-\u03baB p65 rabbit mAb , anti-phospho-NF-\u03baB p65 (Ser536) anti-rabbit mAb , anti-MyD88 rabbit mAb , anti-occludin rabbit anti-mouse , and anti-ZO1 rabbit anti-mouse  were used as primary antibodies. The secondary antibody was horseradish enzyme-labelled anti-rabbit IgG [Zsbio ZB-2301]. TRNzol Universal Total RNA Extraction Reagent , Scientific Revertaid First-Strand cDNA Synthesis Kit , and One-Step Prime Script RT\u2013PCR Kit  were used. Primers were synthesized by Shanghai Shenggong Bioengineering Technology Co., Ltd. Lianhua Qingwen capsules  and oseltamivir phosphate capsules  were used. A nucleic acid protein tester , high-speed freezing centrifuge , and real-time fluorescence quantitative PCR instrument  were used. An enzyme-linked immunosorbent assay (ELISA) test kit for Lipopolysaccharide (LPS) was purchased from Hangzhou Lianke Biotechnology Co., Ltd.\u20132.1/50\u2009\u03bcl. After the mice were lightly anesthetized with ether, 50\u2009\u03bcl of 10\u20132.1 LD50 influenza virus solution was evenly dropped into the nostrils of each mouse to establish the model. The control group(control) received nasal drip of normal saline. Mice were randomly assigned to a control group (18) or an infected group  strain was subcultured in chicken embryos. The titer of the amplified virus was 1:440, and the median lethal dose (LD50) was 10ed group . The mic\u22121 (LHQW-M) Lianhua Qingwen capsule, 22\u2009mg\u2009d\u22121 (LHQW-H) Lianhua Qingwen capsule high-dose group and 395.90\u2009\u03bcg\u2009d\u22121 oseltamivir group (OSTW) , 11\u2009mg\u2009dp (OSTW) . There wMice were anesthetized with ether. Blood was collected from the orbit of each mouse. The mice were sacrificed by cervical dislocation. The abdominal cavity was opened using surgical scissors, and the intestinal canal was dissected. Furthermore, 6\u2009cm jejunum and ileum segments were taken. RNA was extracted from the first 1/2 segment to detect the expression of the inflammatory factor-related mRNAs. The first two segments were fixed in 10% neutral-buffered formalin. The lung tissues of mice were aseptically extracted and evenly divided into three parts. One-third of the total RNA was extracted to detect the expression of inflammatory factor-related mRNA. The other third was homogenized, and the last third was fixed in 10% neutral buffered formalin.A\u2009=\u2009B/C*100%, where A represents the lung organ index, B represents the lung weight (mg), and C represents the body weight (g); and D\u2009=\u2009(E \u2212 F)/G*100%, where D represents the inhibition rate of the lung index (%), E represents the average lung index of the infected group, F represents the average lung index of the administration group, and G represents the average lung index of the infected group , and tumor necrosis factor-\u03b1 (TNF-\u03b1) in the mouse lung were detected using quantitative real-time reverse transcription PCR (qRT-PCR), as was the expression level of Interleukin-1\u03b2 (IL-1\u03b2) and interleukin-10 (IL-10). After homogenization at 4\u00b0C and 12,000 RPM, centrifugation was performed for 15\u2009min, after which the supernatant was collected, isopropanol was added at an equal volume to the supernatant, and the mixture was allowed to stand before centrifugation. The supernatant was discarded, and the precipitate remained.\u2212\u0394\u0394Ct and the relative gene expression were calculated using the CT method.In addition, 1\u2009ml of 75% ethanol was added to each tube and mixed evenly. The supernatant was then centrifuged, discarded, and dried for 5\u2009min. A total of 60\u2009\u03bcl of DEPC-treated water was pipetted repeatedly until it was evenly mixed. The sample was dissolved at room temperature, shaken to properly mix, and centrifuged at a low speed for 10\u2009s. After the system was prepared, 20\u2009\u03bcl was centrifuged at a low speed for 10\u2009s, vortexed, properly mixed, and then centrifuged again. The reaction parameters were 95\u00b0C for 1\u2009min (preheating), 95\u00b0C for 15\u2009s, and 60\u00b0C for 30\u2009s (40\u2009cycles), followed by the production of a dissolution curve  using \u03b2-actin as an internal reference gene. After the reaction, 2After 30\u2009min of blood sample agglutination and centrifugation, the serum sample was drawn and stored at \u221280\u00b0C. A concentrated standard sample was used for gradient dilution to prepare a standard curve of the serum sample. All the reagents and samples were maintained at room temperature before testing. After soaking the enzyme standard plate, add the standard, add the standard diluent to the blank well, and add 1\u2009\u00d7\u2009to the sample well detection buffer 90 and 10\u2009\u03bcl of sample. Following the kit instructions, double wavelength detection was performed using a microplate reader to determine the optical density (OD) value at the maximum absorption wavelength of 450\u2009nm and a reference wavelength of 570\u2009nm.Paraffin sections of the lung and intestine were stained with H&E and alcian blue. After HE staining, the structure of small intestine wall was observed under light microscope. 10\u2009slices of small intestine were taken from each group of mice. Each slice had 10 visual fields, and digital photography was taken. In each photo, the deepest recess depth , the thickest mucosal thickness and muscular layer thickness were measured. The morphology and distribution of goblet cells in the epithelium were observed under light microscope, and the number of goblet cell positive cells distributed in each recess was counted. The expression levels of zonula occludens 1 (ZO-1) and occludin were detected by immunohistochemistry. Pathological sections were randomly photographed at magnifications of 100\u2009\u00d7\u2009and 200\u2009\u00d7. The OD values of the immunohistochemical images were analyzed using ImageJ software to obtain relative expression.2O2 was added and incubated at room temperature for 10\u2009min. After rinsing, 5% bovine serum albumin (BSA) was added and incubated at room temperature for 60\u2009min. Rabbit anti-mouse primary ZO-1 and occludin antibodies were added dropwise without washing before incubation at 4\u00b0C overnight. After rinsing, biotinylated sheep anti-rabbit IgG and rabbit anti-goat IgG antibodies were added. The sample was then washed and 3, 3\u2032 diaminobenzidine tetrahydrochloride (DAB) was added at room temperature for 60\u2009min.For immunohistochemistry, the fixed small intestine was removed, embedded in paraffin, cut into 5-\u03bcm-thick slices, and HFor Alcian blue staining, the slices were placed in a drying oven and baked at 66\u00b0C for 20\u201330\u2009min. Three courses of xylene and three courses of ethanol were added successively. Alcian blue staining solution (100\u2009\u03bcl) was added dropwise to each slice, which was then dyed in a wet box for 1\u2009h. The staining solution was removed, 100\u2009\u03bcl of nuclear solid red staining solution was added to each slice, and sections were washed with water. These samples were passed through three successive passes of ethanol, phenol-xylene, I, and xylene II.16S rDNA high-throughput sequencing was performed on the mouse feces collected from each group. The total DNA of bacteria in feces was extracted, and 10\u2009ng of DNA template was used for PCR amplification according to the sequence of the v3\u2013v4 region. The library was constructed using a library building kit, quantified using Qubit and qPCR, and sequenced on a computer. Representative sequences were selected and annotated, and the species were classified using a database.Fresh small intestinal tissue was collected, and proteins were extracted and quantified. SDS\u2013PAGE, membrane transfer, blocking, and incubation of both primary and secondary antibodies, as well as chemiluminescence and development were carried out. The grayscale of the target protein and internal reference protein was scanned using ImageJ software, and then semiquantitative analysis of the protein content was conducted to obtain NF-\u03baBand p-NF-\u03baB (Phospho NF-\u03baB) levels, as well as the relative expression of Toll-likereceptor4(TLR4) and myeloid differentiation factor 88 (MYD88).Chinese drug compounds were searched in the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP) and Traditional Chinese Medicines Integrated Database (TCMID). The PubChem database was used to obtain the structures of the described components, which were imported into the Swiss target prediction database. A target with a prediction score greater than 0 was considered the drug target, and the Batman database was used to obtain the components and targets of gypsum. Oral bioavailability (OB) and drug-likeness (DL) were set at\u2009\u2265\u200930% and\u2009\u2265\u20090.18, respectively, in the TCMSP database to screen for effective components in the LHQW drug group. Finally, the components of Rhodiola in the TCMID database and gypsum in the Batman database were searched .A total of 253 potentially active components were obtained, and 1,077 drug targets were screened. The GeneCards database was searched using \u201cinfluenza virus\u201d as the keyword. The targets were selected with an evaluation score greater than 10, and the disease targets were obtained after the removal of weightings.Cytoscape 3.7.2 software was used to construct the \u201cdrug component target disease\u201d network diagram, and a network analyzer was used to analyze the topology of the network diagram. In addition, a PPI cluster analysis diagram was drawn using Cytoscape software. After running the common target in the R language, gene ontology (GO) analysis identified the molecular function, cell composition, biological process, and Kyoto Encyclopedia of Gene and Genome (KEGG) pathway of the top 20 hits.The Schrodinger software was used to construct a ligand molecular database for molecular docking. The crystal structure was downloaded from RCSB PDB. The protein structure was imported into Maestro 11.9 platform, and the protein structure was prepared using Schrodinger. The receptor was pretreated, optimized, and minimized (the OPLS3e force field was applied for constraint minimization).Desmond version 2020 was used for the MD simulation of proteins and compounds. OPLS3e was selected as the molecular force field for the MD simulation, and the TIP3 water model was used to solvate the system. Energy minimization of the entire system was achieved using the OPLS3e force field . A Berendsen coupling algorithm was used to create coupling between the temperature and pressure parameters. In the later preparation of the system, 100\u2009ns were run at a time step of 1.2 femtoseconds, and the track was recorded every 10\u2009ps, recording a total of 1,000 frames. The root-mean-square deviation (RMSD) of backbone atoms was calculated, and graphical analysis was performed to illustrate the nature of the interactions between proteins and ligands. The root-mean-square fluctuation (RMSF) of each residue was calculated to determine the major conformational changes in each residue between the initial and dynamic states.The basic principle of the molecular mechanics/Poisson Boltzmann  surface area (MM-GBSA) method is to calculate the difference between the binding free energies of two solvated molecules in the binding and free states or to compare the free energies of different solvated conformations of the same molecule.where All statistical analyses were performed using the SPSS software (version 18.0). Measurement data are expressed as p\u2009<\u20090.01, p\u2009<\u20090.01, p\u2009<\u20090.05, p\u2009<\u20090.01, p\u2009<\u20090.01, p\u2009<\u20090.01). Body weight change, total daily food consumption of mice, viral load in mouse lung tissue, lung index, and lung inhibition rate were separately classified and counted for female and male mice. According to the results of statistical calculation, the sex difference is not significant (p\u2009>\u20090.05), so no sex classification statistics was carried out in the subsequent experiments.In this study, the degree of lung injury was evaluated using the mouse lung index, lung inhibition rate, and lung histology (HE staining). Compared with the control group mice, H1N1 infected mice (infected group) showed reduced diet ,F and wep\u2009<\u20090.05). At the phylum level, the microbiota abundance (Bacteroidetes) decreased significantly, and at the genus level, the microbiota abundance  decreased significantly. Compared with the infected group intervention, LHQW reversed the red function in the four indices to varying degrees, and the Shannon index increased significantly (p\u2009<\u20090.05)  was significantly higher in the LHQW group and was close to that of the control group (p\u2009<\u20090.05).There were differences between the three groups, indicating no errors in the experimental group . The sta\u2009<\u20090.05) . The micHE staining of the small intestine showed that the crypt depth decreased, the muscle layer thinned, and the colon length was shortened in the infected group compared to that in the control group . Alcian Network pharmacological screening detected 1,077 drug targets and 421 disease targets. A total of 115 common drug-disease targets were obtained at the intersection of the targets . The PPIGO results showed that the intersection gene set was enriched in 2333 biological process pathways , 89 cellAKT1 (PDB ID: 4gv1) target was used to assess the effectiveness of the docking method. The protein had high crystal structure accuracy, no deletion of key residues, clear active sites, and a clear binding mode between small-molecule ligands and active sites . ProtoliThe top 50 compounds were selected based on the energy score obtained from the docking results. 10 compounds were obtained for each gene target by scoring the binding energy and evaluating the key residues of the active sites .The core active components (204) of LHQW were docked with AKT1, STAT3, TLR4, TNF, VEGFA, and IL6 targets. The PyMOL21 software was used to visualize the complexes formed by docking. For each target, the compound was selected with the best score for protein targeting and docking . The binding mode between the compounds and proteins was then used to visualize the amino acid residues between the compounds and protein pockets.Ligand063 has multiple hydrogen bond donors and receptors and thus forms strong hydrogen and hydrophobic bonds with protein active sites . The hydThe stability of reactive proteins and small molecules depends on the RMSD. The larger the RMSD, the more unstable is the protein. The stability of small molecules fluctuated at the beginning and tended to stabilize during movement, reflecting the continuous collision between small molecules and active sites in the protein pocket . This reThe calculation of static molecular docking and molecular mechanics generalized Born surface area (MM-GBSA) free binding energy ensures that the complexes of compounds and targets have sufficient energy for biochemical reactions by providing binding posture and binding free energy. The binding free energy calculated using MM-GBSA supported the molecular docking results. Ligand103 had the highest binding ability to TNF (210.26\u2009\u00b1\u200922.01) and TLR4  to determine the relationship between the amount of virus in the mouse lung and the main target of LHQW in the treatment of influenza A virus and abundance of the intestinal microbiota. The correlation between the abundance of the intestinal microbiota at the phylum and genus levels and the targets screened using computer-aided design technology was also assessed.Bacteroidetes abundance. In contrast, these levels were positively correlated with Verrucomicrobia, Gemmatimonadetes, Rokubacteria, and Chloroflexi. At the genus level, INF-\u03b1, TLR4, NF-\u03baB, TNF-\u03b1, IL-6, and IL-1\u03b2 levels were negatively correlated with Prevotellaceae_UCG-001, Muribaculum, and Muribaculaceae_unclassified abundances. In contrast, these levels were positively correlated with Blautia, Klebsiella, Parabacteroides, Roseburia, Bilophila, Eisenbergiella, Citrobacter, Akkermansia, and Clostridiales_unclassified abundance  and TLR4, NF-\u03baB, TNF-\u03b1, IL-6, and IL-1\u03b2 levels were negatively correlated with bundance .Oseltamivir (OSTW), a neuraminidase inhibitor commonly used to treat influenza, is an antiviral drug listed in China. OSTW is a classic antiviral drug with good antiviral effects. However, based on the principle of neuraminidase inhibition, the protective effect of this drug on influenza patients has a time window. Taking it 48\u2009h after onset can significantly shorten the course of the disease and inhibit virus replication. Therefore, we selected OSTW as the positive control drug in this study. BALB/c inbred line mice had the same genetic background. The use of Balb/c mice can reduce the influence of genetic background factors among individual mice on the difference in virus infection sensitivity; therefore, it is easier to study and analyze the dynamic characteristics of viral pathogenicity and replication. BALB/c mice were selected for this study according to the standard operating procedures of the In this study, we found that the inflammatory factors in the lungs of mice with viral pneumonia were disordered, the lungs were damaged, and the TLR4 pathway was significantly activated . One of During the course of influenza virus infection, three different types of innate immune pattern recognition receptors (PRRs) recognize viral RNA, namely Toll-like receptors (TLRs), retinotide-induced gene I (RIG-I), and NLRP3. After receptor activation, interferon regulators 3/7 (IRF 3/7) and NF-\u03baB are activated to promote the expression of IFNs and pro-inflammatory factors, respectively . TLRs arTNF-\u03b1 is considered the major pro-inflammatory cytokine capable of causing \u201ccytokine storm\u201d , therebyBacteroidetes, muribaculaceae_unclassified, and Streptococcus decreased significantly  decreased significantly, which plays an important role in intestinal defense against pathogenic bacteria  entering the intestinal wall are reduced and the resulting immune response and inflammatory factors are also decreased. Meanwhile, LPS crossing the intestinal wall to enter the blood stream and eventually reach the lungs was significantly reduced, thus reducing the activation of the LPS/TLR4/NF-\u03baB signalling pathway ,B, thereThe present study was designed to determine the effect of intestinal microbiota in the improvement of LHQW activity in viral pneumonia and its possible mechanism. The findings clearly indicate that LHQW is effective for treating influenza A virus infectious pneumonia, and the mechanism is associated with the regulation of the TLR4/NF-\u03baB signalling pathway in the lungs by restoring intestinal microbiota and repairing the intestinal wall. This result provides theoretical support for the effective use of LHQW in the treatment of influenza A virus.The data presented in the study are deposited in the NCBI repository, accession number PRJNA889462.The animal study was reviewed and approved by all animal experimental procedures strictly followed the protocol approved by the Ethics Committee of Wannan Medical College (YJS-2020-10-006).PX, ZY, and SD performed the experiments, the data, and wrote the manuscript. ZH and SZ contributed to the study design and overall supervision. All authors have reviewed the manuscript. All authors contributed to the article and approved the submitted version.This work was financially supported by the Natural science projects in colleges and universities in Anhui Province (grant number KJ2020ZD56) and the National Natural Science Foundation of China (grant number 81671318). SZ received funding from the Natural science projects in colleges and universities in Anhui Province (grant number KJ2020ZD56). ZH received funding from the National Natural Science Foundation of China (grant number 81671318).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
+{"text": "The liver plays a vital role in maintaining the physiological homeostasis of mammals and is responsible for many biological processes, including detoxification, bile acid synthesis, glycolysis, and lipid metabolism . The livHhex, hepatocyte nuclear factor 4\u03b1 (Hnf4\u03b1), fibroblast growth factors (FGFs), bone morphogenetic proteins (BMPs), Wnt/\u03b2-catenin, and Hippo pathway play essential roles  8.5 - E9.0 in mouse embryos . By E10.al roles . Until Eal roles . After bal roles . As a real liver . After aal liver . By P7, al liver , becomesal liver .In recent years, single-cell transcriptome sequencing has been developing rapidly and has been applied in many research fields, such as cell atlas construction, as well as studying embryo development and disease pathogenesis . In termFor this study, we performed snRNA-seq to profile 82,967 nuclei from four key time points of postnatal murine liver development . We identified 28 clusters of hepatic cell types and analyzed the dynamic changes in cells composition and functions and the hepatocyte differentiation trajectories during this process. Interestingly, we found two HSC subtypes specifically expressing some markers of LECs or Kupffer cells. In addition, the ligand-receptor interaction and transcription factor regulative activity analysis significantly increased the reliability of the new cell types.All mice used in this study were in C57BL/6 background. The Institutional Review Board approved the use of mice in relevant experimental studies on the Ethics Committee of BGI (Permit No. BGI-IR20210903001). Four neonatal mice from different time points  after birth were purchased from Jiangsu Ailingfei Biotechnology Co. LTD. and used in this study. Mice were transported to the Guangzhou Institute of Biomedicine and Health (GIBH) of the Chinese Academy of Sciences, where GIBH colleagues helped with tissue dissection. Liver tissues were harvested, resected, and snap-frozen in liquid nitrogen. The dissected mouse liver tissues were transported on dry ice to BGI-Shenzhen and were immediately stored in a liquid nitrogen tank.2 , 0.1% NP-40 , 1 \u00d7 protease inhibitor cocktail , 0.1\u00a0mM DTT , and 0.12\u00a0U/\u00b5l RNasin Plus ]. The tissue was incubated on ice for 5\u00a0min and homogenized by 25 strokes of the loose Dounce pestle, after which the homogenate was filtered through a 70\u00a0\u03bcm cell strainer . Next, the filtered homogenate was further homogenized by 25 strokes of the tight pestle to release nuclei, then filtered through a 40\u00a0\u03bcm cell strainer  into a 15\u00a0ml centrifuge tube and centrifuged at 500\u00a0g for 5\u00a0min. The sediment was resuspended in 1.5\u00a0ml blocking buffer containing 1 \u00d7 phosphate buffer saline , 1% filtered sterilized BSA, and 0.2\u00a0U/ml RNasin Plus by pipetting up and down gently and centrifuged at 500\u00a0g for 5\u00a0min. The previous step was repeated once. The nuclei were resuspended in 0.04% BSA of PBS, then counted by DAPI  staining and diluted to a concentration of 1,000 nuclei/\u03bcl.Nuclei were isolated from frozen mouse liver tissue according to a published nucleus extraction method . All theThe single-nucleus RNA-seq libraries were prepared as previously described  with DNBhttps://github.com/shiquan/PISA) was used to parse raw reads into FASTQ+ format based on the library structure and correct cell barcodes with the allow list if the hamming distance is equal or lower than one. The reformed reads were aligned to reference genome GRCm38 (mm10) by using STAR  sequences. The read 2 contains 100\u00a0bp of transcript sequences. The PISA software  package to create a Seurat object followed by normalization, scaled, and dimensionality reduce by the CreateSeuratObject, NormalizeData, FindVariableFeatures, ScaleData, and RunPCA functions in turn with default parameters . Then, wAbout 10,000 hepatocytes were extracted from the integrated Seurat object and introduced into Monocle 2 (v2.18.0) by the as.CellDataSet function . Then, wTo investigate the possible regulatory network intra- or inter-cell, we performed transcript factor regulatory analysis and ligand-receptor interaction analysis by using the pySCENIC (v0.11.2)  package The marker gene dot plot and Uniform Manifold Approximation and Projection (UMAP) were visualized by the DotPlot and DimPlot functions of Seurat, respectively. The bar plot of GO term enrichment was visualized by the barplot function of the clusterProfiler package (v3.18.1) . The ploTo generate an overview of postnatal liver development at the single-cell resolution, we performed snRNA-seq on the liver of mice at P0, P3, P7, P14, and there are three biological replicates at each time point . First, In total, 82,967 single nucleus transcriptomes from the 39 snRNA-seq libraries passed quality control, with a median number of 2,254 UMIs and 1,005 genes per cell . BesidesTo investigate the cells composition and the functional diversity of different cell types during postnatal liver development at single-cell resolution, we integrated all snRNA-seq data from four time points and clustered them into 28 clusters with eliminated batch effect by using Seurat . We furtAfp, H19, and Ahsg, which were essential factors for hepatocyte differentiation and tumorigenesis in hepatocellular carcinoma (HCC)  . The hepd Cyp2f2 . On the Vwf were discovered. For mesenchymal cells, we identified two HSCs subtypes and fibroblast. The fibroblast distinctively expressed Eln, Col1a1, and Gpm6a. In addition, both the HSC subtypes expressed classical marker genes Dcn, Reln, and Fgfbi.Regarding the liver resident non-parenchymal cells, including LEC, HSC, Kupffer cell, we identified many cell subtypes and compared their cell proportion at all time points. Besides, the Kupffer cells increased significantly at P3 and P7 but decreased sharply at P14, suggesting more immune challenges to respond to drastic environmental changes after birth. On the other hand, three LEC clusters, including liver sinusoidal endothelial cell (LSEC), proliferating endothelial cell, and liver vessel endothelial cell (LVEC), that specifically expressed Cd5l and Marco was annotated as Stellate 2/Kupffer, which was recently mentioned by a published paper . The myeloid cells identified in our datasets consisted of common myeloid progenitor (CMP), neutrophils, monocytes, and dendritic cells, expressing classic marker genes, such as Mpo, S100a8, Ccr2, and H2-Aa, respectively. The erythroid lineage contained erythroblast and immature erythrocyte, both of which highly expressed Hba-a1 and Hbb-bt. The erythroblast, also highly expressed Gypa and Gata1 are a critical determinant of erythrocyte differentiation  PathFinally, we investigate the essential regulatory genes in the mouse liver development process after birth. We performed single-cell regulatory network inference and clustering (SCENIC) analysis . And we Pcdhg3 and Pcdhg11, which may be of great importance in the establishment of specific cell-cell connections. Furthermore, by regrouping and annotation, we obtained two new heterogeneous cell subtypes in stellate 2, respectively expressed markers of LEC and Kupffer cell, including Egfl7, Kdr, Cd5l, and Macro. Moreover, the CellChat analysis showed that the CDH signaling pathway only enriched among hepatocyte clusters and stellate 2, which may influence the proliferation of hepatocyte. For hepatic parenchyme cell, we identified several immature hepatocyte subtypes and cholangiocyte, respectively highly expressed Afp, Ahsg, Spp1, and Onecut2. But we do not find the liver stem cell population (hepatoblast) by checked the expression levels of classic marker genes, such as Dlk1, Nope, Cd24a, Prom1 and Epcam, which is consistent with the known fact that hepatoblast differentiation mainly occurs from E13.5 to E18.5 during mouse embryonic development (in vitro, organoid and disease models, because they have some similar characteristics to hepatocyte progenitor cells and strong cellular plasticity (Alb and Ttr (In summary, we profiled the single-nucleus transcriptome of mouse postnatal liver development at four time points, identified 28 different hepatic cell types, and investigated the dynamic of cells composition. Interestingly, we identified a new subtype of hepatic stellate cells that exclusively expressed many genes of the protocadherin family, such as elopment . Consideelopment , so we telopment . Such imasticity . In addi and Ttr . SOX9 si and Ttr . In a wo"}
+{"text": "In conclusion, miR-101 attenuated the Warburg effect and NSCLC proliferation through IDH2/HIF1\u03b1 pathway.Lung cancer is the most diagnosed and deadly cancer in China. MicroRNAs are small noncoding RNA gene products that exhibit multifunctional regulation in cancer cell progressions. MiR-101 loss was illustrated in about 29% of lung cancer patients, and sophisticated mechanisms of miR-101 regulation in NSCLC are eager to be disclosed. Here, using specimens from NSCLC patients and Dural-luciferase reporter assay, we got a clue that miR-101 correlated with IDH2. MiR-101 overexpression and IDH2 deficiency both suppressed NSCLC tumor growth in mice. Moreover, in NSCLC, miR-101 suppressed IDH2 expression levels, further increased  As a global health problem, lung cancer is the most diagnosed 0.82 million) and deadly cancer (0.72 million) in China in 2020 . Among t million MicroRNAs are small noncoding RNA gene products with 22\u2009nt. MicroRNAs regulate biological processes by regulating the translation and degradation of target mRNAs , 5. TherIn hepatocellular carcinoma (HCC), miR-101-3p was demonstrated to suppress glycogen phosphorylase B (PYGB) expression posttranscriptionally to finally decrease cell proliferation, migration, and invasion . In card\u03b2 accelerated NSCLC proliferation and migration by suppressing miR-101 expression through the COX2-HIF1\u03b1 signaling pathway, which indicated the correlation between HIF1\u03b1 and miR-101 in NSCLC [In lung cancer patients, about 29% exhibited loss of miR-101  and resein NSCLC . Shao etin NSCLC . In 2018in NSCLC . The new\u03b1-ketoglutarate (\u03b1-KG) and CO2 or the reverse function [\u03b1-KG into citrate, leading to a reduced \u03b1-KG concentration [\u03b1-KG was reported to exhibit antitumor effects through inhibition of angiogenesis in mice models [\u03b1-KG was a substrate of the \u03b1-KG-dependent dioxygenases, including KDM, TET2, PHD2, and PLOD1-3, which control histone demethylation and HIF1\u03b1-dependent cellular signaling and collagen formation [\u03b1 is broadly expressed and correlates with poor prognosis in human cancers by regulating genes involved in glycolysis, angiogenesis, cell cycle progression, and other cellular pathways [\u03b1 pathway was responsible for cancer proliferation, such as cervical cancer [Warburg's theory refers to metabolic reprogramming in cancer cells. Even with enough oxygen, cancer cells still were characterized by high glucose uptake rate, active glycolysis, and high content of lactic acid . Althougfunction . For exafunction . In addintration . \u03b1-KG wae models . \u03b1-KG waormation . HIF1\u03b1 ipathways . Studiesl cancer  and lungl cancer .\u03b1-KG concentration. Because IDH2 was critical in the Warburg effect and \u03b1-KG concentration was vital for HIF1\u03b1 hydroxylation, we then evaluated the influences of miR-101 on NSCLC metabolism and HIF1\u03b1 expression and hydroxylation. Taken together, we concluded that miR-101 attenuated NSCLC proliferation by accelerating HIF1\u03b1 hydroxylation and degradation. These discoveries implicated the new mechanism of miR-101 in NSCLC and may provide new targets for NSCLC therapies.In this study, we made an attempt to explore the new mechanisms of miR-101 regulation in NSCLC. The dual-luciferase analysis suggested that miR-101 may target IDH2. We utilized in vivo assay to evaluate the tumor growth of NSCLC cells overexpressed with miR-101 or IDH2 deficiency. We also investigated the influence of miR-101 on the IDH2 expression levels and downstream Lung cancer tissues and corresponding adjacent tissues were obtained as mentioned before . NSCLC p6 per mouse. 150\u2009mg/kg fluorescein was injected intraperitoneally at 2, 4, and 6 weeks after tumor cells injection. Mice were photographed with a Xenogen IVIS imaging system, the tumor sizes and volumes were analyzed, and the tumor growth curve was depicted. The nude mice were sacrificed at 8 weeks.Severe combined immunodeficiency (SCID) mice  were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and then kept under aseptic conditions. The experiments were approved by the Biomedical Ethics Committee, School of Medicine, Xi'an Jiaotong University . 12 SCID mice were equally assigned into 4 groups randomly. Lentivirus transfected pre-miR-101-A549-luc cells (miR-101), shIDH2-A549-luc cells (shIDH2), miR-NC-A549-luc cells (miR-NC), pre-miR-101-H460-luc cells (miR-101), shIDH2-H460-luc cells (shIDH2), and miR-NC-H460-luc cells (miR-NC) were subcutaneously injected into SCID mice by 1 \u00d7 10We obtained 293\u2009T cells from our lab, and we purchased A549 and H460 human NSCLC cell lines from American Type Culture Collection . Cells were cultured in RPMI 1640 medium with 10% fetal bovine serum , penicillin (100\u2009U/mL), and streptomycin (100\u2009U/mL) at 37\u00b0C in 5% CO2.\u03bcM, HY-12320, MedChemExpress, USA) for 2 hours or PX-478  for 24 hours, or \u03b1-KG  for 24 hours before subsequent examinations.We cocultured A549 and H460 cells with Cycloheximide . cDNAs were amplified by the SYBR system . The expression levels of mRNAs and miRNAs were calculated by the 2\u03b2-Actin , anti-HIF1\u03b1 , anti-IDH2 antibodies , and anti-Hydroxy-HIF1\u03b1  at 4\u00b0C overnight. After being washed for 3 times by 0.5% TBST, membranes were incubated with second antibodies at a dilution of 1\u2009:\u20094000 at room temperature for 2 hours then washed by 0.5% TBST for 3 times. Blots were then quantified by electrochemiluminescence and visualized by Gel Imaging System .Tissues were homogenized with liquid nitrogen. Cells and tissues were then lysed by lysis buffer for 10\u2009min on ice and then, centrifuged at 12,000\u2009rpm for 15\u2009min at 4\u00b0C. Supernatants were mixed with loading buffer and underwent SDS-PAGE to separate proteins. Proteins were then transferred into the PVDF membrane. The membranes were blocked by 5% nonfat milk in Tris-buffered saline (TBS) and then, incubated with anti-\u03bcl cell lysate and add it to the black enzyme label plate. Add 100\u2009\u03bcl firefly luciferase reaction solution, shake the plate, and mix well to detect the activity of firefly luciferase. Add 100\u2009\u03bcl of sea kidney luciferase reaction solution, mix well with a shaking plate, and detect the activity of sea kidney luciferase.The Dual-luciferase reporter assay was conducted as mentioned before . Plasmid\u03bcg/ml) were screened for mRNA expression by RT-qPCR.Plasmids miR-101 mimic, miR-NC mimic, miR-101 mimic plus pUNO1-hIDH2, miR-NC mimics plus pUNO1-hIDH2, or pUNO1-hIDH2 along were cotransfected with A549 or H460 cells for 48 hours. Cells that survived 16 days of puromycin (200\u2009\u03bcM) coculture for 30 minutes. The ROS levels of cells were examined by BD FACSCanto\u2122 II flow cytometer (BD Biosciences), which were analyzed using FlowJo 10.4 software.1 \u00d7 106 cells were collected and washed by PBS for 3 times followed by dihydroethidium   were conducted according to the manufacturer's instructions.The production of ATP , LA , glucose , and Lung cancer tissues were from the Shaanxi Provincial Cancer Hospital, affiliated to the Medical College of Xi'an Jiaotong University. The study protocol was approved by the Biomedical Ethics Committee, School of Medicine, Xi'an Jiaotong University . Lung cancer tissues were fixed with 4% formaldehyde, embedded in paraffin, and sectioned. After the antigens were retrieved by antigen retrieval buffer, endogenous peroxidase activity was blocked by hydrogen peroxide (0.3%). The slides were stained with anti-IDH2 antibodies , followed by incubation with a horseradish peroxidase-conjugated second antibody . Color was developed with diaminobenzidine and sections were counterstained with hematoxylin.t-test. For all tests, p \u2264 0.05 was considered to be statistically significant. Each experiment was repeated for 3 times, and results were presented as mean \u00b1 SD.Statistical analysis was analyzed by GraphPad Prism 8.0  software. The significance was performed by either one-way analysis of variance (ANOVA) or unpaired, two-tailed Student To investigate the undiscovered function of miR-101 in NSCLC, we measured mRNA expression of miR-101 using the fresh tumor samples and adjacent normal tissues collected after surgery. MiRNA-101 levels were downregulated in NSCLC tissues compared with adjacent normal tissues  which weWe also examined the critical protein IDH2 in cancer metabolism. Tumor tissues expressed lower levels of miR-101 than adjacent normal tissues and a higher amount of IDH2 , which aIn the previous section, we proposed that miR-101 regulates NSCLC in some aspects. To be certain, we traced the volume of tumors in SCID mice transfected with NSCLC cell lines A549-luc or H460-luc. Mice were photographed with a Xenogen IVIS imaging system every two weeks before sacrifice Figures . Before Correlations between miR-101 and IDH2 were demonstrated by Dural-luciferase reporter assay . In thisTo explore the mechanisms of miR-101 regulating NSCLC proliferation through IDH2, we overexpressed miR-101 and IDH2 in A549 and H460 cell lines separately. First, we analyzed the mutual influence between the two by RT-qPCR assay. Overexpression of IDH2 hardly influenced miR-101 levels in both A549 and H460 cells, but overexpression of miR-101 interfered with IDH2 mRNA expression in both A549 and H460 cells Figures . For fur\u03b1-KG into citrate, leading to the reduced \u03b1-KG concentration [\u03b1-KG concentrations in A549 and H460 cells. Compared with the NC group, miR-101 promoted \u03b1-KG production but IDH2 alone and IDH2 plus miR-101 suppressed \u03b1-KG levels  in cell culture medium with or without the HIF1\u03b1 inhibitor, PX-478. MiR-101 overexpression significantly elevated ATP summation and reduced glucose uptake and LA production compared with miR-NC  into citrate from glutamine and accelerate 2-hydroxyglutarate productions [Reactive oxygen species (ROS) was the byproduct of the Warburg effect which is positively related to tumor metabolism. Cancer cells do not utilize their mitochondria to the same extent and in the same way as noncancerous cells. Mitochondrial respiration is associated with the production of ROS . Previouductions . The red\u03b1 inhibition restrained ROS levels which was in line with other studies [\u03b1 pathway.Utilizing flow cytometry, we measured ROS production in A549 and H460 cells. MiR-101 and IDH2 along both attenuated ROS proportions which implied that miR-101 and IDH2 participated in ROS production  and 8. H studies . Taken t\u03b1 pathway was indispensable in tumor growth [\u03b1 regulation kept mysterious. References demonstrated that the blocked interactions between PHD2, an \u03b1-KG-dependent dioxygenase [\u03b1 could inhibit the hydroxylation and degradation of HIF1\u03b1 [Although studies have demonstrated that IDH2/HIF1r growth \u201341, the xygenase , and HIFof HIF1\u03b1 .\u03b1 after CHX treatment. Compared with the miR-NC group, miR-101 remarkably suppressed HIF1\u03b1 production and IDH2 along accelerated HIF1\u03b1 expression. Besides, miR-101 facilitated the IDH2-dependent HIF1\u03b1 degradation (Figures \u03b1 degradation and miR-101 downregulated IDH2 functions.We evaluated the protein levels of HIF1 Figures , which f\u03b1-KG, which is a substrate of the \u03b1-KG-dependent dioxygenases, such as KDM, TET2, PHD2, and PLOD1-3, and controls histone demethylation and HIF1\u03b1-dependent cellular signaling and collagen formation [\u03b1-KG and promoted HIF1\u03b1-dependent signaling pathways. We appended \u03b1-KG to investigate deeply. We first measured HIF1\u03b1 mRNA levels with extra \u03b1-KG. Results revealed no differences between the \u03b1-KG and control group (\u03b1 mRNA-independent mechanism. Subsequently, we analyzed the hydroxylation of HIF1\u03b1 with or without \u03b1-KG by western blot assay. \u03b1-KG greatly inhibited HIF1\u03b1 levels and promoted HIF1\u03b1 hydroxylation (\u03b1 protein were exhibited by CHX treatment. \u03b1-KG accelerated HIF1\u03b1 degradation (Figures \u03b1 hydroxylation and degradation through IDH2/HIF1\u03b1 axis.As we all know, IDH2 catalyzes isocitrate into ormation . IDH2 dool group , which ixylation . After t Figures . Taken t\u03b1 axis plays a central role in the Warburg effect, which is taken advantage of by tumors for proliferation and growth [The Warburg effect is known to be part of metabolic reprogramming and has been discovered since the 1920s. Cancer cells utilize much more glucose than normal cells and transform glucose into lactate by aerobic glycolysis instead of metabolizing glucose by oxidative phosphorylation and shuttling the products of glycolysis into the TCA cycle . IDH2/HId growth \u201346.\u03b1 hydroxylation. Firstly, to screen the possible targets of miR-101 in human NSCLC samples, we examined the mRNA levels of miR-101 which were downregulated and IDH2 which was overexpressed (In this study, we describe a new discovery that miR-101 attenuated NSCLC proliferation by promoting IDH2-mediated HIF1xpressed  and confxpressed . Data imxpressed , and thexpressed . In vivoxpressed .\u03b1, the downstream metabolisms, such as ATP (\u03b1 were expedited by miR-101 overexpression in NSCLC cell lines (Figures \u03b1-KG (Figures Further, we explored the underlying mechanisms. By inhibiting HIF1h as ATP , LA (Figh as ATP , and ROSh as ATP  changed  Figures . But the Figures . TogetheIn this study, IDH2 played a central role in NSCLC regulation. In 2018, IDH2 was reported as a diagnostic and prognostic serum biomarker for NSCLC and high serum IDH2 levels appear to correlate with poor survival in patients with NSCLC . More re\u03b1-KG concentration, and finally inhibited the Warburg effect by promoting HIF1\u03b1 hydroxylation and degradation. Although we provided a valuable comprehensive landscape of miR-101 in NSCLC proliferation from many aspects, there still are some limitations in the context. The extent of miR-101 on IDH2 and whether miR-101 impacts mutated IDH2 required further studies. Next, we would dig deep and describe a more comprehensive landscape of miR-101 in the Warburg effect in NSCLC proliferation.The present study showed that miR-101 suppressed IDH2 expression levels, further increased"}
+{"text": "P < 0.05). The evaluation and treatment of patients with cerebral infarction and their prognosis based on CTA intelligent medical technology are related to collateral circulation, and the effect of effectively reducing the risk of death, cerebral hemorrhage, and neurological function injury and improving the prognosis is more obvious in each collateral circulation.A meta-analysis is used to investigate the correlation between the status of collateral circulation assessed by head CT angiography (CTA) and the outcome of thrombectomy for cerebral infarction. Meta-analysis is conducted. The experimental results show that the National Institutes of Health Stroke Scale (NIHSS) score, modified Rankin Scale (mRS) score, incidence of cerebral hemorrhage, and mortality in the group with good collateral circulation are significantly lower than those in the group with bad collateral circulation, and the rate of good prognosis is significantly higher ( Cerebral infarction (CI) is a common clinical disease. It has the characteristics of acute onset, high mortality, and commonly used recombinant tissue plasminogen activator. Intravenous thrombolytic therapy is the preferred early treatment option, which can effectively reduce the disability rate of patients . HoweverCT angiography (CTA) is performed synchronously after cerebral hemorrhage is ruled out by cranial CT, and interventional bridging therapy could be arranged at the same time as thrombolytic therapy . CerebraThe rest of this paper is organized as follows: Cerebral infarction and cerebral ischemia intracranial artery stenosis was the main mechanism of the incident, long-term chronic artery stenosis can cause the remote cerebral blood supply insufficient, resulting in brain tissue in hypoxia and ischemia condition, and the body for compensatory chronic ischemic pathological state will be a large number of production and release and promote angiogenesis factor, and thus through the new blood vessels and narrow distal vascular bridge improves brain tissue ischemia and hypoxia. Although the symptoms of cerebral ischemia cannot be completely improved through this approach, it can play a certain auxiliary role in intravenous thrombolytic therapy and help to improve the overall thrombolytic effect .Zhang et al.  pointed In this study, the cerebral hemorrhage rate and mortality of the group with good collateral circulation were significantly lower than that of the group with poor collateral circulation, suggesting that good collateral circulation can reduce the risk of death after thrombolytic therapy in patients with cerebral infarction and other cerebrovascular diseases, which is basically consistent with the conclusions of previous studies . The disThere are many clinical imaging evaluation techniques for collateral circulation, and there are some differences in the evaluation procedures, but the definition of good collateral circulation in various imaging evaluation techniques is the key factor to improve the outcome of patients receiving thrombolytic therapy. This study selects the CTA technology as cerebral infarction patients with venous thrombolysis treatment cycle of the side after imaging evaluation scheme, the scheme as part of the noninvasive examination, and has low risk, easy operation, and high resolution multiple advantages, in the clinical research to accept degree is higher, and comprehensive information to obtain the patient's blood vessels and provide technical support for comprehensive and accurate assessment of collateral circulation . DiffereThe literature corresponding to the research direction of \u201cCTA technology evaluation of correlation between collateral circulation and prognosis in patients with cerebral infarction embolectomy\u201d is searched in Wanfang Medical Center, CNKI, VIP, and PubMed at home, and abroad. Keywords include spiral CT angiography, prognosis, cerebral hemorrhage, collateral circulation, cerebral infarction, venous thrombus, NIHSS score, mRS score, CTA, prognosis, cerebral hemorrhage, collateral circulation, and cerebral. The publication time of the included literature should meet the requirements of \u22646 years, and the standard conditions of gender, age, nationality, and race are not set for the screening of the research objects, and they are grouped according to the collateral circulation detected by CTA. Follow-up loss of contact ratio &l is 20%, which has been approved by medical research institutions, with high data integrity and no obvious data loss. Comparative analyses of any one or more outcome indicators in NIHSS score, mRS score, fatality rate, good prognosis rate, and cerebral hemorrhage rate are carried out. After literature screening, the unqualified literature, such as repeated contents, incoherent language logic, serious data loss, obvious operation errors, basic research, failure to contain outcome indicators, and inappropriate research direction, is excluded, and meta-analysis is conducted on the basis of the selected literature.Neurological impairment is assessed on NIHSS, a 42-point scale, with higher scores indicating more severe nerve damage. 1 to 4 are classified as mild neurological impairment, 5 to 20 as moderate neurological impairment, and 21 to 42 as severe neurological impairment.The prognosis is assessed by the mRS, and the patient is rated as 0 for complete disappearance of symptoms . The patThe good prognosis rate is 0~2 in mRS score. The incidence rate and fatality rate of cerebral hemorrhage are calculated according to the number of cases.The improved Jadad scale is used to evaluate the literature quality, with a total score of 1-7, 3 or below is considered as low quality, and 4 or above is considered as high quality.P < 0.1 and I2 \u2265 50%, which is statistically significant, the random-effects model is adopted. There is no statistical significance in heterogeneity between studies when P > 0.1 and I2 < 50% are satisfied, and the fixed-effects model is used in the meta-analysis. Clinical and methodological heterogeneity are studied by using descriptive analysis.RevMan5.2 statistical software is used to analyze the study data . The couAccording to the research direction and keywords, 11 articles are searched in Chinese and English database, including 5 English articles and 6 Chinese articles. I2 = 85.0%, P < 0.00001). Random-effects model analysis shows that NIHSS score of the group with good collateral circulation is lower than that of the group with poor collateral circulation, and the difference is statistically significant after all studies are combined . These results suggest that good collateral circulation after thrombectomy can significantly reduce NIHSS score.One English and six Chinese literatures are included. I2 = 97.0%, P < 0.00001). Random-effects model analysis shows that the mRS score of the group with good collateral circulation is lower than that of the group with poor collateral circulation, and the difference is statistically significant after all studies are combined . It is suggested that good collateral circulation can significantly reduce mRS score after thrombectomy for cerebral infarction.One English and two Chinese literature are included. I2 = 1.0%, P = 0.40). Fixed-effects model analysis shows that the cerebral hemorrhage rate of the group with good collateral circulation is lower than that of the group with poor collateral circulation, and the difference is statistically significant after all studies are combined . It is suggested that good collateral circulation after thrombectomy can significantly reduce the incidence score of cerebral hemorrhage.One English and four Chinese literature are included. I2 = 0.0%, P = 0.87). Fixed-effects model analysis shows that the mortality of the group with good collateral circulation is lower than that of the group with poor collateral circulation, and the difference is statistically significant after all studies are combined . It is suggested that good collateral circulation after thrombectomy can significantly reduce the mortality of cerebral infarction.Two Chinese literature are included. I2 = 80.0%, P = 0.0001). Random-effects model analysis shows that the rate of good outcome is higher in the group with good collateral circulation than that in the group with poor collateral circulation, and the difference is statistically significant after all studies are combined . These results suggest that better collateral circulation after thrombectomy can improve the prognosis of cerebral infarction.Five English and one Chinese literatures are included. A meta-analysis is used to investigate the correlation between the status of collateral circulation assessed by head CTA and the outcome of thrombectomy for cerebral infarction. There is a significant correlation between collateral circulation and the prognosis of patients with cerebral infarction treated with intravenous thrombolytic therapy. Good collateral circulation can promote the rapid improvement of neurological function and prognosis of patients with cerebral infarction after thrombolytic therapy and also play a positive role in reducing mortality and cerebral hemorrhage rate.There are still some shortcomings in this study, such as the small number of included literature and the old age of English literature, which may increase the data bias of the overall research results. Therefore, the follow-up research center will further expand the scope of database literature screening for in-depth verification and analysis."}
+{"text": "Understanding how tumor infiltration is regulated is key to improving treatment efficacy. Here, we report that phosphorylation of HRS, a pivotal component of the ESCRT complex involved in exosome biogenesis, restricts tumor infiltration of cytolytic CD8+ T cells. Following ERK-mediated phosphorylation, HRS interacts with and mediates the selective loading of PD-L1 to exosomes, which inhibits the migration of CD8+ T cells into tumors. In tissue samples from patients with melanoma, CD8+ T cells are excluded from the regions where tumor cells contain high levels of phosphorylated HRS. In murine tumor models, overexpression of phosphorylated HRS increases resistance to anti-PD-1 treatment, whereas inhibition of HRS phosphorylation enhances treatment efficacy. Our study reveals a mechanism by which phosphorylation of HRS in tumor cells regulates anti-tumor immunity by inducing PD-L1+ immunosuppressive exosomes, and suggests HRS phosphorylation blockade as a potential strategy to improve the efficacy of cancer immunotherapy.The lack of tumor infiltration by CD8 + T-cell infiltration into solid tumors is associated with poor responsiveness to immune checkpoint therapy (ICT). Here, the authors show that blocking the phosphorylation of HRS to reduce the induction of immunosuppressive exosomes promotes CD8+ T-cell infiltration into tumors and enhances the efficacy of ICT in mouse melanoma models.Lack of CD8 Despite this remarkable progress, the majority of patients do not respond to ICB therapies. Recent studies indicate that patients with high intratumoral, but not peritumoral, CD8+ T cells, have a better response to ICB8. To improve the efficacy of immunotherapy, it is imperative to promote intratumoral migration of cytolytic CD8+ T cells10. However, the molecular mechanisms that regulate tumor infiltration by CD8+ T cells remain unclear.Immune checkpoint blockade (ICB) using anti-programmed death protein 1 (PD-1) antibodies has demonstrated efficacy in the treatment of many types of cancers13. The heterogeneity of cargo expression in exosomes underlies the diverse functions of exosomes13. Elucidating the mechanisms of cargo sorting to exosomes is key to understanding the heterogeneity of exosomes and their functions. The endosomal sorting complexes required for transport (ESCRT) machinery play an important role in exosome biogenesis14. HRS , is a key component of ESCRT as it mediates the initial cargo recognition and sorting into multivesicular endosomes (MVEs), which are then delivered to the plasma membrane for exosome secretion14. Tumor cells secrete exosomes that carry PD-L1, a key immune checkpoint protein22. How PD-L1 loading to exosomes is regulated in tumor cells is unknown.Exosomes are small extracellular vesicles (sEVs) secreted by cells that potently affect cell\u2013cell communication+ T cells into melanoma tumor tissues. Mechanistically, phosphorylated HRS strongly interacts with PD-L1, and selectively promotes PD-L1 loading to the exosomes, thereby blocking CD8+ T-cell infiltration. In various murine models, the expression of constitutively phosphorylated HRS leads to resistance to anti-PD-1 treatment, whereas inhibition of HRS phosphorylation enhances the therapeutic efficacy of PD-1 blockade. Our study reveals a mechanism by which oncogenic signaling regulates anti-tumor immunity through PD-L1 loading to the exosomes, and suggests inhibiting HRS phosphorylation as a potential strategy to enhance ICB-based therapies.Here, we report that, following phosphorylation by an extracellular signal-regulated kinase (ERK), HRS spatially excludes the infiltration of CD824. As HRS plays an important role in exosome biogenesis, we examined the potential phosphorylation of HRS by oncogenic kinases in cancer cells. Using mass-spectrometry, we analyzed HRS purified from the metastatic melanoma cell line, WM9. We identified a phospho-peptide \u201cKS*PTPSAPVPLTEPAAQPGEG\u201d, in which Serine 345 (\u201cS345\u201d) was phosphorylated . This antibody detected phosphorylated HRS in cells treated with EGF, and the detection was abolished after treatment with SCH772984  that contain samples from melanoma patients  in tumors with high levels of p-HRSS345 compared to tumors with low p-HRSS345   Fig.\u00a0. As a coein Fig.\u00a0\u2013f.S345 was heterogeneously expressed . A significantly lower level of CD8+ TILs was observed in regions with tumor cells expressing high p-HRSS345 compared to regions with low p-HRSS345 , phospho-deficient (\u201cHRSS345A\u201d), and phospho-mimetic mutant HRS (\u201cHRSS345D\u201d)  B16F10\u00a0tumors, the expression of HRSS345D failed to suppress CD8+ TILs  had a lower level of PD-L1 compared to TTDEs from tumors expressing HRSWT (TTDEWT) . TTDEs were isolated from different mouse tumor models: human melanoma WM9 cells established in 15. Compared to the wild-type HRS, PD-L1 showed significantly decreased co-localization with HRSS345A and increased co-localization with HRSS345D  lacking UIM retained PD-L1 binding, whereas further deletion of a.a. 276\u2013478 abolished the interaction ion Fig.\u00a0. Given t+ sEVs without the interference of PD-L1+ sEV originating from the allografts, we first generated B16F10 tumor cells with their endogenous PD-L1 knocked out (\u201cPD-L1-KO B16F10\u201d). Infusion of sEVWT or sEVS345D derived from B16F10 cells expressing PD-L1 significantly promoted PD-L1-KO B16F10 tumor growth in C57BL/6 mice. The effect was not observed for tumors grown in Rag2\u2212/\u2212 mice , an antibody-based quantitative proteomics technology, showed that sEVWT and sEVS345D significantly downregulated the expression of a cluster of proteins related to T\u00a0cell proliferation and activation, such as FOXM1, Aurora A, ASNS, Cyclin-B1, while there was no such difference between sEVS345A and PBS , HRS bind to and internalize ubiquitinylated cargo to intraluminal vesicles (ILVs) to form MVEs, which eventually fuse with the plasma membrane to release these ILVs as exosomes14. Ubiquitin-independent cargo binding by HRS was also reported, although the molecular nature of this mode of sorting is unknown33. Our data show that HRS phosphorylation by ERK led to selective enrichment of cargo proteins including PD-L1 to exosomes. The interaction of HRS with PD-L1 is not mediated by its UIM, but through a region containing a.a. 276\u2013478. S345 is located within the binding region. Phosphorylation of S345 increased HRS binding to PD-L1, but did not affect the conventional ubiquitin-dependent cargo binding  or the interaction with the other ESCRT-0 protein, STAM. The ubiquitin-independent binding and its regulation by HRS phosphorylation may offer a mechanism for the selective enrichment of PD-L1 to the exosomes in response to oncogenic signaling.HRS mediates protein sorting to the exosomes. Our biochemistry and flow cytometry analyses indicate that HRS phosphorylation enriches PD-L1 to the exosomes without affecting PD-L1 expression on tumor cell surface. sEVs derived from phospho-mimetic mutant HRS42. However, it is unclear whether the exosomes in the tumors directly bind to the ECM and whether these exosomes have special roles in tumorigenesis. A previous study suggested that ECM-attached exosomes, rather than diffusible exosomes, promote cell movement43. In our EM analysis of sEVs isolated from tumor tissues, we often observed a direct association of exosomes with ECM fibers, even though collagenase IV was used in the sEV isolation procedure. The observed fibers were likely the remnants of ECM digestion. While ECM disruption is necessary for the isolation of sEVs, the association of sEVs with ECM fibers would probably be more prominent if there was a lesser degree of ECM digestion. Using several parallel in vitro and in vivo models, we show that PD-L1-enriched sEVs derived from cells with HRS phosphorylation effectively suppressed the proliferation and function of CD8+ T cells. We further demonstrate that PD-L1-enriched sEVs inhibited the transmigration of CD8+ T cells cross the ECM. Based on the above findings, we propose that PD-L1 enriched EVs derived from tumor cells expressing high levels of p-HRS may be distributed in the local tumor microenvironment, likely scaffolded on the ECM, to block the infiltration of CD8+ T cells -1 antibodies has demonstrated improved efficacy in treating patients with metastatic melanoma, and MAPK pathway inhibitors  were shown to help reverse CD8+ T-cell exclusion when combined with anti-PD-1 treatment49. Here, animal experiments were performed to investigate whether HRS phosphorylation by ERK affects anti-PD-1 antibody treatment. We found that the ERK inhibitor reduced the level of exosomal PD-L1 by inhibiting HRS phosphorylation, and sensitized B16F10 tumors to anti-PD-1 antibodies. Importantly, the expression of HRSS345D, which represents the constitutively phosphorylated HRS, blocked CD8+ T\u00a0cell infiltration and abolished the response to PD-1 blockade, strongly suggesting a crucial role of HRS phosphorylation in conferring resistance to anti-PD-1 treatment. Developing small molecules targeting phosphorylated\u00a0HRS may potentially achieve improved efficacy of PD-1 blockade while minimizing the toxicity often observed in the combination therapy.In melanoma patients, the combination of 52. Our finding of the selective enrichment of PD-L1 by HRS phosphorylation may provide a mechanism underlying the different levels of PD-L1 in circulating exosomes observed in patients. Future studies will be needed to investigate whether pHRSS345 IHC, combined with an assay of exosomal PD-L1 and genome mutational profiling, will provide important diagnostic information that helps select patients likely to benefit from ICB, a key opportunity given the toxicity of these therapies.Recently, several studies have examined the levels of exosomal PD-L1 in the blood of cancer patients, and suggest the potential use of exosomal PD-L1 as an indicator or predictor of patient response to ICB-based therapies2 incubator (Thermo) at 37\u2009\u00b0C. HRS wild-type, S345A, and S345 mutants were constructed in pCMV 3\u2009\u00d7\u2009Flag and pBabe vectors. To establish cell lines stable expressing HRS variants, 3\u2009\u00d7\u2009Flag-tagged HRS WT/S345A/S345D in pBabe vector were transfected into melanoma cell lines  and selected by puromycin.Human melanoma cell lines WM9, WM164, and A375 were cultured in RPMI 1640 medium (Invitrogen) supplemented with 10% (v/v) fetal bovine serum . B16F10, YUMM1.7 and YUMMER1.7 cells were cultured in DMEM (Sigma) supplemented with 10% (v/v) FBS. All cultures were maintained in a humidified 5% COE. coli in the kinase buffer  in the presence of ATP for 5\u2009min at 30\u2009\u00b0C.Flag-tagged HRS was expressed and purified from HEK293T with anti-Flag M2 resin (Sigma). HRS-Flag proteins were incubated with His\u00d76-ERK2-CA (constitutively active) or His\u00d76-ERK2-KD (kinase dead) purified from 2, 1% NP-40, 1\u2009mM NaF, and 1\u2009mM NaVO4) containing protease inhibitors cocktail (Roche) and phosphatase inhibitors (Bimake). Lysates were then cleared by centrifugation at 12,000\u2009\u00d7\u2009g for 30\u2009min. Equal amounts of proteins were incubated with antibodies for 2\u2009hr at 4\u2009\u00b0C. Immunoprecipitated proteins were collected and washed four times with extraction buffer. Proteins were subjected to SDS-PAGE and western blot analysis.Indicated cells were lysed in the NP-40 extraction buffer  buffer in the presence of protease inhibitor cocktail (Roche) and phosphatase inhibitor cocktail (Bimake). Cell lysates were then subjected to 12\u201315% SDS-PAGE and transferred to polyvinylidene fluoride or nitrocellulose membranes (Bio-Rad Laboratories). The membranes were blocked with 5% bovine serum albumin and probed with indicated antibodies overnight at 4\u2009\u00b0C, followed by incubation for 1\u2009hr at room temperature with secondary antibodies  conjugated with peroxidase. CD63, CD81, CD9 were used as exosome markers. GAPDH was used as a loading control. Information about the primary antibodies was included in Supplementary Table\u00a053.Samples were resuspended in SDS-PAGE sample buffer and run for a short distance (0.5\u2009cm) onto pre-cast NUPAGE (Thermo Fisher Scientific) 1-D SDS gels. Gels were stained with Colloidal Blue (Thermo Fisher Scientific) and the entire 0.5\u2009cm stained gel region was excised and digested overnight using 4\u2009ng/ml modified trypsin (Promega), as previously described4HCO3 (pH 8). The LC-MS/MS analysis was performed on an Easy-nLC 1000 II HPLC (Thermo Fisher Scientific) coupled to a Q Exactive HF mass spectrometer (Thermo Fisher Scientific). Peptides were loaded on a pre-column  and further separated on an analytical column  using a linear gradient from 100% Solvent A (0.1% formic acid in H2O) to 30% Solvent B (0.1% formic acid in acetonitrile), 70% Solvent A in 80\u2009min at a flow rate of 200\u2009nL/min. The top 20 most intense precursor ions from each full scan  were isolated for HCD MS2  with a dynamic exclusion time of 60\u2009s. Precursors with a charge state of +1, +7 or above, or unassigned, were excluded.For identification of phosphorylation by mass spectrometry, proteins isolated by gel electrophoresis were digested with trypsin (Promega) in 100\u2009mM NH18 resin; Waters), and peptides were separated by reverse phase-high pressure liquid chromatography (RP-HPLC) on a BEH C18 nanocapillary analytical column  at a flow rate of 200\u2009nl/min. Solvent A was Milli-Q (Millipore) water containing 0.1% formic acid, and Solvent B was acetonitrile containing 0.1% formic acid. Peptides were eluted at 200\u2009nl/min using an acetonitrile gradient consisting of 5\u201330% B over 225\u2009min, 30\u201380% B over 5\u2009min, 80% B for 10\u2009min before returning to 5% B over 0.5\u2009min. The column was re-equilibrated using 5% B at 300\u2009nl/min for 5\u2009min before injecting the next sample. To minimize carryover, a blank was run between each experimental sample by injecting water and using a 30\u2009min gradient with the same solvents. The full MS scan was acquired in profile mode at 60,000 resolutions with a 400\u20132000\u2009m/z scan range. Data-dependent MS/MS was performed on the top 20 most abundant precursor ions in every full MS scan. Unassigned, +1, and +8 or above charge ions were rejected, and peptide match was set to preferred. Precursor ions subjected to MS/MS were excluded from repeated analysis for 45\u2009s.For sEV protein identification, tryptic digests were analyzed in duplicate on a Q Exactive HF mass spectrometer (Thermo Fisher Scientific) equipped with a Nano-Acquity UPLC System (Waters) with the column heater maintained at 40\u2009\u00b0C. Duplicate injections of each tryptic digest  were made using a UPLC Symmetry trap column (180\u2009\u00b5m i.d.\u2009\u00d7\u20092\u2009cm packed with 5\u2009\u00b5m Chttps://qupath.github.io/) to quantify antigens with optical density of chromogen and generate heatmap in samples .Human melanoma tissues were obtained with informed consent according to procedures approved by the Internal Review Boards (IRB) of the Hospital of the University of Pennsylvania, Massachusetts General Hospital Cancer Center of Harvard Medical School, and the Wistar Institute. All recruited volunteers provided written informed consent. Tissue microarray was built from representative FFPE tissue blocks. Tumor areas were selected by pathologists based on hematoxylin and eosin-stained slides. Duplicate cores were punched from each case (1.0-1.5\u2009mm in diameter). Tissue sections were subjected to antigen retrieval with Tris-EDTA buffers (Agilent-DAKO) kit at 95\u2009\u00b0C for 15\u2009min using TintoRetriever (BioSB). Subsequently, slides were incubated with antibodies and visualized with StayBlue (Abcam) or AEC (Vector Laboratories) chromogens. Aperio CS2 Scanner (Leica) was used for scanning at\u2009\u00d7\u200940 to digitize the slides. Analysis of IHC slides and TMA was performed using QuPath  mice were purchased from Jackson Laboratories. Mice were housed in the University of Pennsylvania Animal Care Facilities under specific pathogen-free (SPF) conditions at 23\u2009\u00b1\u20092\u2009\u00b0C ambient temperature with 40% humidity and a 12\u2009hr light/dark cycle (7\u2009am on and 7\u2009pm off). Experimental and control mice were bred separately. Both males and females between the ages of 6 and 8 weeks were used in the study. Mice were euthanized via cervical dislocation. All animal procedures were pre-approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Pennsylvania, and all experiments conform to the relevant regulatory standards.C57BL/6 wild-type mice expressing CD45.1 (Strain number: 002014) or CD45.2 (Strain number: 000664) and Rag2\u2212/\u2212 mice, WM9 cells (5\u2009\u00d7\u2009106 cells), YUMMER1.7 (2\u2009\u00d7\u2009106 cells) and B16F10 (0.5\u2009\u00d7\u2009106 cells) were injected subcutaneously into each mouse. Tumors were measured every other day using a digital caliper and the tumor volume was calculated by the formula ((width)2\u2009\u00d7\u2009length\u2009\u00d7\u20090.5). Mice were euthanized and tumors harvested 18-30 days after cell inoculation, or the longest dimension of the tumors reached 2.0\u2009cm, as required by IACUC. For the anti-PD-1 antibody treatment, each mouse received intraperitoneal injections of 80\u2009\u03bcg anti-mouse PD-1 (BioXcell) or Armenian hamster IgG control (BioXcell), once every 3 days, as previously described25, starting from the third day after cell inoculation. For the BVD-523 (MedChemExpress) treatment animals were randomized into indicated groups to receive a 0.2\u2009ml suspension containing either vehicle, BVD-523  by oral gavage. For the sEV treatment, a total of 20\u2009\u03bcg of B16F10 cell lines derived sEVs with or without IgG isotype or PD-L1 blocking (10\u2009\u03bcg/ml) were i.v. injected into mice after inoculation of PD-L1 knock out B16F10 cells, once every 3 days, starting from the third day after cell inoculation.For establishing melanoma xenograft model in C57BL/6 wild-type or + T-cell Isolation Kit (STEMCELL) and stimulated with anti-CD3 (Biolegend) and anti-CD28 (Biolegend) for 24\u2009hr. After incubated w/o sEVs for 24\u2009hr respectively, purified CD8+ cells were mixed at 1:1 ratio and i.v. injected to Rag2\u2212/\u2212 recipient mice bearing PD-L1-KO B16F10 tumor (1\u2009\u00d7\u2009106 cells per mouse) at day 14 post-tumor inoculation. Tumors were harvested on day 21 for CD8+ cells assessment. For sEV co-xenograft experiments, Bulk CD8+ cells were purified from CD45.2 mice by negative selection and injected into the Rag2\u2212/\u2212 recipient. sEVs (200\u2009\u03bcg per mouse) and Matrigel (Corning) were pre-incubated for 24\u2009hr at 1:2 ratio (v/v). PD-L1-KO B16F10 cells (1\u2009\u00d7\u2009106 cells per mouse) were mixed with sEVs and Matrigel premix at 1:3 ratio inoculation (200\u2009\u03bcL per mouse) within around 48\u2009hr post CD8+ transfer. The tumors were harvested on day 12 post inoculation for CD8+ cells assessment.The splenocytes and lymphocytes from CD45.1 and CD45.2 mice were subjected to negative selection using EasyJet Mouse CD8Excised tumors were minced into small pieces and digested in DMEM (Gibco) supplemented with 0.5\u2009mg/ml collagenase type IV (Gibco) and 0.1\u2009mg/ml DNase I (Sigma) for 30\u2009min at 37\u2009\u00b0C. Digested cell suspension was then processed through a 70\u2009\u03bcm cell-strainer and rinsed with DMEM. After red blood cell lysis, Tumor-Infiltrating Leukocytes (TILs) were isolated by Percoll Gradient Centrifugation. Cells were then permeabilized in 0.1% Triton X-100, stained with antibodies in flow cytometry staining buffer, and fixed in 1% paraformaldehyde. Stained cells were then analyzed on an LSR II flow cytometer (BD Biosciences). Data were analyzed with the FlowJo software .15. Briefly, the conditioned media were centrifuged at 3000\u2009\u00d7\u2009g for 30\u2009mins  to remove apoptotic bodies and debris, followed by 16,500\u2009\u00d7\u2009g centrifugation for 40\u2009mins to remove microvesicles. The supernatant was further centrifuged at 120,000\u2009\u00d7\u2009g for 2\u2009hr to collect the sEVs. The sEVs were characterized by western blotting following the MISEV 2018 guidelines54.To collect sEVs from cultured melanoma cells, conditioned media were harvested and sEVs were isolated by differential centrifugation as previously described55. Briefly, tumor tissues were excised and incubated with 0.5\u2009mg/ml collagenase type IV (Gibco) and 0.1\u2009mg/ml DNase I (Sigma) for 30\u2009min at 37\u2009\u00b0C under mild agitation (30\u2009rpm). Suspensions were filtrated with 70\u2009\u03bcm cell strainer placed onto a 50\u2009mL tube and rinsed by pre-warmed PBS to favor sEV release and collection from the tissues. The remaining liquid is differentially centrifuged at 300\u2009\u00d7\u2009g for 10\u2009min and 2000\u2009\u00d7\u2009g for 20\u2009min to remove cells and tissue debris . The supernatant is then further centrifuged at 16,500\u2009\u00d7\u2009g for 50\u2009min  to remove large EVs and at 120,000\u2009\u00d7\u2009g for 2.5\u2009hr to collect the crude fraction of small EVs .Tumor-derived sEVs were obtained as describedThe size and concentration of purified sEVs were determined using NanoSight NS300 , which is equipped with fast video capture and particle-tracking software. For verification of tumor-derived sEVs using electron microscopy, purified sEVs suspended in PBS were dropped on formvar-carbon coated nickel grids. After staining with 2% uranyl acetate, grids were air-dried and visualized using a JEM-1011 transmission electron microscope.Cells were rinsed twice with PBS and were fixed for 20\u2009min with 4% paraformaldehyde in PBS at room temperature. Then cells were rinsed twice with PBS and permeabilized with 0.1% Triton X-100 in PBS for 10\u2009min. After rinsing twice with PBS, the cells were incubated with 1% BSA for 30\u2009min at room temperature. Next, cells were incubated with the primary antibodies for 2\u2009hr at room temperature or overnight at 4\u2009\u00b0C. After rinsing three times with PBST (0.01% Triton-x), cells were incubated with secondary antibodies anti-rabbit IgG Alexa Fluor 568 and anti-mouse IgG Alexa Fluor 488 (Invitrogen). After rinsing three times with PBS, cells were stained with DAPI and mounted with ProLong Gold Antifade Mountant (Thermo Fisher). The cells were imaged using confocal microscopes and analyzed with NIS-Elements (Nikon).Blood samples from human healthy donors were collected by the Human Immunology Core at the University of Pennsylvania with the approval from the University of Pennsylvania Institutional Animal Care and Use Committee (IACUC). Written consent was obtained from each healthy donor before blood collection. All experiments involving blood samples from healthy donors were performed in accordance with relevant ethical regulations.+ T cells (1\u2009\u00d7\u2009105 per well-96 well plate) obtained from Human Immunology Core of University of Pennsylvania or murine CD8+ T cells (1\u2009\u00d7\u2009105 per well-96 well plate) purified from splenocytes and lymphocytes using EasyJet Mouse CD8+ T-cell Isolation Kit (STEMCELL) were stimulated with anti-CD3  and anti-CD28  antibodies for 24\u2009hr and then incubated with indicated WM9 cell/xenograft-derived sEVs or B16F10 cell/xenograft-derived sEVs (20\u2009\u03bcg/ml) with or without PD-L1 blocking for 48\u2009hr in the presence of anti-CD3 and CD28 antibodies. The treated CD8+ cells were then collected, stained, and analyzed by flow cytometry. For BVD-treatment in vitro, indicated WM9 or B16F10 cell lines were pretreated with BVD-523 at 2\u2009\u03bcM concentration for 24\u2009hr before sEV collection.To block PD-L1 on sEV surface, the purified sEVs (200\u2009\u03bcg) were incubated with PD-L1 blocking antibodies (10\u2009\u03bcg/ml) or IgG isotype antibodies (10\u2009\u03bcg/ml) in 100\u2009\u03bcl PBS, and then rinsed with 30\u2009ml PBS and pelleted by ultracentrifugation twice to remove the non-bound free antibodies. Human peripheral CD8+ T cells were stimulated with anti-CD3 and anti-CD8 for 24\u2009hr and treated with vehicle or sEVs derived fromWM9 cell lines. After 48\u2009hr incubation, CD8+ T cells were rinsed by RPMI 1640 and harvested with lysis buffer including protease and phosphatase inhibitor cocktail. The RPPA assay was performed by the MD Anderson Cancer Center core facility using 50\u2009\u03bcg protein per sample. Antibodies were validated by Western blotting56. Methods for data analysis are included in statistical analyses.Human CD8PD-L1 knock-out (KO) B16F10 cells were irradiated with 25\u2009Gy X-rays. Splenocytes were then cultured with (primed) or without (unprimed) irradiated PD-L1-KO B16F10 cells in the presence of IL-2 (5\u2009IU/mL) and cocultured for 48\u2009hr. Splenocytes cultured with concanavalin A (10\u2009\u03bcg/mL) were used as a nonspecific T\u00a0cell priming control. Priming was confirmed by IFN-\u03b3 ELISA of the supernatant. Primed splenocytes were then cocultured with sEVs (50\u2009\u03bcg/ml) and freshly cultured PD-L1-KO B16F10 cells with target (PD-L1-KO B16F10) to effector (splenocytes) ratio (1:100) for 48\u2009hr. The cell death associated LDH release and then percentage cytotoxicity was measured according to the manufacturer\u2019s protocol (Millipore Sigma). For splenocyte isolation, mouse spleens were crushed on the strainer and rinsed by 10% FBS DMEM to collect the cells. Then, 1\u2009\u00d7\u2009RBC lysis buffer was used and neutralized by 10% FBS DMEM before splenocyte collection.+ T cells stimulated with anti-CD3 and anti-CD28 for 24\u2009hr and rested for 2 days in a complete RPMI culture medium containing 10% FBS, 1% Glutamine, 1\u00d7 Pen/Strep, and 10\u2009ng/ml IL-2 (Invitrogen). Human CD8+ T cells were stimulated with anti-CD3 and anti-CD28 for 24\u2009hr. The chemotaxis assay was performed using 96-well ChemoTx chemotaxis system with 3\u2009\u03bcm pore size (Neuro Probe) according to manufacturer\u2019s protocol. Briefly, the bottom wells were filled with 30\u2009\u03bcl of migration buffer with or without 100\u2009ng/ml murine or human CXCL9 or CXCL10 (PEPROTECH). To coat the 3\u2009\u03bcm pore, fibronectin  and sEVs (30\u2009ug/ml) were mixed at 1:1 ratio and dropped onto the filter top for 24\u2009hr at 4\u2009\u00b0C. CD8+ T cells were applied to the top of filters rinsed with PBS. After 3-6\u2009hr incubation at 37\u2009\u00b0C, migrated cells collected from the bottom wells were quantified using a cell counter.Murine CD857 was used to identify phosphorylated peptides by setting a variable modification of 79.966331\u2009Da at S, T, and Y, and a neutral loss of 97.976896\u2009Da at S and T. The mass accuracy of precursor ions and that of fragment ions were both set at 20\u2009ppm. The results were filtered by applying a 1% FDR cutoff at the peptide level and a minimum of one spectrum per peptide. The MS2 spectra were annotated using pLabel58.For identification of phosphorylation MS analyses, the software pFind359. The \u201cmatch between runs\u201d option to match identifications across samples based on accurate m/z and retention times was enabled with 0.7\u2009min match time window and 20\u2009min alignment time window60, and peak lists were searched against the human Uniprot database  with a full tryptic constraint using the Andromeda search engine61. Precursor mass tolerance was set to 4.5 ppm in the main search, and fragment mass tolerance was set to 20\u2009ppm. A maximum of two-missed cleavages was allowed, and minimal peptide length was set to seven amino acids. Carbamidomethyl cysteine was set as a fixed modification and methionine oxidation and N-terminus acetylation were set as variable modifications. A database of common expected contaminants including keratins and trypsin, as well as a decoy database produced by reversing the sequence of each protein, were combined with the forward database. Criteria for high confidence peptide/protein identifications included a false discovery rate (FDR) set to 1% for proteins and peptides. The relative abundance of each protein across all samples in an experiment was determined using the label-free quantitation (LFQ) option of MaxQuant62. Proteins that shared all identified peptides were combined into a single protein group by the MaxQuant software. In cases where all identified peptides from a protein were a subset of identified peptides from another protein, these proteins were also combined into that group. Peptides that matched multiple protein groups  were assigned to the protein group with the most unique peptides. Quantification was performed using razor plus unique peptides, including those modified by acetylation  and oxidation (Met). A minimum peptide ratio of 1 was required for protein intensity normalization, and \u201cFast LFQ\u201d was enabled62. Protein identifications were filtered using Perseus software 63 to remove decoy database reverse identifications, contaminants, and proteins identified only by site modified peptides or proteins identified by a single uniquely-mapping peptide. In addition, prior to statistical analysis, protein group LFQ intensities were log2 transformed to reduce the impact of outliers. To reduce quantitative uncertainty, protein groups having less than four valid values (those with MS1 quantification results) present in at least one categorical group, i.e., HRSWT, HRSS345A, or HRSS345D were removed. Missing data points were imputed by creating a downshifted Gaussian distribution of random numbers to simulate the distribution of low signal values . Perseus was also used for the following analyses: hierarchical clustering (Euclidian distances and k-means clustering) after protein intensity values from all replicates were averaged for each protein within cell type and z score normalized; Principal Component Analysis (PCA) after duplicate LC-MS/MS analyses of the same sample  were averaged; and data visualization using volcano plots. For heat maps, technical replicates were averaged as described above and z score normalized. Ingenuity Pathway Analysis 64 was used to determine sub-cellular localization. Uniprot protein identifiers for all proteins identified by LC-MS/MS were uploaded into the application and each identifier was mapped to its corresponding object in Ingenuity\u2019s Knowledge Base.For sEV LC-MS/MS analyses, raw mass spectrometric data were processed using MaxQuant (Ver. 1.6.7.0)https://r-forge.r-project.org/R/?group_id=1899). These values are defined as Supercurve Log2 value. All the data points were normalized for protein loading and transformed to linear value, designated as \u201cNormalized Linear\u201d. \u201cNormalized Linear\u201d value was transformed to Log2 value, and then median-centered for further analysis. Median-Centered values were centered by subtracting the median of all samples in each protein. All the above-mentioned procedures were performed by the RPPA core facility. The normalized data provided by the RPPA core facility were analyzed by Cluster 3.0 (http://bonsai.ims.u-tokyo.ac.jp/~mdehoon/software/cluster/) and visualized using the Java TreeView 1.0.5 (http://jtreeview.sourceforge.net/).For RPPA data, analysis was performed according to the protocol from the M.D. Anderson Cancer Center. Specifically, relative protein levels for each sample were determined by interpolation of each dilution curves from the \u201cstandard curve\u201d (supercurve) of the slide (antibody). Supercurve is constructed by a script in R written by the RPPA core facility. The package binaries of SuperCurve and SuperCurveGUI are available in R-Forge  or Microsoft Excel . For proteomics analysis, significantly changed proteins for pairwise HRS comparisons were defined as having \u22652-fold change, a permutation-based FDR\u2009\u2264\u20090.05, and SFurther information on research design is available in the\u00a0Supplementary InformationPeer Review FileReporting Summary"}
+{"text": "The optimized formulation (AEE8) was subjected to preliminary evaluations along with particle size, drug release, and scanning electron microscopy (SEM) studies. The potential of the optimized emulgel against A431 cell lines was also investigated using MTT assay followed by flow cytometric analysis. The SEM results reveal that the optimized emulgel had a well-defined spherical shape, with a droplet size of 226 \u00b1 1.8 nm, a negative surface charge of \u221230.1 \u00b1 1.6 mV, and a PDI of 0.157. The cellular data indicate that AEE8 reduced the viability of the A431 cells with an IC50 of 16.56 \u03bcg/mL, as determined by MTT assay when compared to cells treated with the extract alone. Furthermore, the flow cytometric analysis of the optimized emulgel formulation demonstrated a marked G2/M phase arrest. This finding further supports the effectiveness of the gel in disrupting the cell cycle at the critical G2 and M phases, which are pivotal for cell division and proliferation. This disruption in cell cycle progression can impede the growth and spread of cancer cells, making the gel a promising candidate for anti-skin-cancer therapy. The safety of emulgels (AEE8) was validated through rigorous biocompatibility testing conducted on HDF  cell lines, ensuring their suitability for use. Considering the potential of the nanoemulgel, particularly AEE8, as demonstrated by its favorable properties and its ability to disrupt the cell cycle, it holds great promise as an innovative approach to treating skin cancer.An epidermoid carcinoma is a form of non-melanoma skin cancer that originates from the outer layer of the skin\u2019s squamous cells. Previous studies have shown that andrographis extract and andrographolide inhibit the growth and proliferation of epidermoid carcinoma cells while also inducing cell cycle arrest and apoptosis. The objective of this study was to improve the anticancer efficacy of the andrographolide-rich extract by delivering it in the form of nanoemulgel. During the formulation of emulgels, sonication, and homogenization were employed, and a 2 Skin cancer arises because of the abnormal growth of skin cells caused by genetic mutations or exposure to UV radiation. It is the 17th most common cancer worldwide. Based on its impairments, skin cancer has been broadly classified into melanoma and non-melanoma, which is commonly seen in people of Caucasian descent. Epidermoid carcinoma is a type of non-melanoma skin cancer that arises from the squamous cells that make up the outer layer of the skin [Herbs and supplements are widely used by cancer patients and survivors to reduce their symptoms and enhance their quality of life . The mosAndrographis paniculata (AP), have gained popularity because of their medicinal properties and low incidence of side effects, unlike various drugs. AP has been used in traditional Unani and Ayurvedic formulations to treat conditions such as snake bites, insect bites, diabetes, diarrhea, fever, and malaria [Herbal formulations, such as  malaria . Researc malaria , antidia malaria , antihyp malaria , antihep malaria , anti-in malaria , anti-HI malaria , and ant malaria , Metabol malaria . The pla malaria , specifiandrographis extract and andrographolide on A431 cells have found inhibition of the growth and proliferation of epidermoid carcinoma cells and induction of cell cycle arrest and apoptosis [Various studies of poptosis . Howeverpoptosis  for the poptosis , which cpoptosis . Emulgelpoptosis .Sesame oil has been shown to have chemopreventive effects on skin cancer by counteracting the growth of cancerous cells. Sesamol, a compound found in sesame oil, has been identified as an active component in these chemopreventive properties . AdditioQbD, or quality by design, is an experimental approach that evaluates how different variables affect product quality. The QbD methodology allows for the assessment of both the main effects and interactions among variables in a cost-effective and time-efficient manner. Different techniques can be used to implement the QbD approach, and statistical software can be used to analyze the data obtained .The emulgel formulation was optimized using the quality by design (QbD) approach with a factorial design, which allowed for the evaluation of multiple factors on the response variable, such as drug release. Critical process parameters (CPPs) and critical quality attributes (CQAs) that have significant impacts on product quality were identified, and their effects on the formulation were systematically evaluated through experiments . This apThe current study involved a novel emulgel formulation containing a blend of sesame oil and andrographolide-rich extract along with carbapol 934 as a gelling agent. The emulgels optimized by QbD were then evaluated for their anticancer potential against A431 cell lines using the MTT assay, followed by a cell cycle analysis study on A431 cell lines using flow cytometry. This step helped determine the effectiveness of the formulation in inhibiting the growth and proliferation of epidermoid carcinoma cells. The optimized emulgels were evaluated using in vitro biocompatibility studies with HDF cells to determine the safety profile against normal skin cells.The retention times for the standard andrographolide and the andrographolide-rich extract were, respectively, 12,319 min and 12,310 min for the total run time of 45 min. Comparing the HPLC profiles of the standard andrographolide and the extract  in melanoma tumor tissue, one potential approach for skin cancer treatment could involve blocking or inhibiting the activity of this enzyme. By blocking UrdPh, it may be possible to disrupt the metabolic processes or signaling pathways that contribute to the growth and progression of melanoma cells, potentially leading to therapeutic benefits in the treatment of skin cancer . TherefoIn this study, FTIR observations were conducted to investigate the interactions between the active drug and the excipients used in the formulation. The spectra were obtained for the extract, the main excipients (sesame oil and Carbopol), their physical mixture with the drug, and the test formulations The formulated emulgels were observed as a greenish viscous substance with a homogenous texture and a glossy appearance. An increase in the polymer concentration, specifically Carbopol 934, in the formulations resulted in a significant increase in the viscosity, as demonstrated in The linear equation generated by Design Expert is as follows: viscosity = +0.04020 + 0.0080A + 0.0180B. This equation suggests that an increase in the amount of extract and Carbopol in the emulgel formulations leads to an increase in viscosity, The results of the spreading coefficients demonstrate that all emulgels had a high degree of Spreadability, as shown in It was found that all emulgel formulations exhibited good extrudability. The linear equation obtained from Design Expert further supports this finding, as shown in 2 factorial design to develop an optimized emulgel formulation with andrographolide-rich extract. The final composition consisted of 0.08 g extract, 0.5 g carbopol-934, and other excipients. The formulated emulgel underwent various evaluations, including droplet size, polydispersity index (PDI)  followed zero-order and Hixson\u2212Crowell kinetics, which explains the sustained release observed with the emulgels.The software Design Expert was used based on a QbD approach 2Although all formulated emulgels exhibited good stability, the optimized formulation (AEE8), selected based on preliminary evaluation using the quality by design (QbD) approach, is now eligible for screening for its potential as an anticancer agent. This screening process aims to evaluate its efficacy in inhibiting cell proliferation, inducing apoptosis, or affecting cancer-related pathways. The selection of the optimized formulation for screening signifies its promising characteristics and marks an important step towards assessing its potential as a therapeutic option for cancer treatment.50 value for AEE8 was 16.56 \u00b5g/mL, which was significantly lower than the IC50 value of the extract 26.87 \u00b5g/mL. Pure andrographolide with an IC50 value of 8.07 \u00b5g/mL was used as a standard drug, and the results are presented in The cytotoxic activity of the optimized formulation, AEE8, was evaluated against A431 cells using the MTT assay. The IC50 concentration was selected for further evaluation against A431 cell lines. To investigate the effects on the cell cycle a cell cycle study was conducted using flow cytometry. The results obtained from the flow cytometry analysis are presented below A cell cycle assay was performed to conduct a cell cycle analysis using propidium iodide (PI). Based on the significant cell inhibition observed with the andrographolide, extract, and AEE8 emulgel after a 24 h treatment period, the IC50 concentrations, respectively. In the G0/G1 phase (growth Phase), 57.74%, 40.42%, 46.81%, and 42.9% of cells were arrested in the untreated, andrographolide, extract, and AEE8 with IC50 concentrations, respectively. In the S phase (synthetic phase), 5.82%, 3.79%, 4.2%, and 4.57% of cells were arrested in untreated, andrographolide, extract, and AEE8 with IC50 concentrations, respectively. On the other hand, in the G2/M phase, 34.09%, 41.41%, 38.02%, and 43.21% cells were arrested in the untreated, andrographolide, extract, and AEE8 with IC50 concentrations, respectively depicted in In the sub G0/G1 phase (apoptotic phase), 2.35%, 14.38%, 10.97%, and 9.32% cells were arrested in the untreated, andrographolide, extract, and gel with ICThe results of cytotoxicity study performed by MTT assay suggest that given andrographolide, emulgel (AEE8) was nontoxic in nature on dermal fibroblasts (HDFs) with 90.54% and 92.37% cell viability values after the 24 h of incubation, as shown in p values were < 0.05.MS Excel and SPSS software were used in the current research work for statistical data analysis, where the Andrographis paniculata contains terpenoids, primarily andrographolide, which has been shown to exhibit anticancer activity in the current investigation. The optimized emulgel formulation, AEE8, containing 0.08 percent extract and 0.5 percent Carbopol-934, has demonstrated acceptable effects against A-431 cancer cells. The formulated nanoemulgel AEE8 has demonstrated greater cytotoxic properties against A431 cell lines compared to the Extract. Additionally, it has shown a significant ability to induce cell cycle arrest, similar to andrographolide. The evaluation of safety and biocompatibility is crucial when considering the potential clinical applications of any new material or formulation. The results obtained from the study indicate that the prepared nanoemulgels, specifically AEE8, demonstrate a high level of safety and biocompatibility. Therefore, the emulgel formulation concept proves to be a valuable approach for enhancing the effectiveness of andrographis extract in topical applications. AEE8 has the potential to be developed as a therapeutic agent for the treatment of skin cancer. The successful development of a topical treatment option for non-melanoma skin cancer utilizing andrographis extract represents a promising advancement in the field of phytotherapy.Currently, there is no phytotherapy available for the topical treatment of non-melanoma skin cancer. To address this gap, an attempt was made to topically administer andrographis extract using a nanoemulgel formulation, representing a novel method for delivering phytoactive therapy to patients with dermal cancer that may provide substantial benefits. The ethanolic fraction of Andrographis paniculata were gathered from the gardens of Tirupathi, authenticated with FRLHT , voucher no. 123919. Human skin adenocarcinoma cell lines (A431) and HDF   were procured from the National Centre for Cell Lines . Carbopol-934 and glycerin were acquired from Loba Chemicals , and propylene glycol, propylparaben, and methylparaben were obtained from Vasa Chemicals . Triethanolamine was received from Merck Chemicals , and EDTA and DMSO were acquired from Merck .The leaves of The fresh leaves were collected and dried at 40 \u00b0C followed by pulverization. The resulting powder was subjected to the defatting process using petroleum ether. Following the defatting process, the plant material was subjected to Soxhlet extraction for 24 h using ethanol as the solvent. The obtained extract was placed for the Rota evaporation process, followed by labeling, and stored in the refrigerator followed by the phytochemical screening .The samples were analyzed with an auto-sampler HPLC  LichroCART, Lichrospher, and C18-C18-5\u00b5 column. The mobile phase used was buffer:0.01 N potassium dihydrogen phosphate in water +0.5 mL orthophosphoric acid and acetonitrile, with an injection volume of 1.5 mL/min, with UV detection at 223 nm. The filtration of the samples was conducted using a 0.45 \u03bcm syringe filter, where standard 0.5 mg/mL andrographolide in methanol and 5 mg/mL sample extract in methanol were injected.The process of molecular docking for the bioactive compound was performed using the Schrodinger docking software with automated capabilities. The ligand was imported from the PubChem portal, and the ligprep file was generated using the Maestro tool version 4.2 ; PDB ID: 1SJ9 was retrieved from the rcsb.org portal, and the missing loops and missing amino acid residue were add and minimized. Further glide grids were generated, and finally the ligand was docked .\u22121. The samples analyzed comprised the andrographis extract, drug excipients, such as sesame oil and Carbopol, their physical mixture, and the emulgel formulation [To investigate the chemical interactions between the andrographis extract and the excipients in the emulgel formulations, Fourier-transform infrared spectroscopy (FTIR) was conducted. The analysis was carried out using an FTIR spectrophotometer (Bruker-(Alpha), Ettlingen, Germany) via the KBr pellet technique in an inert atmospheric condition covering a wave range of 4000\u2013400 cmmulation . The modified method of the process was employed for the formulation of emulgels . The sel2 factorial approach was selected to optimize the formulation factors with the evaluation parameters statistically. A 2-level factorial design with 3 center points was constructed to explore the response surfaces using Design Expert software (Version 13). Extract, A 0.04  and 0.12 , Carbopol, B 0.5 , and 2.5  were taken. Factors and responses were provided in The 2The emulgel formulation underwent periodic evaluation to determine quality control parameters, such as color, odor, texture, consistency, stickiness, and phase separation.Measuring the pH of the emulgel formulation is a crucial step in determining its quality and efficacy. The pH measurement provides important information regarding the acidity, neutrality, or alkalinity of the formulation, which can impact its effectiveness and stability. To determine the pH of the emulgel formulations, a digital pH meter  was utilized after calibration at room temperature. A 1% solution of the emulgel formulation was placed into a glass beaker, and the pH was measured by inserting the electrode of the pH meter into the solution. To ensure accuracy, triplicate readings were taken, and the mean and standard deviations were calculated . Measuring viscosity is a critical step in assessing the emulgel formulations, as it can affect their application and efficacy. The Brookfield digital viscometer is widely used for viscosity measurements because of its accuracy and reliability. The use of Spindle 6 and a rotation speed of ten revolutions per minute is a standard method for determining viscosity. Additionally, using a container with a wide aperture allows for the proper insertion of the viscometer spindle into the emulgel sample, which can improve the accuracy of the measurements . To measure the spreadability of an agent, researchers employed a pulley-equipped wooden block, a pair of mirror-image glass slides, and some standard weights. Five minutes of pressure from a weight of 1000 g were used to evenly distribute the gel throughout the glass slides. The gel formulation was applied to the glass slide at a weight of 1 g, and the slide was then covered with a second glass slide. A lower glass slide was secured to a bracket, while an upper glass slide was suspended freely from a pulley loaded with 20 g weights. The spreadability by timing how long it took the top glass slide to glide downwards under load from a height of 7.50 inches was measured .S = M \u00d7The extrudability of emulgels refers to the ability of the product to be extruded from its packaging. It is determined by measuring the force required to extrude a 0.5 cm ribbon of the emulgel from a detachable lacquered aluminum tube within a ten-second time frame. This test is conducted multiple times to obtain accurate readings, and an average is calculated to determine the emulgel\u2019s extrudability .ExtrudaDiffusion studies of emulgels typically involve investigating the rate and extent of drug release from emulgels, which are topical formulations consisting of both water and oil phases stabilized by an emulsifier. A drug release study was conducted using a Franz diffusion cell. The experimental emulgels were applied onto a dialysis membrane in a predetermined quantity and placed onto the Franz diffusion cell. To simulate medicament release, 25 mL of buffer (pH 7.4) was injected into the bottom compartment of the cell. The set-up was placed on a magnetic stirrer for continuous stirring at 37 \u00b0C. Blank readings were taken for comparison, and at regular intervals of 30 min, 1 mL of release media was withdrawn and replaced simultaneously with fresh medium to maintain sink conditions. The experiment was conducted for 8 h, and the collected samples were adequately diluted to measure the absorbance using UV-spectrophotometric analysis at 223 nm  by a standard plot followed by computation of cumulative percentage drug release values .2 for one day. After the cells were treated with the emulgel formulations, 5 mg/mL MTT solution in PBS was added (20 \u00b5L) to each well and incubated for 4 h at 37 \u00b0C. Subsequently, the formazan crystals formed were dissolved in 100 \u00b5L of DMSO, and the optical densities were measured at 570 nm using an ELISA reader . The experiment was repeated three times, and the average readings were recorded. The specific absorbance was calculated by subtracting the absorbance of the solvent from the overall absorbance to obtain accurate results [To evaluate the potential cytotoxic effects of various concentrations  of andrographis extract emulgel formulations on A-431 cell lines, the MTT assay was utilized. A-431 cells (2 \u00d7 104) were seeded into each well of a 96-well tissue culture plate containing 100 \u00b5L of DMEM and incubated at 37 \u00b0C with 5% CO results .5 cells per well and cultured in DMEM supplemented with 10% FBS. After allowing 24 h for adhesion, the cells were treated with IC50 concentrations of andrographolide, extract, and AEE8 for 24 h. Following the treatment, the cells were harvested and fixed. Subsequently, they were rinsed with PBS and stained with propidium iodide and RNase in PBS at room temperature for 30 min. Finally, the samples were analyzed using flow cytometry .In order to quantify the distribution of cells in different phases of the cell cycle, including sub G1, G1, S, and G2/M, a cell cycle assay was performed. A431 cells were plated onto six-well plates at a density of 2 \u00d7 102 atmosphere at 37 \u00b0C, the emulgel with different concentrations diluted in culture media  was added to the wells. Following another 24 h incubation period, the spent media were removed, and the MTT reagent was added at a final concentration of 0.5 mg/mL. After removing the MTT reagent, 100 \u03bcL of solubilization solution (DMSO) was added and gently stirred on a gyratory shaker to enhance dissolution. Finally, the absorbance was measured at a wavelength of 570 nm using a spectrophotometer or an ELISA reader.The optimized nanoemulgel, AEE8, containing andrographis extract, underwent cell viability testing using HDF  cell lines. The cells were cultured in DMEM and seeded in 96-well plates at a density of 20,000 cells per well. After 24 h of incubation in a 5% CO"}
+{"text": "Gilliamella apicola was markedly reduced. These changes were associated with significantly larger ileum microbiotas suggesting that extended exposure to the active hive environment plays an antibiotic role in hindgut microbiome establishment. We conclude that core hindgut microbiome transmission is facultative horizontal with 5 of 6 core hindgut species readily acquired from the built hive structure and natural diet. Our findings contribute novel insights into factors influencing assembly and maintenance of honey bee gut microbiota and facilitate future experimental designs.Honey bees are a model for host\u2013microbial interactions with experimental designs evolving towards conventionalized worker bees. Research on gut microbiome transmission and assembly has examined only a fraction of factors associated with the colony and hive environment. Here, we studied the effects of diet and social isolation on tissue-specific bacterial and fungal colonization of the midgut and two key hindgut regions. We found that both treatment factors significantly influenced early hindgut colonization explaining similar proportions of microbiome variation. In agreement with previous work, social interaction with older workers was unnecessary for core hindgut bacterial transmission. Exposure to natural eclosion and fresh stored pollen resulted in gut bacterial communities that were taxonomically and structurally equivalent to those produced in the natural colony setting. Stressed diets of no pollen or autoclaved pollen in social isolation resulted in decreased fungal abundance and bacterial diversity, and atypical microbiome structure and tissue-specific variation of functionally important core bacteria. Without exposure to the active hive environment, the abundance and strain diversity of keystone ileum species The online version contains supplementary material available at 10.1007/s00248-022-02025-5. A variety of symbiotic microbial associations have developed in the guts of insects and other animals. Social insects in particular present unique opportunities to investigate host\u2013microbiome interactions due to variation in individual behavior, phenotype, diet, and lifespan occurring within the same genetic unit \u20133. GivenApis mellifera) colonies are adaptively organized groups of individuals that collect and process floral-derived nutrition via age-based division of labor [Honey bee , bacteria found with greater abundance/prevalence in queen guts and/or the active colony environment [The hindgut of the adult worker honey bee harbors a core hindgut microbial community of five omnipresent bacterial groups totaling approximately 10al cells , 35. Thezed scab , 37. Snos firm 5 , 38, 39.ironment , 40, 41.In worker bees, the establishment of a typical hindgut microbiota happens in the first few days of adult life, leads to increased weight gain, reduced susceptibility to pathogens, and priming of the host immune system , 42, 43.Most recently, the honey bee hindgut microbiota has become the subject of significant research interest due to its role in disease susceptibility , 43, a mWe gathered emerging brood frames from 16 actively growing colonies in July 2016, at the Carl Hayden Bee Research Center in Tucson AZ. Twenty capped brood frames containing a high proportion of dark-eyed pupae were placed into screened collection boxes under controlled climate conditions . We alloWe tested the hypothesis that establishment of the hindgut microbiota in NEWs relies on contact with older established workers. A single cohort of newly emerged worker (NEWs) containing\u2009>\u20093000 bees were marked with a paint dot on their thorax, and divided among healthy full-sized colonies containing thousands of older established workers, or nuc-box cages containing no older workers, different diet treatments and two 19X9.125 inch frames of drawn wax comb that had been previously exposed to older established workers. To control for the colony environment including exposure to older established workers, we returned 100 marked NEWs to each of three healthy growing colonies. We placed 300 marked NEWs into each of nine nuc-box cages (three treatments with three replicates), and provided the following diet treatments: freshly collected and stored pollen (beebread), autoclaved corbicular pollen, and no pollen (sucrose syrup only). Thus, exposure to older established workers only occurred for the colony control. The beebread diet treatment consisted of one frame with abundant freshly collected pollen obtained near the center of the brood nest from healthy colonies that were actively collecting and storing pollen. In choice tests, workers prefer 1\u20132-day-old pollen , so we p2O (w/v) and then worked the mixture into a pollen paste. This mixture was autoclaved and packed into a frame of empty wax comb. The no pollen treatment received a frame of empty wax comb. All non-social cages were given a 2nd 19X9.125\u2033 frame of empty drawn wax comb to encourage clustering, and we provided sterilized 70% sucrose syrup and sterile water ad libitum via 30\u00a0ml drip bottles, and maintained the cages at 35\u00a0\u00b0C and 50% relative humidity. Both the autoclaved pollen and no pollen (sucrose only) diets are referred to as stressed diets.The autoclaved pollen treatment was comprised of corbicular pollen pellets stripped from the hind legs of foragers using a pollen-trapping device attached to the front of active colonies. To the corbicular pollen, we added 10% sterile HAfter nine days, twelve bees from each cage or colony replicate were dissected and processed as described in Fig.\u00a0For N\u2009=\u200948 pylorus/ileum and N\u2009=\u200948 rectum samples, we amplified the V6\u2013V8 variable region of the 16S rRNA gene using PCR primers 799F (acCMGGATTAGATACCCKG\u2009+\u2009barcode) and bac1193R (CRTCCMCACCTTCCTC). DNA was amplified using the HotStarTaq Plus Master Mix Kit  with the following thermocycler program: 94\u00a0\u00b0C for 3\u00a0min, followed by 28 cycles of 94\u00a0\u00b0C for 30\u00a0s, 53\u00a0\u00b0C for 40\u00a0s and 72\u00a0\u00b0C for 1\u00a0min, with a final elongation step at 72\u00a0\u00b0C for 5\u00a0min. PCR products were confirmed on a 2% agarose gel. PCR products were then used to prepare DNA libraries via the protocol for Illumina MiSeq DNA library preparation. Sequencing was performed at the University of Arizona Genetics Core on a MiSeq following the manufacturer\u2019s guidelines.Sequences were processed using MOTHUR v.1.35.1 . The makTotal bacteria and fungi in the midgut, pylorus/ileum, and rectum were quantified using the BactQuant and FungiQuant qPCR primers , 56 on BWe calculated microbiota diversity by treatment and niche, using unique sequences identified in the bioinformatics pipeline. Using the summary.single command in Mothur, we rarefied to the smallest library . We calculated observed number of unique sequences, Shannon\u2019s (H), the Effective Number of Species or richness (ENS- defined as the exp(H)) and equitability or evenness of the microbiota defined as H/Hmax, where Hmax\u2009=\u2009ln.We used the top 196 OTUs accounting for\u2009>\u200999% of the reads to examine transmission. We first defined the top 196 unique OTUs by species, core hindgut membership and proportional representation by treatment. We then performed a test for proportions on the top 196 unique OTUs comparing the colony control to the treatments, and normal diets to stressed diets.Lactobacillus kunkeei (5), Bifidobacterium asteroides (2) and Bombella apis (1). OTUs representing non-core diversity were summed and corrected for community size via mean (4.2) 16S rRNA gene copy number [The microbiome data set was transformed by bactiquant results and species-specific rRNA copy number. To incorporate community size in the analysis, we multiplied the proportional abundance of OTUs returned by amplicon sequencing by the total bacterial 16S rRNA gene copies determined with qPCR for each individual tissue type. All core bacterial genomes contain four 16S rRNA gene copies except y number . To alloy number , we convy number  using thy number . The anaAs a more straightforward measure of change in particular taxa without respect to other community members, we compare estimated cell counts by niche and taxon using an ANOVA performed on log-transformed cell counts normalized for species-specific 16S rRNA gene copy number. Effects attributed to diet were examined by comparing stressed diets (autoclaved corbicular pollen or no pollen) to normal diets of freshly collected beebread (colony and pollen). Microbial community structure was also compared with diet source and social context as factors. We compared bacterial and fungal copy number by niche using one-way ANOVA (Tukey HSD post hoc) and two-sample t-tests. We performed correlations examining log-transformed fungal abundance with each major bacterial taxon. All analyses were conducted in either JMP_v11(JMP_ 1989\u20132007) and/or SAS_ v9.4 .F. perrara from G. apicola, we clustered the sequences at 99% similarity, producing a total of 4367 OTUs following the exclusion of singletons and doubletons. We then confirmed taxonomy via NCBI BLAST and consolidated core gut phylotypes from the top 40 OTUs reducing the data set to 8 core gut phylotypes. Following consolidation and taxonomic confirmation, eight of the top 40 unique OTUs  were sparse containing a high frequency of zero values. These eight OTUs were consolidated into a 9th group consisting of \u201cother\u201d (\u03a3 OTUs 41\u201397 plus the eight listed above). Following consolidation, the eight phylotypes and \u201cother\u201d represented 97% and 1.5% of the total sequences, respectively, and were used for downstream statistical analyses. The dependent variable \u201cother\u201d is a combination of OTUs representing a measure of non-core bacterial abundance for each tissue.Next-generation sequencing returned 4,236,606 quality trimmed reads (400\u00a0bp) for the 96 libraries, an average of 44,131 sequences per library Table . To distp\u2009=\u20090.0007). In the no pollen treatment provided only sucrose solution, the guts of nine-day-old adults weighed significantly less than the treatments provided pollen in some form, and newly emerged adults consumed 36% less autoclaved pollen than they did freshly collected pollen [Considering the three treatments where diet consumption could be measured, gut weight differed significantly by diet treatment , and wasd pollen .3,44\u2009=\u20093.1, p\u2009=\u20090.04), and ileum  of workers fed a diet of fresh beebread but raised in social isolation. In the midgut, bacterial abundance differed between the colony control and fresh pollen treatment . In the ileum, the colony control differed in bacterial abundance from fresh pollen (p\u2009=\u20090.001), and no pollen (p\u2009=\u20090.0005). Bacterial abundance in the rectum did not differ by diet treatment or social exposure.Bacterial abundance differed by treatment in two of three gut tissues Fig.\u00a0. Relativ3,44\u2009=\u200964.3, p\u2009<\u20090.0001) as compared to the other two gut regions; post hoc tests revealed that colony control midguts differ from those of fresh pollen, autoclaved pollen and no pollen (p\u2009<\u20090.0001), and the fresh pollen treatment also differed from autoclaved pollen (p\u2009<\u20090.005) and no pollen (p\u2009<\u20090.0004). Fungal abundance also differed among treatments in the ileum ; post hoc tests show colony control differs from fresh pollen (p\u2009<\u20090.0004), autoclaved pollen and no pollen (p\u2009<\u20090.0001), and fresh pollen differs from autoclaved pollen and no pollen (p\u2009<\u20090.0001). In the rectum, differences were significant but less pronounced . Following post hoc tests, fungal abundance in rectums of the colony control differed from fresh pollen (p\u2009<\u20090.002) autoclaved pollen (p\u2009<\u20090.0004) and no pollen (p\u2009<\u20090.0009).Fungal abundance differed by treatment across all three gut sections Fig.\u00a0. In natuBased on unique bacterial OTUs, the diversity of combined hindgut tissues (ileum and rectum) differed by treatment including observed species, Shannon\u2019s H, and Equitability, a measure of evenness Fig.\u00a0. ConsideGilliamella apicola differed by social environment (Table p\u2009<\u20090.00001). The richness of the other four core hindgut groups did not differ by social environment, but S. alvi richness differed by diet treatment showing 21\u201322 established strains in normal diets, but only 11\u201313 in stressed diets  than that of fresh-stored pollen , and sub3% than tra Figs. . G apicoes Table .L. firm5, L. kunkeei, G. apicola and Bombella apis, in the ileum and L. firm 4 and B. asteroides in the rectum  exposure to the emergence frame. Given this initial exposure, the asocial fresh pollen treatment was highly similar to the social colony control based on multiple measures S. alvi id oxygen , 38. Undd oxygen . Data ond oxygen . Strongloduction . Based ovi Table . Confirmon Table . Correspectively , 70\u201372.S. alvi and G. apicola establish poorly when NEWs were exposed to either five or 300 older siblings and wax frames of unstated origin [G. apicola established poorly relative to the colony control, attaining typical proportions in\u2009<\u200950% of individuals [G. apicola establishment is sensitive to a socially related factor. Positively correlated with the abundance of G. apicola, fungal density was significantly diminished throughout the gut, suggesting that fungi are also difficult to acquire with limited exposure to the colony environment. More control of microbial exposure is required to test this hypothesis. If this particular bacterial partnership does not establish, it appears to trigger a cascade of negative changes in host physiology [G. apicola strains will increase the chance of compatibility with sister strains, and ileum partner S. alvi.Confirmed in separate laboratory experiments, both d origin , 9. Evenividuals , mirroriysiology , 44. ExpG. apicola and/or the ileum partnership with S. alvi may be functionally \u201creplaced\u201d by L. kunkeei and Bombella apis under various environmental conditions  resulted in a sporadic pattern of species co-occurrence and increased microbiota similarity between in the ileum and rectum Figs.  and 6, s pylorus , associa pylorus ). While  pylorus , fungal Lactobacillus firm5 is found with high prevalence and abundance throughout the hive environment and is readily acquired with natural eclosion [Lactobacillus firm5 phylotype are abundant in every hindgut, and hypothesized to coexist via resource partitioning [Lactobacillus firm5 may associate by niche. While our 400\u00a0bp sequence cannot distinguish among three of the four major Lactobacillus firm5 species, OTU2 corresponds to Lactobacillus apis which appears to colonize first [L. apis niche fidelity for the ileum, perhaps via adaptations to exploit host-excreted nutrients. Lactobacillus apis -host fidelity was disrupted in the stressed diet treatments but the same group of unique Lactobacillus firm5 sequences dominated the hindgut in a different way; stressed diet treatments tended towards greater evenness of Lactobacillus firm5 species, while microbiotas associated with normal diets tended towards greater dominance.eclosion , 20, 82.eclosion . Based oitioning . Althougze first , and preRelative to vertical transmission, a mechanism of facilitated horizontal transmission may be a more robust evolutionary strategy because it promotes increased population variability, allows for partner choice, and results in greater competition within and between species/strains . Many faL. kunkeei and Bombella apis, are also core species that colonize the queen ileum [While many microbes are introduced from the pollination environment, the active hive environment does not represent an alien microbiome composed of non-specialized residents; it is comprised in large part of microbes carried with worker bees when they reproduce by budding . These cen ileum , 40, 86.Our results show that hindgut microbiota assembly involves both fungi and bacteria, and relies on factors associated with diet and active hive exposure. With few exceptions, fungi have been ignored in studies of the honey bee microbiota , 47. SymSupplementary file1 (XLSX 215 KB)Supplementary file2 (XLSX 930 KB)Below is the link to the electronic supplementary material."}
+{"text": "Collection and mechanical recycling of post-consumer flexible polypropylene packaging is limited, principally due to polypropylene being very light-weight. Moreover, service life and thermal\u2013mechanical reprocessing degrade PP and change its thermal and rheological properties according to the structure and provenance of recycled PP. This work determined the effect of incorporating two fumed nanosilica (NS) types on processability improvement of post-consumer recycled flexible polypropylene (PCPP) through ATR-FTIR, TGA, DSC, MFI and rheological analysis. Presence of trace polyethylene in the collected PCPP increased the thermal stability of the PP and was significantly maximized by NS addition. The onset decomposition temperature raised around 15 \u00b0C when 4 and 2 wt% of a non-treated and organically modified NS were used, respectively. NS acted as a nucleating agent and increased the crystallinity of the polymer, but the crystallization and melting temperatures were not affected. The processability of the nanocomposites was improved, observed as an increase in viscosity, storage and loss moduli with respect to the control PCPP, which were deteriorated due to chain scission during recycling. The highest recovery in viscosity and reduction in MFI were found for the hydrophilic NS due to a greater impact of hydrogen bond interactions between the silanol groups of this NS and the oxidized groups of the PCPP. In recent years, considering that global plastics production increased to 390.7 million tons in 2021, development of strategies for valuing plastic waste has received growing interest in order to reduce their accumulation in the environment and minimize economic losses and damage to natural systems [Mechanical recycling is one of the most attractive strategies to recover plastics after consumption. Polypropylene (PP) is one of the most demanded plastics that can be mechanically recycled and is widely used for packing snacks, pasta, baked goods, rice and beverages. PP has low specific weight, thermal and impact resistance, low cost and is processable through conventional industrial techniques, such as extrusion and injection molding . These pNanotechnology is a current alternative to improve the physical\u2013rheological properties of recycled polymers by incorporating low concentrations of nanoparticles in the polymeric matrix. Development of nanocomposites based on recycled polymers has high added value and attractiveness for the polymer and composites industries. Nanoreinforcements promote a large interface surface area that leads to quantitative improvement in the polymer\u2019s performance . The nanProperties of nanocomposites depend on the type of polymer, the polymer\u2019s molecular weight and grade, chemical structure, type and concentration of nanofiller, processing conditions and plastic conversion techniques, among others . StudiesFumed silica is an outstanding alternative because of its commercial accessibility, low cost and uses as a food additive . Fumed sThus, in this work, nanocomposites based on post-consumer flexible PP and two types of fumed silica (hydrophilic and hydrophobic) were developed, and their structural, thermal and processability properties were investigated.\u22121 at 230 \u00b0C and 2.16 kg) was supplied by Petroquim S.A. (Chile). Post-consumer recycled polypropylene pellets (PCPP) from flexible packages were purchased from Inproplas S.A (Chile). Two types of commercial fumed nanosilica (NS) purchased from Haochuang Material (native particle size ranges from 5 nm to 40 nm) were used: (i) hydrophilic nanosilica (NS1) with a specific surface area of 200 m2 g\u22121 and (ii) hydrophobic nanosilica (NS2) obtained after chemical post-treatment of NS with dimethyldichlorosilane.Homopolymer grade virgin polypropylene in pellets (VPP)  or hydrophobic (NS2). Control films and pellets of PCPP and VPP were also prepared. VPP was used as a reference of a type of polypropylene used in the manufacture of bioriented extruded or coextruded films.\u22121 in a pelletizer Scientific, LZ-120  coupled to the extruder.Preparation of films and pellets was carried out by using a twin-screw extruder Labtech Scientific LTE-20\u201340  with a temperature profile from 180 \u00b0C to 195 \u00b0C from feeding to the extruder die. The screw speed was 35 rpm and the torque was between 40% and 50%. Previously, polymers and NS were dried at 100 \u00b0C for 24 h. Thickness of the films was measured by using digital micrometer Digimatic Mitutoyo ID-C112 , resulting between 150 and 180 \u00b5m. For pellets production, filaments were formed in a round nozzle die and subsequently solidified in a Scientific model LW-100 water bath . The filaments were cut at a speed of 10 m min\u22121 with a resolution of 4 cm\u22121 and 64 scans. The spectra analyses were performed with the program Opus v. 7.0.PP, NS and nanocomposites were analyzed in an FTIR equipment Bruker Alpha IFS 66V  coupled to a crystal diamond of attenuated total reflection Bruker Platinum. FTIR spectra were obtained in attenuated total reflectance (ATR) mode in a wavenumber range from 4000 to 400 cm\u22121 heating rate under nitrogen atmosphere with a flow rate 50 mL min\u22121. Decomposition initiation temperature at 2.5% mass loss (Tonset), temperature at the maximum degradation rate (Td) and weight percentage of residues at 600 \u00b0C were determined.Thermal stability and degradation temperatures of PP, NS and nanocomposites were evaluated through thermogravimetric analysis with a TGA/DSC 1 analyzer . 6 to 7 mg of each sample (film or NS) were collocated in alumina capsules and heated from 30 \u00b0C to 700 \u00b0C at 10 \u00b0C min\u22121 under a nitrogen atmosphere. Melting temperature (Tm), crystallization temperature (Tc) and melting (\u0394Hm) and crystallization (\u0394Hc) enthalpies were determined. Furthermore, the crystallinity of the samples was calculated through Equation (1):100 is the melting enthalpy of a whole crystalline polypropylene (207 J g\u22121) [PP is the mass fraction of the polymer in the sample. DSC analyses were carried out in duplicate.The effect of incorporating NS in the thermal properties of the PCPP was analyzed through differential scanning calorimetry (DSC) using a Mettler DSC-822e analyzer . 5 to 6 mg of each film was weighed into aluminum capsules and subjected to three thermal programs: (i) 0 \u00b0C to 250 \u00b0C (first heating), (ii) 250 \u00b0C to 0 \u00b0C (cooling) and 0 \u00b0C to 250 \u00b0C (second heating), with a heating/cooling rate at 10 \u00b0C min7 J g\u22121)  and XPP \u22121, which was previously verified to be in the linear viscoelastic range by amplitude sweep tests for polypropylene.VPP, PCPP and nanocomposites with 1, 2 and 4 wt% of each NS were analyzed to establish comparisons between nanocomposites with improved thermal stability at equivalent concentrations of NS1 and NS2. Plates of 25 mm \u00d7 1.5 mm (1.4 g approx.) were injection-molded from the samples in pellets through a machine Haake MiniJetPro Thermo Fisher Scientific. The injection conditions were a conditioning time of 90 s, injection temperature of 220 \u00b0C, pressure of 500 bar, injection time of 5 s, post-injection pressure and time of 200 bar and 5 s and a molding temperature of 60 \u00b0C. The plates were subjected to rheological tests in a parallel plate rheometer Anton Paar MCR301 to measure the complex viscosity (\u03b7*), storage modulus (G\u2032) and loss modulus (G\u2033) versus frequency (\u03c9) at 190 \u00b0C under nitrogen atmosphere in dynamic mode. The frequency range was between 0.1 and 500 rad sThe melt flow index of the PCPP and nanocomposites with 1, 2 and 4 wt% of NS was evaluated to establish comparisons between nanocomposites with improved thermal stability at equivalent concentrations of NS1 and NS2. The tests were carried out in a plastometer Zwick Roell Mflow  following the ASTM D1238-20 standard. 4 to 5 g of sample in pellets were put into the plastometer\u2019s cylinder and heated at 230 \u00b0C with an applied weight of 2.16 kg. Six measurements for each sample were carried out with a preheating time of 7 min, and the average value and standard deviation were reported.p < 0.05).The results obtained for DSC and MFI were statistically analyzed through variance analysis (ANOVA) and LSD Fischer\u2019s multiple range test in order to find statistically significant differences between the samples for a random experimental design  chains [\u22121 would be associated with formation of carbonyl groups. For instance, a study developed by Fasihah et al. (2017) associated peaks at 1718 and 1741 cm\u22121 identified in the recycled PP to formation of ketone and ester groups, respectively [840 cm\u22121 . Figure ) chains ,26. Thisectively . Presenc\u22121, bending vibration of \u2013OH in the silanol group at 800 cm\u22121 and rocking vibration of Si-O group at 454 cm\u22121 [\u22121 in the NS2 was observed and attributed to the asymmetrical stretching vibration of C\u2013H associated with the organic modifier of the NS ; however, it overlapped with the peak of PCPP related to rocking vibration of \u2013CH3 group.onset, Td and residue mass at 600 \u00b0C of the samples are reported in onset and Td of PCPP in accordance with ATR-FTIR analysis. PE is more thermally stable and is degraded from 400 \u00b0C, as reported by Dikobe and Luyt (2010) in their comparative study of LLDPE and PP and their composites with wood powder [As d powder . The lowd powder .onset and Td of the nanocomposites. In this context, Tonset of the PCPP was increased 10 \u00b0C when 0.5 wt% of NS1 was incorporated, and 14 \u00b0C for nanocomposite PCPP-4NS1. Td of the PCPP with a value of 462 \u00b0C was also slightly increased to 465 \u00b0C when 4 wt% of NS1 was added. The excellent thermal resistance of NS1 to high temperatures delayed degradation of the polymeric matrix. Furthermore, thermal degradation of the polymer possibly favored agglomeration of NS aggregates on the surface of the melted material, which created a physical barrier to heat in the polymer [On the other hand, as  polymer .onset and Td values compared to the control PCPP film. Furthermore, the Tonset of PCPP-0.5NS2 was lower than the Tonset of the VPP film. This effect could result from the lower thermal stability of the hydrophobic NS2 and the possible interactions of the organic modifier of the NS2 with the polymer matrix, which favored early degradation of the PCPP. However, an increase in NS2 concentration improved the thermal stability of the nanocomposites, and PCPP-1NS2 was the most thermally stable nanocomposite. This result would be associated with an adequate balance between the concentration and dispersion of the NS in this nanocomposite. However, the highest concentration of NS2 (4 wt%) diminished Tonset, possibly due to a greater concentration of organic modifier interacting with the PCPP, and then the effect of better heat transfer to the polymer matrix prevailed and favored its degradation.Incorporation of NS2 also delayed thermal degradation of PCPP at 1% of NS2 or higher concentrations. Nonetheless, d values at 2% y 4 wt% of each NS. It is important to highlight that the Tonset values of all nanocomposites were below the extrusion temperature of the PP.On the other hand, PCPP film exhibited higher residue concentration after its pyrolysis than VPP film. Pyrolysis of the VPP resulted in 2% residues and was increased to 6% for PCPP. Furthermore, incorporation and increase in NS produced a rise in residual percentage in the nanocomposites. This result would be associated with inorganic contamination of particles and additives incorporated during recycling of the PCPP, whose amount might have varied among the samples due to the heterogeinity of the recycled plastic used for each extrusion load and the presence of residual NS not degraded during the thermal analysis . FinallyOn the other hand, PCPP was less crystalline than VPP, possibly associated with two factors: (i) the commercial VPP was an isotactic homopolymer and (ii) the presence of traces of polymers structurally different from the PP in the PCPP that impeded the ordering of polymeric chains during the cooling for the film production by extrusion. Further, PP reprocessing could generate shorter polymeric chains that favor a lower amount of ordered sites or smaller crystallites whose energy to be melted is lower, as Nanocomposite films had thermal behavior similar to the PCPP control film. This effect was evidenced since their melting temperatures and enthalpies had similar values . Howeverc, whose value is similar to the reported values in previous studies for PE [s for PE ,40,42. FFinally, in the second heating, where the thermal history of the polymer was erased, temperature values and similar thermal behavior to the first heating were registered. However, formation of a unique crystalline structure in the PP with melting temperatures of PP and PE slightly lower than those registered in the first heating process is highlighted. Further, NS addition did not significantly affect such temperature values., and, as in the first heating process, a significant increase in the crystallinity of PCPP by the presence of NS was observed. This fact confirmed the nucleation effect of nanoparticles during manufacture of nanocomposites. Nonetheless, statistical differences in the crystallinity of the nanocomposites were not obtained through variation in type and concentration of NS.\u22121) [\u22121) . The zerNS type did not influence viscosity values at 1 and 2 wt% of NS, but a significant difference at 4 wt% of NS was found . This faThe storage modulus (G\u2032) and loss modulus (G\u2033) versus frequency for all materials are shown in Conversely, NS1- and NS2-filled nanocomposites showed higher G\u00b4and G\u2019\u2019 values with respect to the PCPP independent of type of NS. The viscoelastic behavior of the nanocomposites containing NS1 or NS2 was similar. All curves showed the typical melt behavior of the PP, with G\u2032 decreasing with lowering frequency, reported as Maxwellian behavior for the nanocomposites based on virgin PP . Further\u22121 to lower frequency values of 38.6 and 44.7 rad s\u22121, respectively. The transition to a rather elastic/solid-like behavior at a slightly lower frequency for PCPP-4NS1 could be associated with less chain relaxation in this nanocomposite, possibly due to a greater number of more intensive interactions of hydrogen bond types between the hydrophilic NS1 and the oxidized groups in the PCPP. Further, G\u2032 and G\u2033 at 0.1 rad s\u22121 were plotted as a function of NS content in \u22121 has been reported for nanocomposites based on virgin PP prepared via in situ polymerization [On the other hand, rization .MFI measures the capability of a polymer to be adequately processed through techniques with high mechanical stress and pressure as extrusion. MFI is inversely proportional to the viscosity and molar mass of a polymer ,46. In t\u22121, two times higher than the VPP used as a commercial reference (\u22121 are used in the food packaging industry [The MFI of the PCPP was 6.8 g 10 mineference . It is iindustry . Recycliindustry .\u22121) when 30 wt% wood powder was incorporated [\u22121) between 25% and 45%, attributed to a restriction of flowability of the composite with high interaction between the filler and polymer [On the other hand, incorporating NS1 at 1 wt% slightly reduced the MFI of the PCPP, and this reduction was more significant at 2 and 4 wt%. High NS1 content favored interactions by hydrogen bonds between the oxidized groups of the PCPP and the silanol groups of the NS1, which increased the viscosity of the nanocomposite. This effect counteracted the negative impact of the degraded recycled polymer on viscosity, which typically tended to be reduced. Moreover, the hydrophilic nature of NS1 enhanced the immiscibility between the nanoparticles and the polymer at the highest concentrations of NS1, causing formation of agglomerates and favoring a drastic reduction in the MFI of the polymer. Previous studies on PCPP composites also evidenced reduction in MFI of polymers by addition of fillers other than nanosilica. Haq and Srivastava (2017) observed a decrease of 1.2-fold for the MFI of recycled PP (9.28 g 10 minrporated . The sam polymer .onset and Td higher than the control PCPP.As with nanocomposites with NS1, incorporation and increase in NS2 concentration in the PCPP reduced its MFI . HoweverNanocomposite films based on post-consumer recycled polypropylene and hydrophilic and hydrophobic fumed silica were satisfactorily developed by extrusion. The results indicated that fumed silica hindered thermal degradation, possibly due to interactions between NS and PCPP that hindered PCPP chain scission. PE traces in PCPP and carbonyl groups formed by thermal\u2013mechanical degradation of the polymer during its recycling were detected. Excellent thermal resistance of the NS promoted high thermal stability for PCPP. Hydrophilic nanosilica improved thermal stability for nanocomposites, with 1 to 4 wt% of the filler associated with its thermal resistance and physical barrier to heat. Meanwhile, hydrophobic nanosilica enhanced the thermal stability of the PCPP more significantly at 1 wt% of the nanofiller as a combined result of several influencing factors, such as hydrophobic nanosilica concentration and interactions between the organic modifier and the PCPP, which enabled heat transfer to the polymer. Furthermore, nucleation action exerted by the NS during nanocomposites\u2019 processing slightly favored the polymer\u2019s crystallization.On the other hand, interestingly, incorporation and increase in NS concentration counteracted the negative impact of the shorter degraded polymer chains in the PCPP. These shorter polymer chains typically cause a reduction in viscosity of a recycled PP, but the interactions of the polymer with the nanosilica, including interactions between the oxidized groups of the PCPP and silanol groups in the nanosilica, increased the complex viscosity more significantly at the highest hydrophilic nanofiller concentration. Thus, PCPP/fumed silica nanocomposites presented improved processability, which appears to be recovery of storage and loss modulus. It is highlighted that rheological performance varied with nanosilica loading, especially at a low frequency range, and was determined through differences in affinity between type of NS and PCPP.The results on improving thermal stability and viscosity recovery of PCPP by nanosilica addition are promising for potentially increasing the recycling rates of this flexible plastic toward a more circular economy, highlighting that research on the properties of the developed nanocomposites and their reprocessing by industrial plastic conversion techniques for specific applications are needed."}
+{"text": "GelStereo sensing technology is capable of performing three-dimensional (3D) contact shape measurement under various contact structures such as bionic curved surfaces, which has promising advantages in the field of visuotactile sensing. However, due to multi-medium ray refraction in the imaging system, robust and high-precision tactile 3D reconstruction remains a challenging problem for GelStereo-type sensors with different structures. In this paper, we first propose a universal Refractive Stereo Ray Tracing (RSRT) model for GelStereo-type sensing systems to realize 3D reconstruction of the contact surface. Moreover, a relative geometry-based optimization method is presented to calibrate multiple parameters of the proposed RSRT model, such as the refractive indices and structural dimensions. Furthermore, extensive quantitative calibration experiments are performed on four different GelStereo sensing platforms; the experimental results show that the proposed calibration pipeline can achieve less than 0.35 mm in Euclidean distance error, based on which we believe that the proposed refractive calibration method can be further applied in more complex GelStereo-type and other similar visuotactile sensing systems. Such high-precision visuotactile sensors can facilitate the study of robotic dexterous manipulation. Tactile perception is one of the main ways for humans to interact with real-world environments ,2, and hCurrently, various types of tactile sensors have been developed, with different structures used to adapt to different sensing requirements and integration scenarios. A detailed survey of visuotactile sensing technologies can be found in . NeverthRecently, our previous studies proposed the GelStereo route based on a binocular stereo vision system ,17,21. TIn this paper, we carry out an in-depth study of the universal 3D reconstruction pipeline of GelStereo-type sensors, with an emphasis on refractive calibration. To begin with, a Universal Refractive Stereo Ray Tracing model, which we call GU-RSRT, is presented for GelStereo-type sensors with various structures. The GU-RSRT performs ray tracing modeling on the GelStereo imaging systems, in which the parameters include intrinsic and extrinsic parameters of the binocular camera, refractive indices, and structural geometry. To obtain these parameters in GU-RTST model, we propose a Universal Multi-Medium Refractive (UMMR) calibration method using the embedded relative geometric features of checkerboards. Furthermore, a Marker-Based Self-Calibration (MBSC) method is proposed for specific GelStereo-type sensors with known structured markers embedded on the sensor surface, which omits the step of checkerboard calibration and updates the sensor parameters during daily use, significantly improving the service life of the sensor. Extensive calibration and evaluation experiments are performed on four GelStereo-type sensors with different refracting and contact surfaces. The experimental results show that the proposed refractive calibration method can obtain reasonable parameters for the GU-RSRT model, and the constructed 3D reconstruction system achieves 3D points measurement with less than 0.35 mm Euclidean distance error on different sensor platforms. Furthermore, the proposed 3D reconstruction pipeline with refractive calibration can be practically applied to high-precision 3D deformation measurement in various GelStereo-type sensors and similar visuotactile sensors, including those with binocular cameras and undergoing multi-medium light refraction, as shown in A universal refractive stereo ray tracing model that can handle sensors with arbitrary refracting and contact surfaces is presented for GelStereo-type sensors.A universal multi-medium refractive calibration method using the embedded geometric features of checkerboards is proposed to obtain refractive parameters in GelStereo imaging systems. The results show that the proposed calibration method can realize high precision (less than 0.35 mm Euclidean distance error) in 3D contact geometry measurements on different sensor platforms.A marker-based self-calibration method that can automatically perform refractive calibration every time the sensor starts up is proposed for specific GelStereo-type sensors with known structured markers embedded on the sensor surface, allowing for prolonged sensor life.In summary, the contributions of this paper can be summarized as follows:The rest of this paper is organized as follows. We first provide a tactile 3D reconstruction pipeline for GelStereo-type sensors using a GU-RSRT model . The refm times refraction and use the general equation GelStereo-type sensors utilize a binocular vision system for 3D geometry sensing. With sparse or dense stereo matching points pairs on left and right tactile images ,21, a 2DTaking the left ray as an example, we backpropagate the rays from the camera optical center to the 3D points on the sensor surface in the left camera coordinate system.Given a point on the left tactile image  and lefquations  and 3)  fi , the, the7), m on the sensor surface. This intersection point is considered as the reconstructed 3D point. In order to compute this point, we transform the right ray m from the right to the left camera coordinate system:The left and right rays intersect in medium P can be computed byThis equation set is overdetermined; thus, that the least square method is employed. The reconstructed 3D point Equation .To achieve high-precision 3D geometry sensing, a refractive calibration method is desirable in order to obtain a fine set of parameters for GU-RSRT model. The model parameters are divided into three parts, including camera parameters, refractive indices, and structural parameters. Zhang\u2019s method  is emploIn GelStereo-type sensor imaging systems, the shapes of refracting surfaces are already known, as they are determined by the sensors\u2019 structure design. However, the pose of the refracting surface in the camera coordinate system is uncertain due to deviations during sensor assembly. The pose is determined by several translation and orientation parameters  calibration method for GelStereo-type sensors. In practice, we fully pressed checkerboards onto the surface of the sensor\u2019s transparent elastomer. The 3D point of each corner was then reconstructed by the GU-RSRT model. The objective functions were designed to ensure the spatial invariance of the checkerboard corners.l, and As shown in The objective function for the Euclidean distance can be designed as follows:The horizontal edges of the checkerboard are perpendicular to the vertical edges. Then, the objective function for perpendicularity can be designed asThis objective function expresses that the red vector is perpendicular to the blue vector in The final objective function is a linear combination of Equation ).Instead of the checkerboard mentioned in the UMMR method, the structured markers embedded on the sensor surface can provide the ground truth of relative geometric features. A Marker-Based Self-Calibration (MBSC) method is proposed for specific GelStereo-type sensors. These sensors should have curved refracting surfaces, curved sensor surfaces, and markers with known structures.S is the number of markers after downsampling and Unlike the checkerboard with a planar structure, markers are distributed in 3D space. The Euclidean distance between markers is mainly used in self-calibration. In order to improve the computational efficiency without loss of geometric constraints, the voxel downsampling method is employed to downsample all markers into a few key markers. The objective function is designed as follows:In order to verify the effectiveness of the proposed tactile 3D reconstruction pipeline, including the GU-RSRT model and the refractive calibration methods, we carried out the following experiments on several sensor platforms.Quantitative experiments on 3D reconstruction. First of all, we quantitatively evaluate the accuracy of the proposed tactile 3D reconstruction pipeline using ground truth 3D points obtained from high-precision measuring instruments. Specifically, the 3D reconstruction errors on four different GelStereo-type sensors with various refracting surfaces and sensor surfaces were evaluated using the Mean Absolute Error (MAE) in the X, Y, Z directions and the Mean Euclidean Distance Error (MEDE) between the reconstructed 3D points and the ground truth. Moreover, on these sensor platforms we analyzed the reconstruction errors of 3D points with different contact depths and regions.Method comparison experiments. In addition to the methods proposed in this paper, two other commonly used 3D reconstruction methods were used to ensure a comprehensive evaluation.Traditional Triangulation Method (TTM): Without considering multi-medium refraction, the traditional triangulation method was applied using binocular camera parameters calibrated in the air.Camera Parameters Absorption Method (CPAM): The 3D reconstruction errors caused by multi-medium refraction can be absorbed by the camera parameters to a certain extent ,41. In pGU-RSRT+UMMR: The GU-RSRT model with parameters calibrated through the universal multi-medium refractive calibration method was applied to GelStereo-type sensors for tactile 3D reconstruction.GU-RSRT+MBSC: The GU-RSRT model with parameters calibrated through marker-based self-calibration method was applied to GelStereo-type sensors for tactile 3D reconstruction.Ablation studies. In-depth ablation studies on the UMMR calibration method were carried out to study the importance of each relative geometric feature.GU-RSRT+UMMR . Considering the pixel position of the black dot on the images, the estimated 3D position was computed using the proposed pipeline. The 3D readings from the linear guide were converted to the left camera coordinate system using a transformation matrix, which was obtained by ArUco-based pose estimation [A platform for collecting binocular tactile image pairs and corresponding ground truth 3D points was needed for evaluation. As shown in timation  and the timation . The conUMMR calibration was conducted during sensor fabrication, specifically, before painting markers and the coating layer. First, checkerboard images on the sensor surface were captured for refractive calibration using the UMMR method. Specifically, we pasted a checkerboard pattern on the flat surface of the 3D-printed calibration board. We manually pressed this calibration board onto the transparent gel surface, as shown in Then, the optimization problem was formulated based on Equation  for refrEquation  were setFinally, this optimization problem was solved using a differential evolution algorithm. The bounds of parameters are listed in Using the platform in To evaluate the 3D reconstruction errors of different regions on the sensor surface, these sampling points were divided into several groups, which are depicted by yellow lines and numbers in 3D reconstruction accuracy. The refractive calibration results and 3D reconstruction errors of GelStereo Tip sensor, GelStereo Palm2.0 sensor, GelStereo Palm1.0 sensor, and GelStereo BioTip sensor are shown in Methods comparison. In Self-calibration. The results of marker-based self-calibration and the 3D reconstruction errors of the GelStereo Palm1.0 and GelStereo BioTip sensors are shown in In addition, we applied this marker-based self-calibration method to the GelStereo Tip and GelStereo Palm2.0 sensor; however, the performance was not satisfactory, as shown in 3D reconstruction errors with different contact depths and regions. We further studied the reconstruction accuracy of the proposed method on different sensor platforms for different contact depths and contact regions in order to evaluate its robustness. The error distributions at different contact depths are illustrated using a violin plot in Ablation studies. The results of ablation studies on the UMMR calibration method are demonstrated in In GelStereo-type sensor imaging systems, the shapes of refracting surfaces play an important role in ray tracing. Although the refracting surface function depends on sensor design, the manufacturing process  of the transparent supporting plate might bring errors into this function, especially on the curved supporting plate in the GelStereo Palm1.0 and GelStereo BioTip sensors. To solve this problem, a method for correcting the function of the refracting surface should be integrated into the refractive calibration process. In this way, the precision of tactile 3D reconstruction can be further improved in GelStereo-type sensors.As mentioned in In this paper, we present a universal Refractive Stereo Ray Tracing model for GelStereo-type sensors to model the tactile 3D reconstruction under multi-medium light refraction. In addition, a Universal Multi-Medium Refractive (UMMR) calibration method is proposed to obtain the refractive and structural parameters in the GU-RSRT model, in which relative geometric features on checkerboards are employed to build an optimization problem for calibration. In addition, a self-calibration method based on structured markers on the sensor surface is provided for specific GelStereo-type sensors.Extensive calibration and evaluation experiments are conducted on four different GelStereo-type sensors with various structure designs. The experimental results show that the proposed refractive calibration method can obtain reasonable parameters of the GU-RSRT model and the 3D reconstruction error of the mean Euclidean distance error is less than 0.35 mm, which outperforms the other 3D reconstruction methods. In addition, the accuracy of the marker-based self-calibration method is slightly better than the UMMR calibration method on GelStereo-type sensors with curved refracting surfaces. The self-calibration method has great potential in improving calibration efficiency and sensor service life. Moreover, our experimental results show the robustness of the proposed 3D reconstruction pipeline with different contact depths and regions.The feasibility of the proposed tactile 3D reconstruction pipeline is fully demonstrated in this paper. Its practical application scenario is visuotactile sensing  based on binocular cameras and undergoing multi-medium light refraction. With high-precision sensing capability, GelStereo-type sensors and other similar visuotactile sensors could provide more possibilities for robots to achieve rich-contact and dexterous manipulation. In the future, we intend to further improve the 3D reconstruction performance of GelStereo-type sensors and apply GelStereo-type sensors to robotic perception and manipulation tasks."}
+{"text": "Modelling studies suggest that about one third of the glacial carbon drawdown may not be associated to the deep ocean, but to the thermocline or intermediate ocean. However, the carbon storage capacity of thermocline waters is still poorly constrained. Here we present paired 230Th/U and 14C measurements on scleractinian cold-water corals retrieved from\u2009~\u2009450\u00a0m water depth off the Maldives in the Indian Ocean. Based on these measurements we calculate \u220614C, \u2206\u220614C and Benthic-Atmosphere (Batm) ages in order to understand the ventilation dynamics of the equatorial Indian Ocean thermocline during the Last Glacial Maximum (LGM).\u00a0Our results demonstrate a radiocarbon depleted thermocline as low as -250\u00a0to -345\u2030 (\u2206\u220614C), corresponding to\u2009~\u2009500\u20132100\u00a0years (Batm) old waters at the LGM compared to\u2009~\u2009380\u00a0years today. More broadly, we show that thermocline ventilation ages are one order of magnitude more variable than previously thought. Such a radiocarbon depleted thermocline can at least partly be explained by variable abyssal upwelling of deep-water masses with elevated respired carbon concentrations. Our results therefore have implications for radiocarbon-only based age models and imply that upper thermocline waters as shallow as 400\u00a0m depth can also contribute to some of the glacial carbon drawdown.Variations of atmospheric CO Accordingly, Quaternary glacial and interglacial variations in atmospheric CO2 concentrations have been attributed to changes in the sink and source properties of the Earth surface carbon cycle, particularly to the marine carbon cycle5. Although there appears to be some heterogeneity in the different sectors of the Southern Ocean8, there is growing evidence for the presence of an isolated carbon reservoir during the last glacial period that may have accumulated re-mineralized (respired) organic carbon, 14. In addition, it has been suggested that the deep ocean possibly absorbed 730\u2013980 Pg of dissolved inorganic carbon (DIC) during the Last Glacial Maximum  of which one third may be accounted for by a transfer from thermocline and intermediate waters15. This demonstrates that the deep-sea carbon inventory is heterogeneous. It is well admitted that the deep-sea carbon pool did age significantly during the LGM, but there is a profound uncertainty regarding the exchange between surface and deep ocean, i.e. the role of intermediate and thermocline waters.Ocean circulation and ocean ventilation are crucial drivers of Earth\u2019s climate system. Ocean ventilation is the process by which surface waters, recently in contact with the atmosphere, are injected into the ocean interior and transported away from the source (aging of water masses). Solubility, biological, and alkalinity pumps are the main mechanisms that foster the storage of roughly 50 times more carbon in the deep-sea compared to the atmosphere22, leaving their importance in particular enigmatic. Inconsistencies in glacial and deglacial ventilation records may at least partly be the result of using foraminiferal radiocarbon dates relative to the atmosphere. Cold-water corals (CWC) have been shown to serve as a robust archive for several geochemical proxies30 in particular for the thermocline and deeper waters. Their aragonite skeletons contain relatively high concentrations of uranium, allowing accurate age determination through 230Th/U dating26. Combined 230Th/U and 14C measurements enable us to determine past ocean 14C/12C ratios and thus are a proxy for accurate and precise \u220614C and corresponding ventilation ages30. Moreover, CWC aggradations often occur near the boundaries of thermocline and intermediate waters, which are sensitive to large-scale oceanographic perturbations31.Reconstructions of thermocline and intermediate water ventilation are still sparse and often exhibit conflicting results230Th/U and 14C measurement on CWCs retrieved from thermocline waters  at 450\u00a0m water depth off the Maldives in the equatorial Indian Ocean32  14C ventilation ages for each sample . Finally, we compare our results with glacial radiocarbon simulations applying an ocean general circulation model including \u220614C32. The Indian Ocean is only ventilated from the south and thus a cul de sac, making it an important compartment for thermohaline circulation and especially for reconstructing past \u220614C of thermocline waters originating in the Southern Oceans  are systematically older and reveal ages from 22.071\u00a0ka to 23.503\u00a0ka  Marine2034 curve at their corresponding calendar ages  values as low as \u2212\u2009250\u2030 to \u2212\u2009345\u2030 , corresponding to Batm ages of up to 2100\u00a0years. The observed variability in Batm ages cannot be related to species, but tend to cluster with higher Batm ages at the slightly deeper site , although both are only\u2009<\u2009100\u00a0km apart from each other and are both located on the eastern side of the Maldives.In accordance to previous results\u00a0ka Fig.\u00a0. Our dat14C and Batm values for the Indian Ocean thermocline at the LGM are similar to those observed off Tasmania in far deeper water depths of 1430\u20131950\u00a0m, off SW-Australia in water depth as deep as 1788\u00a0m and from the Drake Passage  values and Batm ages broadly agree with the radiocarbon simulations but some discrepancies are visible .For further analysis, we simulated the temporal evolution of radiocarbon in the equatorial thermocline. Our coral based \u2206\u2206ble Fig.\u00a0 and 2s. 14C simulations for the LGM were roughly consistent with benthic 14C values reconstructed on other locations41, our new data from the Indian Ocean highlights that the 14C history of glacial thermocline waters is complex. Thermocline waters are at the transient zone between the surface mixed layer and the deep-ocean. Especially in the glacial ocean, where deeper waters stored additional radiocarbon depleted carbon11, the equatorial thermocline of the Indian Ocean tends to reflects both atmospheric \u220614C and deep ocean \u220614C. However, even if radiocarbon depleted but carbon rich deep-water reservoirs are a pervasive feature of the glacial ocean, high ventilation ages in near surface waters are a difficult phenomenon to explain. In the following, we consider three hypotheses that could explain the variability and depletion of 14C reconstructed for the glacial thermocline of the Indian Ocean: (1) in-situ aging, (2) advection of 14C-depleted mid-depth water masses, as well as (3) local upward mixing of 14C-depleted carbon.This indicates that the simulations underestimate the past radiocarbon variability of the Indian Ocean thermocline. While previous 33 and Marine2034 \u220614C curves as expected for thermocline water masses that have been in contact with the atmosphere. However, the observed variability in ventilations ages suggest a strong but variable aging of thermocline waters. Can the observed radiocarbon decline be explained by an in-situ aging from an isolated thermocline water? We discount this hypothesis for the following reasons, (a) our sites here are not horizontally isolated from other ocean basins, (b) in-situ aging is at odds with the amplitude and rapidity of our reconstructed \u2206\u220614C variations (about 300\u2030 within 1500\u00a0years).Lowest ventilation ages recorded in our dataset plot near or in-between the Intcal2014C record could be explained by the advection of southern sourced mode waters17. Here, the principal mechanism is the upwelling of carbon and nutrient-rich water in the Southern Ocean, which is subsequently transported to the equatorial thermocline by the Antarctic Intermediate Water (AAIW) and the Subantarctic Mode Water (SAMW)17. In the Equatorial Pacific, the advection of such Southern Ocean radiocarbon depleted waters was synchronous with deep-water ventilation changes22. However, even though this mechanism has been proposed for periods of abrupt climatic perturbations such as the Younger Dryas and Heinrich Stadials I and II, reconstructed ventilation ages of the intermediate northern Indian Ocean do not exhibit any larger excursions during the LGM17. Further evidence comes from a neodymium isotope based reconstructions showing, that advances of AAIW in the equatorial Indian Ocean are restricted to the deglaciation and did not occur during the LGM42.The decadal to centennial scale variability seen in our 43. However, the amplitude of our reconstructed ventilation changes rather supports the hypothesis of altered glacial deep-sea overturning and increased CO2 storage, as recently suggested by a comprehensive compilation of glacial deep-sea 14C records11.It has been suggested that increased glacial reservoir ages could be related to decreased air-sea equilibration during the LGMNevertheless, with the present dataset we cannot rule out that radiocarbon depleted mid-depth waters, either SAMW or AAIW, may have partly contributed to the observed variability in the thermocline ventilations ages.44, modern Indian Deep Water (IDW) is formed from abyssal waters such as Antarctic Bottom Water via diapycnal mixing in the interior45., thereby increasing the volume of southern sourced water masses at shallower water depths  have been identified in the (SW) Pacific Ocean39, but also in the northern deep and abyssal Indian Ocean by using fossil foraminiferal \u220614C ages53. These extremely old deep- and abyssal water masses may thus be the most likely potential radiocarbon depleted source to cause, by upward mixing with the overlying water mass, the accumulation of 14C-depleted DIC in the equatorial thermocline of the Indian Ocean  of 14C data points towards extensive, but variable mixing of the Indian Ocean equatorial thermocline with extremely 14C-depleted abyssal waters. Our study therefore shows that the deep Indian Ocean carbon reservoir, although temporally restricted, expanded to thermocline waters and thus contributed to the drawdown of atmospheric CO2 at the end of the last glacial period. The dynamic nature of this oceanographic phenomenon suggest that this extended carbon pool is regionally variable. Accordingly, future studies should intensively try to identify regional differences and depth constraints of carbon pool extension especially in the Indian Ocean.Taken together, our new equatorial thermocline Indian Ocean 32 revealed calibrated ages near the LGM between 22.54 and 21.4\u00a0ka. Thus, this sample set provides the unique opportunity to study ventilation ages at thermocline depth of the equatorial Indian Ocean during the LGM. Well-preserved coral skeletons  were cleaned mechanically in order to remove potential containments . Samples have been screened for their mineralogy with a PANalytical X\u2019Pert PRO diffractometer, equipped with a copper X-ray tube revealing that all samples remained in their initial aragonitic mineralogy.This study analysed scleractinian cold-water corals retrieved during research cruise SO236 to the Maldives Archpielago. In particular, coral samples were collected by a video-guided grab and a box corer in the Vaadhoo Channel  and the Kardiva Channel  on a multi-collector inductively coupled plasma mass spectrometer 28. The reference material HU-1 was measured for the reproducibility assessment of the mass-spectrometry measurements54. Note, we assume HU-1 to be in secular equilibrium, which contrasts with observations by ref54 and causes a 1.5\u2030 difference in the absolute value of \u03b4234U. For age determination this difference has no consequence, as we use the half-lives of ref54 for age determination, hence we presume a different isotopic composition for our batch of HU-1 if compared to the data published by ref54. In total, 13 samples were analysed revealing all only minor residual contaminations (232Th\u2009<\u20094\u00a0ppb). Nevertheless, an initial 230Th correction was applied prior to age calculations using a 230Th/232Th activity ratio for the upper thermocline waters of 8\u2009\u00b1\u2009418. Age determinations and uncertainty assessment were carried out using iterative solution of the decay equations and error propagation using Monte Carlo simulations26. The initial 234U/238U activity ratios of all measured corals are, when transferred into \u03b4234U notation , within uncertainty in a narrow band of\u2009\u00b1\u200910\u2030 compared to the value of modern seawater (145.0\u2009\u00b1\u20091.5\u203055), suggesting a closed system behaviour for the exchange of U between the skeletons and seawater.Samples were chemically cleaned in a weak acid leach2 from the CWC samples was carried out at the IUP, Heidelberg University, Germany, following the method described in56. The final iron\u2013graphite compound was measured on an accelerator mass spectrometer  at the Curt-Engelhorn-Center Archaeometry (CEZA), Mannheim, Germany58. Calculation of \u220614C, \u2206\u220614C and Benthic-Atmosphere (Batm) ages 30 is based on IntCal2033.The extraction of CO14C values simulated using an enhanced version of the Hamburg Large Scale Geostrophic ocean general circulation model59; for the enhancements and implementation of \u220614C see refs.61 and further references therein. The model has an effective horizontal resolution of 3.5\u00b0 and 22 layers in the vertical. It considers recent (PD), cold stadial (CS) and glacial (GS) climatic background conditions which result in upper and lower ocean ventilation intensities. The simulations were carried out with transient values of atmospheric \u220614C34 and pCO262 evaluated nearest to the coral sites.The radiocarbon measurements were compared with \u2206Supplementary Figures.Supplementary Table 1.Supplementary Table 2."
\ No newline at end of file